Exogenous Rosmarinic Acid Application Enhances Thermotolerance in Tomatoes
Abstract
:1. Introduction
2. Results
2.1. Exogenous RA Treatment Increases Plant Thermotolerance in Tomato
2.2. Exogenous RA Treatment Activates Antioxidant System in Tomato Plants Subjected to High Temperature
2.3. Exogenous RA Treatment Promotes HSPs in Tomato Plants in Response to High-Temperature Stress
2.4. WRKYs Are Involved in RA-Mediated Plant Thermotolerance
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Condition
4.2. RA Pretreatment and Temperature Treatments
4.3. Thermotolerance and ROS Analysis
4.4. Determination of Antioxidant Enzyme Activity and Antioxidant Contents
4.5. Plant Total RNA Extraction and qRT–PCR Measurements
4.6. Western Blot Analysis
4.7. RNA-Seq Analysis
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhang, H.; Zhu, J.; Gong, Z.; Zhu, J.K. Abiotic stress responses in plants. Nat. Rev. Genet. 2022, 23, 104–119. [Google Scholar] [CrossRef] [PubMed]
- Kollist, H.; Zandalinas, S.I.; Sengupta, S.; Nuhkat, M.; Kangasjarvi, J.; Mittler, R. Rapid responses to abiotic stress: Priming the landscape for the signal transduction network. Trends Plant Sci. 2019, 24, 25–37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, J.Y.; Zhao, X.B.; Burger, M.; Wang, Y.R.; Chory, J. Two interacting ethylene response factors regulate heat stress response. Plant Cell 2021, 33, 338–357. [Google Scholar] [CrossRef] [PubMed]
- Tieman, D.; Zhu, G.T.; Resende, M.F.R.; Lin, T.; Taylor, M.; Zhang, B.; Ikeda, H.; Liu, Z.Y.; Fisher, J.; Zemach, I.; et al. PLANT SCIENCE A chemical genetic roadmap to improved tomato flavor. Science 2017, 355, 391–394. [Google Scholar] [CrossRef]
- Sato, S.; Peet, M.M.; Gardner, R.G. Altered flower retention and developmental patterns in nine tomato cultivars under elevated temperature. Sci. Hortic. 2004, 101, 95–101. [Google Scholar] [CrossRef]
- Shekhawat, K.; Almeida-Trapp, M.; García-Ramírez, G.X.; Hirt, H. Beat the heat: Plant- and microbe-mediated strategies for crop thermotolerance. Trends Plant Sci. 2022, 22, 1360–1385. [Google Scholar] [CrossRef]
- ul Haq, S.; Khan, A.; Ali, M.; Khattak, A.M.; Gai, W.X.; Zhang, H.X.; Wei, A.M.; Gong, Z.H. Heat shock proteins: Dynamic biomolecules to counter plant biotic and abiotic stresses. Int. J. Mol. Sci. 2019, 20, 5321. [Google Scholar] [CrossRef] [Green Version]
- Charng, Y.Y.; Liu, H.C.; Liu, N.Y.; Chi, W.T.; Wang, C.N.; Chang, S.H.; Wang, T.T. A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. Plant Physiol. 2007, 143, 251–262. [Google Scholar] [CrossRef] [Green Version]
- Hasanuzzaman, M.; Bhuyan, M.H.M.B.; Zulfiqar, F.; Raza, A.; Mohsin, S.M.; Al Mahmud, J.; Fujita, M.; Fotopoulos, V. Reactive oxygen species and antioxidant sefense in plants under abiotic stress: Revisiting the crucial role of a universal defense regulator. Antioxidants 2020, 9, 681. [Google Scholar] [CrossRef]
- Singh, R.; Singh, S.; Parihar, P.; Mishra, R.K.; Tripathi, D.K.; Singh, V.P.; Chauhan, D.K.; Prasad, S.M. Reactive oxygen species (ROS): Beneficial companions of plants’ developmental processes. Front. Plant Sci. 2016, 7, 1299. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, P.; Jaleel, C.A.; Salem, M.A.; Nabi, G.; Sharma, S. Roles of enzymatic and nonenzymatic antioxidants in plants during abiotic stress. Crit. Rev. Biotechnol. 2010, 30, 161–175. [Google Scholar] [CrossRef] [PubMed]
- Ahammed, G.J.; Xu, W.; Liu, A.; Chen, S. Endogenous melatonin deficiency aggravates high temperature-induced oxidative stress in Solanum lycopersicum L. Environ. Exp. Bot. 2019, 161, 303–311. [Google Scholar] [CrossRef]
- Yu, Y.; Deng, L.; Zhou, L.; Chen, G.; Wang, Y. Exogenous melatonin activates antioxidant systems to increase the ability of Rice seeds to germinate under high temperature conditions. Plants 2022, 11, 886. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.J.; Li, J.X.; Ding, S.T.; Cheng, F.; Li, X.; Jiang, Y.P.; Yu, J.Q.; Foyer, C.H.; Shi, K. The protein kinase CPK28 phosphorylates ascorbate peroxidase and enhances thermotolerance in tomato. Plant Physiol. 2021, 186, 1302–1317. [Google Scholar] [CrossRef]
