Next Article in Journal
The Impact of Growth Years on the Medicinal Material Characteristics and Metabolites of Stellaria dichotoma L. var. lanceolata Bge. Reveals the Optimal Harvest Age
Next Article in Special Issue
Analysis and Identification of Genes Associated with the Desiccation Sensitivity of Panax notoginseng Seeds
Previous Article in Journal
Magnolin Inhibits Paclitaxel-Induced Cold Allodynia and ERK1/2 Activation in Mice
Previous Article in Special Issue
Integrated Analysis of miRNAome and Transcriptome Identify Regulators of Elm Seed Aging
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 12
Issue 12
10.3390/plants12122284
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of OsAOX1a Deficiency on Mitochondrial Metabolism at Critical Node of Seed Viability in Rice

by
Jing Ji
1,†,
Shuangshuang Lin
1,2,†,
Xia Xin
1,
Yang Li
1,
Juanjuan He
1,
Xinyue Xu
1,
Yunxia Zhao
1,
Gefei Su
1,3,
Xinxiong Lu
1,* and
Guangkun Yin
1,*
1
National Crop Genebank, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
Institute of Agricultural Bioresource, Fujian Academy of Agricultural Sciences, Fuzhou 350003, China
3
College of Biological Science, China Agricultural University, Beijing 100193, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Plants 2023, 12(12), 2284; https://doi.org/10.3390/plants12122284
Submission received: 13 April 2023 / Revised: 29 May 2023 / Accepted: 8 June 2023 / Published: 12 June 2023
(This article belongs to the Special Issue Seed Aging Mechanism)
Browse Figures
Review Reports Versions Notes

Abstract

:
Mitochondrial alternative oxidase 1a (AOX1a) plays an extremely important role in the critical node of seed viability during storage. However, the regulatory mechanism is still poorly understood. The aim of this study was to identify the regulatory mechanisms by comparing OsAOX1a-RNAi and wild-type (WT) rice seed during artificial aging treatment. Weight gain and time for the seed germination percentage decreased to 50% (P50) in OsAOX1a-RNAi rice seed, indicating possible impairment in seed development and storability. Compared to WT seeds at 100%, 90%, 80%, and 70% germination, the NADH- and succinate-dependent O2 consumption, the activity of mitochondrial malate dehydrogenase, and ATP contents all decreased in the OsAOX1a-RNAi seeds, indicating that mitochondrial status in the OsAOX1a-RNAi seeds after imbibition was weaker than in the WT seeds. In addition, the reduction in the abundance of Complex I subunits showed that the capacity of the mitochondrial electron transfer chain was significantly inhibited in the OsAOX1a-RNAi seeds at the critical node of seed viability. The results indicate that ATP production was impaired in the OsAOX1a-RNAi seeds during aging. Therefore, we conclude that mitochondrial metabolism and alternative pathways were severely inhibited in the OsAOX1a-RNAi seeds at critical node of viability, which could accelerate the collapse of seed viability. The precise regulatory mechanism of the alternative pathway at the critical node of viability needs to be further analyzed. This finding might provide the basis for developing monitoring and warning indicators when seed viability declines to the critical node during storage.

1. Introduction

Mitochondrial redox homeostasis is a key factor affecting seed viability. During the imbibition process of seeds with high viability, the number of mitochondria, as well as the inner membrane and cristae of the mitochondria are significantly improved, and proteins and genes involved in energy and material metabolism, enzyme activity of TCA cycle, electron transport chain and oxidative phosphorylation are also significantly improved [1,2]. However, in the process of seed aging, there are a number of deleterious changes that inhibits the repair of mitochondrial structure and function; the total number of mitochondria (the outer membrane and inner membrane) are difficult to distinguish, and membrane integrity+ decrease the number of matrix, cristae is less than that of high viability seeds and the shape is irregular. The proportion of mitochondria increased and the motility decreased, and the physiological functions, such as electron transport chain, oxidative phosphorylation and marker enzymes, were also lower than normal seeds, and mitochondrial cytochrome c was released into the cytoplasm, inducing programmed cell death [3,4,5].
With the decrease in seed viability, the activities of superoxide dismutase, ascorbate peroxidase, monodehydroascorbate reductase and glutathione reductase of mitochondrial antioxidant system have also been shown to decrease significantly. Moreover, the total amount of ascorbic acid and glutathione decrease, and the ratio of oxidized forms also decrease significantly, resulting in the accumulation of reactive oxygen species (ROS) [6,7]. The accumulation of ROS oxidizes lysine, arginine, and proline in the protein side chain, resulting in protein carbonylation modification, inducing protein peptide chain breakage, and the change of the oxidation site to carbonyl [8]. Carbonylation then causes changes in protein structure and loss of function, which are easily degraded by hydrolases, leading to physiological and metabolic disorders of cells and tissues, aging or death [9]. Researchers have shown that when rice seed viability drops to the level of the critical node (CN, 85% germination), ROS accumulate and attack lipids, and 4-HNE and other carbonyl small molecules accumulate, resulting in the production of mitochondrial ATP synthase, malate dehydrogenase, and succinate dehydrogenase. The protein undergoes carbonylation modification, which inhibits the ATP supply required for seed germination [10,11].
Mitochondrial redox homeostasis is closely related to the mitochondrial electron transport chain (mETC). mETC in plants is associated chiefly with the cytochrome pathway and alternate oxidase pathway. In the cytochrome pathway, electrons are transferred from reduced substrates (NADH and succinate) to Complex I or Complex II, and then to ubiquinone, Complex III, cytochrome c (Cyt c), Complex IV, and subsequently, the transfer of electrons to O2 which generates H2O, while protons are pumped from the mitochondrial matrix to the mitochondrial intermembrane space, forming proton kinetic potential on both sides of the inner membrane, thereby driving the synthesis of ATP [12,13]. Under stress, the cytochrome pathway is inhibited, the oxidative capacity of NADH is reduced, the transfer of electrons to ubiquinone is inhibited, the proportion of oxidized ubiquinone is increased, and the transfer of electrons to O2 generates O2−, resulting in oxidative damage, At the same time, it induces the alternative oxidase(AOX) pathway, which facilitates electron transfer to AOX, and the pumping of protons from the mETC membrane arm to generate ATP [14,15,16].
AOX is involved in clearing ROS in the mitochondria [17]. When AOX activity is inhibited, mitochondrial ROS levels increase significantly, whereas overexpression of AOX can enhance the activity of the ROS clearance system [18,19]. AOX can reduce excessive ROS production by regulating electron transfer in the mitochondrial complex. Tobacco plants lacking in AOX were severely inhibited in cell respiration, and showed a significant increase in apoptosis after treatment with H2O2, salicylic acid, and other agents [20]. In contrast, wild-type tobacco showed a significant increase in AOX content, maintaining a high respiratory rate and inhibiting ROS production [20]. Kühn et al. [21] reported the molecular mechanism by which the redox homeostasis of aox1a mutants regulates the cytochrome pathway and the AOX pathway under stress in Arabidopsis.
Different plants contain different numbers of AOX genes. For example, the rice genome contains four AOX genes, OsAOX1a, OsAOX1c, OsAOX1d (previously named OsAOX1b), and OsAOX1e [22,23]. Moreover, five AOXs (AtAOX1a–d and AtAOX2) have been identified in Arabidopsis, while HvAOX1a, HvAOX1c, HvAOX1d1 and HvAOX1d2 have been identified in barley [24,25]. AOX genes expression are regulated by a number of factors, such as temperature, light, and nutrient availability, among others. AOX1a plays an important role in response to stress in both Arabidopsis and rice. AOX1c is expressed in all plant developmental stages at a very low level, while AOX1d is expressed during the early vegetative stage, flowering, and in senescent leaves [26]. AOX1e is not a well-known AOX isoform, and little is known about its specific role in plant metabolism and stress response.
It has been reported that the redox homeostasis of the critical node of rice seed viability was significantly altered, inhibiting the cytochrome pathway, and the expression of OsAOX1a was significantly up-regulated compared to gene expression in unaged seeds. Furthermore, the expression of the core subunit of the membrane arm of the mETC complex I was significantly up-regulated, electron and proton transfer ability was improved, and ATP generation was maintained [5,27]. Previous work confirmed that the cytochrome pathway, the accumulation of ROS, and mitochondrial protein carbonylation are the processes that are inhibited during the critical node of rice seed viability, however, AOX1a can be induced to maintain mitochondrial redox homeostasis and enhance the function of ATP generation. Given that the molecular mechanisms underlying rice seed conservation are still unclear, this study will explore the regulatory mechanism of rice seed conservation longevity from the perspective of mitochondrial activity regulation using wild-type and OsAOX1a-RNAi rice seeds for artificial aging.

2. Results

2.1. Comparison of Survival Curves between WT and OsAOX1a-RNAi Seeds after Aging Treatment

We found that the grain length is smaller in seeds with lower levels of OsAOX1a expression (Figure 1a). Compared with WT seeds, the seed width, length, and 100-grain weight of OsAOX1a-RNAi seeds had decreased by 1.9%, 2.2% and 8.2%, respectively (Figure 1b–d). These results show that the accumulation of dry matter in OsAOX1a-RNAi seeds was less than that in the WT seeds.
The initial germination rates of the WT and OsAOX1a-RNAi seeds were 98.5% and 96.5%, respectively. Under artificial aging treatment at 40 °C and 75% relative humidity for 30 d, the survival curves of each of the two groups showed the typical inverse S-shaped curve with an initial plateau phase transition state (known as the critical node (CN)), followed by a rapid decline in viability. The shape of the survival curve and most importantly, the time point at which seed survival (germination) declined to 50% (P50), differed between the two groups (Figure 2). The plateau phase of the survival curve was similar between the WT and OsAOX1a-RNAi groups. The germination rate of each of the two types of seed fell gradually to 90.0%, 80.0% and 70.0% after 6, 9, and 12 d of artificial aging treatment (Figure 2a), respectively. However, the vigor index of OsAOX1a-RNAi seeds during AA treatment was always significantly lower than that of the WT group (Figure 2b). Furthermore, once the critical node was reached (at 12 days of aging), the germination rate of the OsAOX1a-RNAi seeds began to decline rapidly compared to the WT seeds. The time required for the seed germination percentage to decrease to 50% (P50) was estimated to be 13.6 d for OsAOX1a-RNAi and of 14.8 d WT seeds. These results indicated that the storability of OsAOX1a-RNAi seeds significantly decreased compared to the WT seeds.

2.2. Assessment of Mitochondria Status during Artificial Aging Treatments

To gain deeper insight into the differences in mitochondria status between OsAOX1a-RNAi and WT seeds during artificial aging treatments, mitochondria were extracted from seeds that were allowed to imbibe for 48 h at 100%, 90%, 80%, and 70% germination, respectively. The mitochondrial electron transport capacity was evaluated by monitoring NADH and succinate-dependent O2 consumption (Table 1). The respiratory rate of mitochondrial significantly decreased with the decrease in seed viability in both seed groups. Compared to the WT seeds at 100%, 90%, 80%, and 70% germination, the NADH-dependent O2 consumption of the OsAOX1a-RNAi seeds decreased by 62%, 61%, 70% and 53%, respectively; the succinate-dependent O2 consumption were decreased by 21%, 28%, 54% and 19%, respectively. In addition, we measured the abundance of AOX1 and Cyt c, which plays a crucial role in mitochondrial electron transport (Figure 3). Compared to the WT seeds, the abundance of AOX1 and Cyt c in the OsAOX1a-RNAi seeds was always lower during the artificial aging treatment. These results suggested that the capacity for electron transport was inhibited in the mitochondria of the OsAOX1a-RNAi seeds after imbibition, indicating a decrease in ATP supply.
In addition, the mitochondrial malate dehydrogenase (MDH) activity and ATP content were measured for both the OsAOX1a-RNAi and WT seeds at 100%, 90%, 80% and 70% germination. MDH activity and ATP content were found to decrease significantly with the decrease in seed viability in both the seed groups (Figure 4). However, compared to the WT seeds, the MDH activity of the OsAOX1a-RNAi seeds decreased by 14.4%, 14.3%, 13.18% and 24.8%, at 100%, 90%, 80%, and 70% germination, respectively, while ATP content decreased by 47.2%, 60.5%, 53.8% and 51.8%, respectively. These results indicate that the mitochondrial metabolism in the OsAOX1a-RNAi seeds after imbibition was weaker than that of the WT group.