- Petersen, M.; Abdullah, Y.; Benner, J.; Eberle, D.; Gehlen, K.; Hücherig, S.; Janiak, V.; Kim, K.H.; Sander, M.; Weitzel, C.; et al. Evolution of rosmarinic acid biosynthesis. Phytochemistry 2009, 70, 1663–1679. [Google Scholar] [CrossRef]
- Floare-Avram, C.V.; Covaciu, F.; Voica, C.; Puscas, R.; Feher, I.; Marincas, O.; Magdas, D.A. Differentiation of tomatoes based on isotopic, elemental and organic markers. J. Food Sci. Technol. 2020, 57, 2222–2232. [Google Scholar] [CrossRef]
- Marchev, A.S.; Vasileva, L.V.; Amirova, K.M.; Savova, M.S.; Koycheva, I.K.; Balcheva-Sivenova, Z.P.; Vasileva, S.M.; Georgiev, M.I. Rosmarinic acid-from bench to valuable applications in food industry. Trends Food Sci. Technol. 2021, 117, 182–193. [Google Scholar] [CrossRef]
- Scagel, C.F.; Lee, J.; Mitchell, J.N. Salinity from NaCl changes the nutrient and polyphenolic composition of basil leaves. Ind. Crops Prod. 2019, 127, 119–128. [Google Scholar] [CrossRef]
- Hernández, J.A.; Ferrer, M.A.; Jiménez, A.; Barceló, A.R.; Sevilla, F. Antioxidant systems and O2−/H2O2 production in the apoplast of pea leaves. Its relation with salt-induced necrotic lesions in minor veins. Plant Physiol. 2001, 127, 817–831. [Google Scholar] [CrossRef]
- Cheng, F.; Yin, L.L.; Zhou, J.; Xia, X.J.; Shi, K.; Yu, J.Q.; Zhou, Y.H.; Foyer, C.H. Interactions between 2-Cys peroxiredoxins and ascorbate in autophagosome formation during the heat stress response in Solanum lycopersicum. J. Exp. Bot. 2016, 67, 1919–1933. [Google Scholar] [CrossRef] [Green Version]
- Foyer, C.H.; Noctor, G. Ascorbate and glutathione: The heart of the redox hub. Plant Physiol. 2011, 155, 2–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, S.; Liu, J.; Liu, Z.; Li, X.; Wu, F.; He, Y. HEAT-INDUCED TAS1 TARGET1 mediates thermotolerance via HEAT STRESS TRANSCRIPTION FACTOR A1a–directed pathways in Arabidopsis. Plant Cell 2014, 26, 1764–1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Espin, S.; Gonzalez-Manzano, S.; Taco, V.; Poveda, C.; Ayuda-Duran, B.; Gonzalez-Paramas, A.M.; Santos-Buelga, C. Phenolic composition and antioxidant capacity of yellow and purple-red Ecuadorian cultivars of tree tomato (Solanum betaceum Cav.). Food Chem. 2016, 194, 1073–1080. [Google Scholar] [CrossRef]
- Zhu, C.; Wu, S.; Sun, T.; Zhou, Z.; Hu, Z.; Yu, J. Rosmarinic acid delays tomato fruit ripening by regulating ripening-associated traits. Antioxidants 2021, 10, 1821. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Rahman, F.A.; Rashid, I.A.S.R.; Shoala, T.M. Nanoactivities of natural nanomaterials rosmarinic acid, glycyrrhizic acid and glycyrrhizic acid ammonium salt against tomato phytopathogenic fungi Alternaria alternate and Penicillium digitatum. J. Plant Prot. Res. 2020, 60, 150–160. [Google Scholar] [CrossRef]
- Corral-Lugo, A.; Daddaoua, A.; Ortega, A.; Espinosa-Urgel, M.; Krell, T. Rosmarinic acid is a homoserine lactone mimic produced by plants that activates a bacterial quorum-sensing regulator. Sci. Signal. 2016, 9, ra1. [Google Scholar] [CrossRef]
- Sharma, A.; Shahzad, B.; Rehman, A.; Bhardwaj, R.; Landi, M.; Zheng, B. Response of phenylpropanoid pathway and the role of polyphenols in plants under abiotic stress. Molecules 2019, 24, 2452. [Google Scholar] [CrossRef] [Green Version]
- Ali, S.; Rizwan, M.; Arif, M.S.; Ahmad, R.; Hasanuzzaman, M.; Ali, B.; Hussain, A. Approaches in enhancing thermotolerance in plants: An updated review. J. Plant Growth Regul. 2020, 39, 456–480. [Google Scholar] [CrossRef]
- Kaushal, N.; Gupta, K.; Bhandhari, K.; Kumar, S.; Thakur, P.; Nayyar, H. Proline induces heat tolerance in chickpea (Cicer arietinum L.) plants by protecting vital enzymes of carbon and antioxidative metabolism. Physiol. Mol. Biol. Plants 2011, 17, 203–213. [Google Scholar] [CrossRef] [Green Version]