2.3. The Abundance of Complex I Subunits during Artificial Aging Treatments

Mitochondrial electron transfer chain Complex I is upstream of the AOX pathway and is classified into five functional sections: N module, Q module, P module, CA domain and GLDH domain. The abundance of Complex I subunits was compared between OsAOX1a-RNAi and WT seeds at germination rates of 100%, 90%, 80% and 70% (Figure 5).
In the OsAOX1a-RNAi seeds, the abundance of 75 kDa and 51 kDa subunits, the core subunits in the N module, were always lower than the corresponding values in the WT seeds during the artificial aging treatment. In addition, the abundance of the 75 kDa subunit in the WT seeds did not significantly change during the aging treatment, however, that in the OsAOX1a-RNAi seeds was gradually down-regulated. The abundance of the 51 kDa subunit was down-regulated during treatment, however, the corresponding value in the OsAOX1a-RNAi seeds was too low to be resolved. Together, these results indicate that the capacity of electron transfer in OsAOX1a-RNAi was inhibited, especially at the time point of critical node of seed viability.
The abundance of the Nad3, Nad4, Nad4L and Nad6 subunits, the core subunits in the P module, showed different patterns between the OsAOX1a-RNAi and WT seeds during the aging treatment. The abundance of Nad4 subunit was too low to be resolved in either of the two seed groups. The abundance of Nad3 and Nad6 subunits in the OsAOX1a-RNAi seeds was always higher than that in the WT seeds during aging treatment. In addition, the abundance of Nad3 did not significantly change, and the abundance of Nad6 was gradually down-regulated in both the seed groups during the aging treatment. The abundance of the Nad4L subunit in the OsAOX1a-RNAi seeds was always lower than that in the WT during the aging treatment. In addition, the abundance of Nad4L subunit in the WT seeds was gradually down-regulated during the aging treatment, but was not significantly changed in the OsAOX1a-RNAi seeds.
The abundance of the 39 kDa subunit and the Nad7 subunit, the core subunits in the Q module, was always higher in the OsAOX1a-RNAi seeds than in the WT seeds during the aging treatment. The subunits of GLDH and γ-carbonic anhydrase (γ-CA) are the non-conserved subunits of Complex I. The abundance of GLDH subunit was gradually up-regulated in both types of seeds during the treatment. The abundance of the γ-CA subunit in the OsAOX1a-RNAi seeds was always lower than that in the WT during the aging treatment.

3. Discussion

3.1. Low AOX1a Impaired Seed Development and Storability

AOX1a plays an extremely important role in maintaining growth and promoting plant survival under adverse conditions. Many studies have shown that the expression of AOX1a is up-regulated during a number of critical processes in plant growth and development, including seed germination, stress response, flowering and pollination [16,28,29]. The expression level of AtAOX1a under suitable conditions had no significant effect on plant vegetative growth, but under low temperature condition, the growth of AtAOX1a mutant leaves was shown to be slower and weaker than that of the WT group [30]. Similarly, ripening, respiration, and ethylene production were severely impaired in transgenic LeAOX-RNAi tomato plants [31]. In this study, the seed width, length, and 100-grain weight of OsAOX1a-RNAi seeds were all less than the corresponding measures in the wild-type seeds (Figure 1). The dry matter accumulation of seeds was found to be positively correlated with the expression level of OsAOX1a, and the down-regulation of OsAOX1a impaired the regulation of cell life activities and seed development. Although the germination percentage of OsAOX1a-RNAi rice seeds after being aged 3, 6 and 9 d did not show a significant difference compared to that of the WT group, the vigor index of OsAOX1a-RNAi seeds during the aging treatment was always significantly lower than that of the WT group (Figure 2). In addition, the P50 of WT is significantly longer than that of OsAOX1a-RNAi seeds. These results indicated that the down-regulation of OsAOX1a ultimately reduced seed storability. Regulating the expression of AOX1a to adapt to various stresses in the growth environment can help promote plant growth and developmental stability [32,33,34]. However, OsAOX1a-RNAi plant is unable to regulate the expression of OsAOX1a to cope with various stresses encountered during natural growth conditions. Therefore, it can be concluded that AOX1a is closely involved in the regulation of seed development and storability of the seeds.

3.2. Low AOX1a Impaired Mitochondrial Activity during Seed Imbibition

AOX1a is a key component in the mitochondrial alternative chain, whose inactivation could lead to a different response [35,36]. In the present study, we found that in the OsAOX1a-RNAi seeds, compared to the WT seeds, the NADH- and succinate-dependent O2 consumption were both reduced during the artificial aging treatment, and the expressions of the abundances of AOX1 and Cyt c were inhibited (Table 1 and Figure 3). These results are consistent with the fact that the respiratory capacity of AOX1a mitochondria was significantly restricted by the impairment of the alternative-terminal oxidase, the cytochrome oxidase, or both [21,37]. Compared to our previous study, the capacity of O2 consumption of the pure mitochondria was higher than the crude mitochondria in the present study, which were isolated from the imbibed rice seed after artificial aging treatment. In addition, the MDH activity and ATP content were reduced in the OsAOX1a-RNAi seeds compared to the WT seeds during treatment (Figure 4). These results are consistent with the reported lower activity of the malate-oxaloacetate shuttle in the AOX1a mutant compared to the WT seeds [38]. MDH catalyzes the interconversion of malate and oxaloacetate in mitochondria [39,40]. MDH activity was shown to be reduced in rice seeds during artificial aging treatment [5]. These results indicate that ATP production was severely inhibited in the OsAOX1a-RNAi seeds at the critical node of viability. ATP supply was the core factor for seed germination. The insufficient supply of ATP in OsAOX1a-RNAi seeds at the critical node of viability might lead to a rapid loss of seed viability. AOX1a was important to maintain mitochondrial ETC and energy performance [41]. When considering the published findings as well as the results of the current study, it appears that mitochondrial metabolism may be inhibited in the OsAOX1a-RNAi seeds after imbibition.

3.3. Low AOX1a Altered Mitochondrial Electron Transfer Chain Complex I during Seed Imbibition

In our previous study, the alternative pathway of ETC was significantly induced, whereas the cytochrome pathway was inhibited at the critical node of seed viability in rice [5]. Complex I is the entry site for electrons into the ETC through the oxidation of NADH, which is composed of multiple subunits, including three core modules: N (NADH oxidation site) and Q (ubiquinone reduction site) modules, and P (proton transfer site) module [42,43,44]. When Complex I activity is inhibited, the subunits of NADH dehydrogenase II belonging to the P module, and AOX are upregulated under stress conditions, thus forming an alternative pathway for maintaining cellular respiration and energy supply [45,46]. Our previous study had shown that the P module was significantly induced, whereas the N module was inhibited at the critical node of seed viability in rice [27]. In the present study, we also found that the core subunits of the N module were down-regulated, whereas the subunits of the P module were up-regulated in both OsAOX1a-RNAi and WT at critical node of seed viability (Figure 5). AOX and the subunits of the N module display dramatic and coordinated responses to stress treatments [47,48]. However, the abundance of Complex I subunits of the WT seeds was higher than that of the OsAOX1a-RNAi seeds, which suggests that the capacity of ETC of the WT seed was significantly higher than that of OsAOX1a-RNAi seed at the critical node of seed viability; therefore, the capacity of ATP production in the WT seeds was higher than that in the OsAOX1a-RNAi seed seeds. This might be the reason for the more rapid loss of viability of the OsAOX1a-RNAi seeds compared to the WT after critical node.

4. Materials and Methods

4.1. Materials and Treatments

The seeds of Japonica rice (Oryza sativa L. ssp. Japonica cv. “Nipponbare”) were used in this study. In order to generate the interfering OsAOX1a construct, a 379-bp fragment was amplified from OsAOX1a full-length cDNA (AB004864), and then the fragment and its inverted repeat fragment were inserted downstream of a maize ubiquitin promoter at the BamHI (NEB), SacI (Takara Bio), KpnI (NEB), and SpeI (Promega) restriction sites of the modified pTCK303 vector [49]. Transgenic plants were generated by the constructs were transferred to Agrobacterium tumefaciens (strain EHA105), and were transformed into rice callus according to the method of Hiei et al. [50], which resulted to be positive in real-time PCR testing via HygR gene. The primers are shown in Table 2. Wild-type and transgenic lines were grown in the research fields located in the Hainan province under natural conditions.
The seeds were sealed in an aluminum foil bag at 40 °C for 7 days to break dormancy. The seed germination rate (%)and the vigor index were determined at 28 °C after 7 d in the dark. Artificial aging treatment was performed at 40 °C and 75% relative humidity for 21 days [5]. The aging curve was characterized by seeds withdrawn from the treatment every 3 days for each of the two genotypes (WT and OsAOX1a-RNAi). The time taken for the seed germination rate to decrease to 50% (P50) was calculated using the Avrami equation with OriginPro software 2021 [51].

4.2. Crude Mitochondria Purification

For mitochondrial purification, rice seeds were allowed to imbibe at 28 °C for 48 h in the dark, after which 1200 embryos were homogenized in grinding buffer (0.3 M mannitol, 2 mM EGTA, 0.5% (w/v) polyvinypyrrolidone-40, 0.5% (w/v) bovine serum albumin (BSA), 20 mM cysteine, pH 7.5) and the mixture was centrifuged at 2000× g for 5 min. The supernatant was removed, and the pellet was resuspended in a wash buffer (0.3 M sucrose, 10 mM TES, pH 7.5) and centrifuged again at 2000× g for 5 min. The resulting supernatant was collected and centrifuged at 12,000× g for 15 min. The supernatant was then discarded, and the pellet was resuspended in the wash buffer. The mixture was centrifuged at 2000× g for 5 min, the supernatant was removed, and the mixture was centrifuged again at 12,000× g for 15 min to obtain the mitochondria, from which 4 mg mitochondrial protein could be extracted. Each step of the experiment was performed at 4 °C, and the mitochondria were stored at −80 °C.

4.3. Mitochondrial Respiration Rate Assay

Mitochondrial respiration rate was measured using an oxygen electrode (Hansatech, Norwich, UK). Mitochondria (1 mg mitochondrial protein) was added to 1 mL of reaction solution containing 0.3 M sucrose, 10 mM TES-KOH (pH 7.5), 5 mM KH2PO4, 10 mM NaCl, 2 mM MgSO4 and 0.1% (w/v) BSA, and was maintained at 20 °C. NADH (10 mM), succinic acid (10 mM) and ADP (0.8 mM) were added according to the procedures reported by Logan et al. [52].

4.4. ATP Content Determination

ATP content was determined using ATP Content Assay Kit (Solarbio, Beijing, China) according to the instructions of the manufacturer. Mitochondria pellets were resuspended in 1 mL extraction buffer and centrifuged at 10,000× g for 10 min, after which 500 μL chloroform was added to the supernatant, and the mixture was centrifuged at 10,000× g for 3 min. The supernatant was collected for ATP detection.

4.5. Mitochondrial Malate Dehydrogenase Activity

Mitochondrial malate dehydrogenase activity was based on the reversible reaction of NAD+ oxidizing L-malic acid to oxaloacetate, which was determined by monitoring the increase in absorbance at 340 nm and 25 °C, and 0.5 mg of mitochondrial protein was added to the reaction solution (0.1 M potassium phosphate, pH 7.5, 0.2 mM NADH, and 5 mM oxaloacetic acid).