- Nayyar, H.; Kaur, R.; Kaur, S.; Singh, R. γ-Aminobutyric acid (GABA) imparts partial protection from heat stress injury to rice seedlings by improving leaf turgor and upregulating osmoprotectants and antioxidants. J. Plant Growth Regul. 2014, 33, 408–419. [Google Scholar] [CrossRef]
- Luo, Y.; Li, F.; Wang, G.P.; Yang, X.H.; Wang, W. Exogenously-supplied trehalose protects thylakoid membranes of winter wheat from heat-induced damage. Biol. Plant. 2010, 54, 495–501. [Google Scholar] [CrossRef]
- Su, Y.; Huang, Y.; Dong, X.; Wang, R.; Tang, M.; Cai, J.; Chen, J.; Zhang, X.; Nie, G. Exogenous methyl jasmonate improves heat tolerance of perennial ryegrass through alteration of osmotic adjustment, antioxidant defense, and expression of jasmonic acid-responsive genes. Front. Plant Sci. 2021, 12, 664519. [Google Scholar] [CrossRef] [PubMed]
- Ru, M.; Li, Y.; Guo, M.; Chen, L.; Tan, Y.; Peng, L.; Liang, Z. Increase in rosmarinic acid accumulation and transcriptional responses of synthetic genes in hairy root cultures of Prunella vulgaris induced by methyl jasmonate. Plant Cell Tissue Organ Cult. 2022, 149, 371–379. [Google Scholar] [CrossRef]
- Sarwar, M.; Saleem, M.F.; Ullah, N.; Rizwan, M.; Ali, S.; Shahid, M.R.; Alamri, S.A.; Alyemeni, M.N.; Ahmad, P. Exogenously applied growth regulators protect the cotton crop from heat-induced injury by modulating plant defense mechanism. Sci. Rep. 2018, 8, 17086. [Google Scholar] [CrossRef] [Green Version]
- Petersen, M.; Simmonds, M.S. Molecules of interest—Rosmarinic acid. Phytochemistry 2003, 62, 121–125. [Google Scholar] [CrossRef]
- Zhang, J.; Li, D.M.; Gao, Y.; Yu, B.; Xia, C.X.; Bai, J.G. Pretreatment with 5-aminolevulinic acid mitigates heat stress of cucumber leaves. Biol. Plant. 2012, 56, 780–784. [Google Scholar] [CrossRef]
- Hu, L.; Zhang, Z.; Xiang, Z.; Yang, Z. Exogenous application of citric acid ameliorates the adverse effect of heat stress in tall fescue (Lolium arundinaceum). Front. Plant Sci. 2016, 7, 179. [Google Scholar] [CrossRef] [Green Version]
- Ogweno, J.O.; Song, X.S.; Shi, K.; Hu, W.H.; Mao, W.H.; Zhou, Y.H.; Yu, J.Q.; Nogues, S. Brassinosteroids alleviate heat-induced inhibition of photosynthesis by increasing carboxylation efficiency and enhancing antioxidant systems in Lycopersicon esculentum. J. Plant Growth Regul. 2008, 27, 49–57. [Google Scholar] [CrossRef]
- Fragkostefanakis, S.; Mesihovic, A.; Simm, S.; Paupière, M.J.; Hu, Y.; Paul, P.; Mishra, S.K.; Tschiersch, B.; Theres, K.; Bovy, A.; et al. HsfA2 controls the activity of developmentally and stress-regulated heat stress protection mechanisms in tomato male reproductive tissues. Plant Physiol. 2016, 170, 2461–2477. [Google Scholar] [CrossRef] [PubMed]
- Hahn, A.; Bublak, D.; Schleiff, E.; Scharf, K.D. Crosstalk between Hsp90 and Hsp70 chaperones and heat stress transcription factors in tomato. Plant Cell 2011, 23, 741–755. [Google Scholar] [CrossRef] [Green Version]
- Ohama, N.; Sato, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Transcriptional regulatory network of plant heat stress response. Trends Plant Sci. 2017, 22, 53–65. [Google Scholar] [CrossRef] [PubMed]
- Dang, F.-F.; Wang, Y.-N.; Yu, L.U.; Eulgem, T.; Lai, Y.A.N.; Liu, Z.-Q.; Wang, X.U.; Qiu, A.-L.; Zhang, T.-X.; Lin, J.; et al. CaWRKY40, a WRKY protein of pepper, plays an important role in the regulation of tolerance to heat stress and resistance to Ralstonia solanacearum infection. Plant Cell Environ. 2013, 36, 757–774. [Google Scholar] [CrossRef]
- Yang, S.; Cai, W.; Shen, L.; Cao, J.; Liu, C.; Hu, J.; Guan, D.; He, S. A CaCDPK29–CaWRKY27b module promotes CaWRKY40-mediated thermotolerance and immunity to Ralstonia solanacearum in pepper. New Phytol. 2022, 233, 1843–1863. [Google Scholar] [CrossRef]
- Li, S.; Fu, Q.; Chen, L.; Huang, W.; Yu, D. Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance. Planta 2011, 233, 1237–1252. [Google Scholar] [CrossRef] [PubMed]
- Dang, F