4.6. Western Blot t Analysis

The mitochondria protein was extracted from the mitochondrial pellets at 4 °C in the extraction buffer (Tris-HCl, pH 7.5, 2 mM EDTA, 1% (w/v) PVP40, and 1 mM DTT), and centrifuged at 20,000× g for 15 min. The supernatant was collected and centrifuged at 20,000× g for 15 min again. Equal amounts of mitochondrial protein (10 μg per lane) were loaded onto 12% SDS-PAGE gels and transferred to PVDF using the Mini Trans-Blot cell electrophoresis apparatus (Bio-Rad, California, USA). The blotted membrane was blocked for 4 h at room temperature in the Tris-Buffered Saline with Tween-20 buffer (50 mM Tris-HCl, pH 8.2, 0.1% (v/v) Tween 20, and 150 mM NaCl) with 2% low-fat milk, and then incubated for 2 h after adding 1:2000 purified protein-specific primary antibody: Nad4, Nad4L, Nad6, and Nad7 (Beijing Protein Innovation, Beijing, China); 51 kDa, 75 kDa, 18 kDa, and 39 kDa (Phytoab, Kansas, USA); and Cyt c, AOX1, Nad3, GLDH, and γ-CA (Agrisera, Vännäs, Sweden). A secondary antibody was the anti-rabbit IgG (Agrisera, Vännäs, Sweden) conjugated with horseradish peroxidase diluted 1:5000. LI-COR Odyssey dual-color infrared fluorescence imaging system (LI-COR Biosciences, Nebraska, USA) was used for imaging.

4.7. Statistical Analyses

All data were analyzed as a one-variable general linear model procedure (analysis of variance) via SPSS (SPSS Inc., Chicago, IL, USA). Differences between OsAOX1a-RNAi transgenic plants and WT controls detected using the Student’s t-test at the level of p < 0.05, 0.01, and 0.001 were considered as significant, and were labeled as *, **, and ***, respectively.

5. Conclusions

In conclusion, we explored the biological mechanisms of rice seed viability at the critical node, with the goal of providing a scientific basis for improved seed conservation. The key finding of this study is that seed development and storability was shown to be impaired in OsAOX1a-RNAi seeds. In addition, mitochondrial metabolism and alternative pathways were severely inhibited in OsAOX1a-RNAi seeds at the critical node of viability. An insufficient level of ATP was available after imbibition, which led to the accelerated decrease in seed viability, compared to the wild type.

Author Contributions

G.Y. and X.L. designed the research. J.J., S.L., J.H., X.X. (Xinyue Xu) and Y.Z. performed experiments, G.Y., J.J. and G.S. analysed the results. G.Y. and X.L. wrote the paper, X.X. (Xia Xin), Y.L. helped with editing the paper before submission. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Key Research and Development Program of China (2021YFD1200501).

Data Availability Statement

The data presented in this study are available on reasonable request. from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Carrie, C.; Murcha, M.W.; Giraud, E.; Ng, S.; Zhang, M.F.; Narsai, R.; Whelan, J. How do plants make mitochondria? Planta 2013, 237, 429–439. [Google Scholar] [CrossRef] [PubMed]
  2. Law, S.R.; Narsai, R.; Taylor, N.L.; Delannoy, E.; Carrie, C.; Giraud, E.; Millar, A.H.; Small, I.; Whelan, J. Nucleotide and RNA metabolism prime translational initiation in the earliest events of mitochondrial biogenesis during Arabidopsis germination. Plant Physiol. 2012, 158, 1610–1627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Xin, X.; Tian, Q.; Yin, G.; Chen, X.; Zhang, J.; Ng, S.; Lu, X. Reduced mitochondrial and ascorbate-glutathione activity after artificial ageing in soybean seed. J. Plant Physiol. 2014, 171, 140–147. [Google Scholar] [CrossRef]
  4. Wang, Y.; Li, Y.; Xue, H.; Pritchard, H.W.; Wang, X. Reactive oxygen species-provoked mitochondria-dependent cell death during ageing of elm (Ulmus pumila L.) seeds. Plant J. 2015, 81, 438–452. [Google Scholar] [CrossRef]
  5. Yin, G.; Whelan, J.; Wu, S.; Zhou, J.; Chen, B.; Chen, X.; Zhang, J.; He, J.; Xin, X.; Lu, X. Comprehensive mitochondrial metabolic shift during the critical node of seed ageing in rice. PLoS ONE 2016, 11, e0148013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Li, Y.; Wang, Y.; Xue, H.; Pritchard, H.W.; Wang, X. Changes in the mitochondrial protein profile due to ROS eruption during ageing of elm (Ulmus pumila L.) seeds. Plant Physiol. Biochem. 2017, 114, 72–87. [Google Scholar] [CrossRef] [PubMed]
  7. Sun, H.; Li, L.; Wang, X.; Wu, S.; Wang, X. Ascorbate-glutathione cycle of mitochondria in osmoprimed soybean cotyledons in response to imbibitional chilling injury. J. Plant Physiol. 2011, 168, 226–232. [Google Scholar] [CrossRef]
  8. Stadtman, E.R.; Levine, R.L. Free radical-mediated oxidation of free amino acids and amino acid residues in proteins. Amino Acids 2003, 25, 207–218. [Google Scholar] [CrossRef]
  9. Ramallo Guevara, C.; Philipp, O.; Hamann, A.; Werner, A.; Osiewacz, H.D.; Rexroth, S.; Rögner, M.; Poetsch, A. Global protein oxidation profiling suggests efficient mitochondrial proteome homeostasis during aging. Mol. Cell Proteom. 2016, 15, 1692–1709. [Google Scholar] [CrossRef] [Green Version]
  10. Yin, G.; Xin, X.; Fu, S.; An, M.; Wu, S.; Chen, X.; Zhang, J.; He, J.; Whelan, J.; Lu, X. Proteomic and carbonylation profile analysis at the critical node of seed ageing in Oryza sativa. Sci. Rep. 2017, 7, 40611. [Google Scholar] [CrossRef] [Green Version]
  11. Fu, S.; Yin, G.; Xin, X.; Wu, S.; Wei, X.; Lu, X. Levels of crotonaldehyde and 4-hydroxy-(E)-2-nonenal and expression of genes encoding carbonyl-scavenging enzyme at critical node during rice seed aging. Rice Sci. 2018, 25, 152–160. [Google Scholar]
  12. Millar, A.H.; Whelan, J.; Soole, K.L.; Day, D.A. Organization and regulation of mitochondrial respiration in plants. Annu. Rev. Plant Biol. 2011, 62, 79–104. [Google Scholar] [CrossRef] [PubMed]
  13. Moller, I.M. Plant mitochondria and oxidative stress: Electron transport, NADPH Turnover, and metabolism of reactive oxygen species. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001, 52, 561–591. [Google Scholar] [PubMed] [Green Version]
  14. Fromm, S.; Senkler, J.; Zabaleta, E.; Peterhänsel, C.; Braun, H.P. The carbonic anhydrase domain of plant mitochondrial complex I. Physiol. Plant. 2016, 157, 289–296. [Google Scholar] [CrossRef]
  15. Senkler, J.; Senkler, M.; Braun, H.P. Structure and function of complex I in animals and plants—A comparative view. Physiol. Plant. 2017, 161, 6–15. [Google Scholar] [CrossRef]
  16. Saha, B.; Borovskii, G.; Panda, S.K. Alternative oxidase and plant stress tolerance. Plant Signal. Behav. 2016, 11, e1256530. [Google Scholar] [CrossRef]
  17. Amirsadeghi, S.; Robson, C.A.; Vanlerberghe, G.C. The role of the mitochondrion in plant responses to biotic stress. Physiol. Plantarum. 2006, 129, 253–266. [Google Scholar] [CrossRef]
  18. Batnini, M.; Fernández Del-Saz, N.; Fullana- Pericàs, M.; Palma, F.; Haddoudi, I.; Mrabet, M.; Ribas-Carbo, M.; Mhadhbi, H. The alternative oxidase pathway is involved in optimizing photosynthesis in Medicago trunculata infected by Fusarium oxysporum and Rhizoctonia solani. Physiol. Plant. 2020, 169, 600–611. [Google Scholar] [CrossRef]
  19. Challabathula, D.; Analin, B.; Mohanan, A.; Bakka, K. Differential modulation of photosynthesis, ROS and antioxidant enzyme activities in stress-sensitive and -tolerant rice cultivars during salinity and drought upon restriction of COX and AOX pathways of mitochondrial oxidative electron transport. J. Plant Physiol. 2022, 268, 153583. [Google Scholar] [CrossRef]
  20. Alber, N.A.; Vanlerberghe, G.C. The flexibility of metabolic interactions between chloroplasts and mitochondria in Nicotiana tabacum leaf. Plant J. 2021, 106, 1625–1646. [Google Scholar] [CrossRef]
  21. Kühn, K.; Yin, G.; Duncan, O.; Law, S.R.; Kubiszewski-Jakubiak, S.; Kaur, P.; Meyer, E.; Wang, Y.; Small, C.C.; Giraud, E.; et al. Decreasing electron flux through the cytochrome and/or alternative respiratory pathways triggers common and distinct cellular responses dependent on growth conditions. Plant Physiol. 2015, 167, 228–250. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Ito, Y.; Saisho, D.; Nakazono, M.; Tsutsumi, N.; Hirai, A. Transcript levels of tandem-arranged alternative oxidase genes in rice are increased by low temperature. Gene 1997, 203, 121–129. [Google Scholar] [CrossRef]
  23. Considine, M.J.; Holtzapffel, R.C.; Day, D.A.; Whelan, J.; Millar, A.H. Molecular distinction between alternative oxidase from monocots and dicots. Plant Physiol. 2002, 129, 949–953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Bailey, C.D.; Carr, T.G.; Harris, S.A.; Hughes, C.E. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Mol. Phylgenet Evol. 2003, 29, 435–455. [Google Scholar] [CrossRef]
  25. Costa, J.H.; McDonald, A.E.; Arnholdt-Schmitt, B.; Fernandes de Melo, D. A classification scheme for alternative oxidases reveals the taxonomic distribution and evolutionary history of the enzyme in angiosperms. Mitochondrion 2014, 19, 172–183. [Google Scholar] [CrossRef] [PubMed]
  26. Clifton, R.; Millar, A.H.; Whelan, J. Alternative oxidases in Arabidopsis: A comparative analysis of differential expression in the gene family provides new insights into function of non-phosphorylating bypasses. Biochim. Biophys. Acta 2006, 1757, 730–741. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Chen, B.; Yin, G.; Whelan, J.; Zhang, Z.; Xin, X.; He, J.; Chen, X.; Zhang, J.; Zhou, Y.; Lu, X. Composition of mitochondrial Complex I during the critical node of seed aging in Oryza sativa. J. Plant Physiol. 2019, 236, 7–14. [Google Scholar] [CrossRef]
  28. Garmash, E.V.; Velegzhaninov, I.O.; Ermolina, K.V.; Rybak, A.V.; Malyshev, R.V. Altered levels of AOX1a expression result in changes in metabolic pathways in Arabidopsis thaliana plants acclimated to low dose rates of ultraviolet B radiation. Plant Sci. 2020, 291, 110332. [Google Scholar] [CrossRef] [PubMed]
  29. Vanlerberghe, G.C. Alternative oxidase: A mitochondrial respiratory pathway to maintain metabolic and signaling homeostasis during abiotic and biotic stress in plants. Int. J. Mol. Sci. 2020, 21, 4874. [Google Scholar] [CrossRef] [Green Version]
  30. Fiorani, F.; Umbach, A.L.; Siedow, J.N. The alternative oxidase of plant mitochondria is involved in the acclimation of shoot growth at low temperature. A study of Arabidopsis AOX1a transgenic plants. Plant Physiol. 2005, 139, 1795–1805. [Google Scholar] [CrossRef] [Green Version]
  31. Xu, F.; Yuan, S.; Zhang, D.W.; Lv, X.; Lin, H.H. The role of alternative oxidase in tomato fruit ripening and its regulatory interaction with ethylene. J. Exp. Bot. 2012, 63, 5705–5716. [Google Scholar] [CrossRef]
  32. Watanabe, C.K.; Hachiya, T.; Takahara, K.; Kawai-Yamada, M.; Uchimiya, H.; Uesono, Y.; Terashima, I.; Noguchi, K. Effects of AOX1a deficiency on plant growth, gene expression of respiratory components and metabolic profile under low-nitrogen stress in Arabidopsis thaliana. Plant Cell Physiol. 2010, 51, 810–822. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Qiao, X.; Ruan, M.; Yu, T.; Cui, C.; Chen, C.; Zhu, Y.; Li, F.; Wang, S.; Na, X.; Wang, X.; et al. UCP1 and AOX1a contribute to regulation of carbon and nitrogen metabolism and yield in Arabidopsis under low nitrogen stress. Cell Mol. Life Sci. 2022, 79, 69. [Google Scholar] [CrossRef] [PubMed]
  34. Sieger, S.M.; Kristensen, B.K.; Robson, C.A. The role of alternative oxidase in modulating carbon use efficiency and growth during macronutrient stress in tobacco cells. J. Exp. Bot. 2005, 56, 1499–1515. [Google Scholar] [CrossRef]
  35. Rasmusson, A.G.; Fernie, A.R.; van Dongen, J.T. Alternative oxidase: A defense against metabolic fluctuations? Physiol. Plant. 2009, 137, 371–382. [Google Scholar] [CrossRef] [PubMed]
  36. Selinski, J.; Scheibe, R.; Day, D.A.; Whelan, J. Alternative oxidase is positive for plant performance. Trends Plant Sci. 2018, 23, 588–597. [Google Scholar] [CrossRef] [PubMed]
  37. Giraud, E.; Ho, L.H.; Clifton, R.; Carroll, A.; Estavillo, G.; Tan, Y.F.; Howell, K.A.; Ivanova, A.; Pogson, B.J.; Millar, A.H.; et al. The absence of alternative oxidase1a in Arabidopsis results in acute sensitivity to combined light and drought stress. Plant Physiol. 2008, 147, 595–610. [Google Scholar] [CrossRef] [Green Version]
  38. Gandin, A.; Duffes, C.; Day, D.A.; Cousins, A.B. The absence of alternative oxidase AOX1A results in altered response of photosynthetic carbon assimilation to increasing CO(2) in Arabidopsis thaliana. Plant Cell Physiol. 2012, 53, 1627–1637. [Google Scholar] [CrossRef] [Green Version]
  39. Imsande, J.; Pittig, J.; Palmer, R.G.; Wimmer, C.; Gietl, C. Independent spontaneous mitochondrial malate dehydrogenase null mutants in soybean are the result of deletions. J. Hered. 2001, 92, 333–338. [Google Scholar] [CrossRef] [Green Version]
  40. Day, D.A.; Millar, A.H.; Whelan, J. Plant mitochondria: From genome to function. In Advances in Photosynthesis and Respiration; Govindjee, Ed.; Kluwer Academic Press: Dordrecht, The Netherlands, 2004; pp. 2–7. [Google Scholar]
  41. Garmash, E.V. Suppression of mitochondrial alternative oxidase can result in upregulation of the ROS scavenging network: Some possible mechanisms underlying the compensation effect. Plant Biol. 2023, 25, 43–53. [Google Scholar] [CrossRef]
  42. Hirst, J. Mitochondrial complex I. Annu. Rev. Biochem. 2013, 82, 551–575. [Google Scholar] [CrossRef]
  43. Hunte, C.; Zickermann, V.; Brandt, U. Functional modules and structural basis of conformational coupling in mitochondrial complex I. Science 2010, 329, 448–451. [Google Scholar] [CrossRef]
  44. Braun, H.P.; Binder, S.; Brennicke, A.; Eubel, H.; Fernie, A.R.; Finkemeier, I.; Klodmann, J.; König, A.C.; Kühn, K.; Meyer, E.; et al. The life of plant mitochondrial complex I. Mitochondrion 2014, 19, 295–313. [Google Scholar] [CrossRef] [PubMed]
  45. Sweetman, C.; Waterman, C.D.; Rainbird, B.M.; Smith, P.M.C.; Jenkins, C.D.; Day, D.A.; Soole, K.L. AtNDB2 is the main external NADH dehydrogenase in mitochondria and is important for tolerance to environmental stress. Plant Physiol. 2019, 181, 774–788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Sweetman, C.; Miller, T.K.; Booth, N.J.; Shavrukov, Y.; Jenkins, C.L.D.; Soole, K.L.; Day, D.A. Identification of alternative mitochondrial electron transport pathway components in chickpea indicates a differential response to salinity stress between cultivars. Int. J. Mol. Sci. 2020, 21, 3844. [Google Scholar] [CrossRef]
  47. Clifton, R.; Lister, R.; Parker, K.L.; Sappl, P.G.; Elhafez, D.; Millar, A.H.; Day, D.A.; Whelan, J. Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Mol. Biol. 2005, 58, 193–212. [Google Scholar] [CrossRef] [PubMed]
  48. Wanniarachchi, V.R.; Dametto, L.; Sweetman, C.; Shavrukov, Y.; Day, D.A.; Jenkins, C.L.D.; Soole, K.L. Alternative respiratory pathway component genes (AOX and ND) in rice and barley and their response to stress. Int. J. Mol. Sci. 2018, 19, 915. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Wang, M.; Chen, C.; Xu, Y.Y.; Jiang, R.X.; Han, Y.; Xu, Z.H.; Chong, K. A practical vector for efficient knockdown of gene expression in rice (Oryza sativa L.). Plant Mol. Biol. Rep. 2004, 22, 409–417. [Google Scholar] [CrossRef]
  50. Hiei, Y.; Ohta, S.; Komari, T.; Kumashiro, T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence-analysis of the boundaries of the T-DNA. Plant J. 1994, 6, 271–282. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Walters, C.; Wheeler, L.; Grotenhuis, J. Longevity of seeds stored in a genebank: Species characteristics. Seed Sci. Res. 2005, 15, 1–20. [Google Scholar] [CrossRef]
  52. Logan, D.C.; Millar, A.H.; Sweetlove, L.J.; Hill, S.A.; Leaver, C.J. Mitochondrial biogenesis during germination in maize embryos. Plant Physiol. 2001, 125, 662–672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Plants 12 02284 g001 550
Figure 1. Comparison of wild-type (WT) and OsAOX1a-RNAi rice seeds (a) with respect to width (b) length (c) and 100-grain weight (d). Data represent the mean ± standard deviation of three independent experiments. Asterisks indicate a significant difference between OsAOX1a-RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05.
Figure 1. Comparison of wild-type (WT) and OsAOX1a-RNAi rice seeds (a) with respect to width (b) length (c) and 100-grain weight (d). Data represent the mean ± standard deviation of three independent experiments. Asterisks indicate a significant difference between OsAOX1a-RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05.
Plants 12 02284 g001
Plants 12 02284 g002 550
Figure 2. Seed viability curves showing the time for the seed germination percentage decrease to 50% (P50 (a)) and the vigor index (b) of wild-type and OsAOX1a-RNAi rice following artificial aging treatment. Data represent the mean ± standard deviation of three independent experiments. “……” represents the time when germination percentage decreases to 50%. Asterisks indicate a significant difference between OsAOX1a -RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05; **, p < 0.01; ***, p < 0.001.
Figure 2. Seed viability curves showing the time for the seed germination percentage decrease to 50% (P50 (a)) and the vigor index (b) of wild-type and OsAOX1a-RNAi rice following artificial aging treatment. Data represent the mean ± standard deviation of three independent experiments. “……” represents the time when germination percentage decreases to 50%. Asterisks indicate a significant difference between OsAOX1a -RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05; **, p < 0.01; ***, p < 0.001.
Plants 12 02284 g002
Plants 12 02284 g003 550
Figure 3. Western blot showing verification abundance of AOX1 and Cyt c in mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%,90%, 80%, and 70% after 48 h imbibition.
Figure 3. Western blot showing verification abundance of AOX1 and Cyt c in mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%,90%, 80%, and 70% after 48 h imbibition.
Plants 12 02284 g003
Plants 12 02284 g004 550
Figure 4. Malate dehydrogenase (MDH) activity (a) and ATP content (b) in crude mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition. Data represent the mean ± standard deviation of three independent experiments. Asterisks indicate a significant difference between OsAOX1a-RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05; ***, p < 0.001.
Figure 4. Malate dehydrogenase (MDH) activity (a) and ATP content (b) in crude mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition. Data represent the mean ± standard deviation of three independent experiments. Asterisks indicate a significant difference between OsAOX1a-RNAi transgenic plants and WT controls via Student’s t-test: * p < 0.05; ***, p < 0.001.
Plants 12 02284 g004
Plants 12 02284 g005 550
Figure 5. Western blotting showing verification abundance of mitochondrial Complex I subunits in crude mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition.
Figure 5. Western blotting showing verification abundance of mitochondrial Complex I subunits in crude mitochondria from wild type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition.
Plants 12 02284 g005
Table
Table 1. Rate of oxygen uptake (nmolO2·min−1mg protein−1) by mitochondria in wild-type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition. O2 consumption rates are presented as means ± SD (n = 3).
Table 1. Rate of oxygen uptake (nmolO2·min−1mg protein−1) by mitochondria in wild-type and OsAOX1a-RNAi seeds at germination percentage of 100%, 90%, 80%, and 70% after 48 h imbibition. O2 consumption rates are presented as means ± SD (n = 3).
MaterialsSubstrateO2 Consumption Rate (nmolO2·min−1mg−1 Protein)
100%90%80%70%
Wild typeNADH44.4 ± 3.238.1 ± 2.218.9 ± 0.611.4 ± 2.6
NADH + ADP97.8 ± 3.265.5 ± 2.943.3 ± 3.022.7 ± 2.6
Succinate24.5 ± 2.018.8 ± 0.811.5 ± 1.07.9 ± 0.7
Succinate + ADP40.5 ± 1.925.8 ± 1.814.2 ± 1.79.8 ± 2.6
OsAOX1a-RNAiNADH17.3 ± 1.911.8 ± 1.28.3 ± 0.76.6 ± 0.4
NADH + ADP36.7 ± 0.925.2 ± 1.112.9 ± 0.710.5 ± 1.0
Succinate7.9 ± 0.26.0 ± 0.34.5 ± 0.54.1 ± 0.2
Succinate + ADP32.0 ± 1.218.5 ± 0.78.8 ± 0.67.9 ± 0.5
Table
Table 2. Primers used in real-time PCR.
Table 2. Primers used in real-time PCR.
NamePrimer (5′→3′)Restriction Site
OsAOX1a-FCGGAGCTCGGATCCAACAAAAGAATGGTATGTAGSacI + BamHI
OsAOX1a-RGGACTAGTGGTACCATATCACTGAGGATGTTTGTSpeI + KpnI
Hyg-FCTATTTCTTTGCCCTCGGAC
Hyg-RAAGCCTGAACTCACCGCGAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ji, J.; Lin, S.; Xin, X.; Li, Y.; He, J.; Xu, X.; Zhao, Y.; Su, G.; Lu, X.; Yin, G. Effects of OsAOX1a Deficiency on Mitochondrial Metabolism at Critical Node of Seed Viability in Rice. Plants 2023, 12, 2284. https://doi.org/10.3390/plants12122284

AMA Style

Ji J, Lin S, Xin X, Li Y, He J, Xu X, Zhao Y, Su G, Lu X, Yin G. Effects of OsAOX1a Deficiency on Mitochondrial Metabolism at Critical Node of Seed Viability in Rice. Plants. 2023; 12(12):2284. https://doi.org/10.3390/plants12122284

Chicago/Turabian Style

Ji, Jing, Shuangshuang Lin, Xia Xin, Yang Li, Juanjuan He, Xinyue Xu, Yunxia Zhao, Gefei Su, Xinxiong Lu, and Guangkun Yin. 2023. "Effects of OsAOX1a Deficiency on Mitochondrial Metabolism at Critical Node of Seed Viability in Rice" Plants 12, no. 12: 2284. https://doi.org/10.3390/plants12122284

APA Style

Ji, J., Lin, S., Xin, X., Li, Y., He, J., Xu, X., Zhao, Y., Su, G., Lu, X., & Yin, G. (2023). Effects of OsAOX1a Deficiency on Mitochondrial Metabolism at Critical Node of Seed Viability in Rice. Plants, 12(12), 2284. https://doi.org/10.3390/plants12122284

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop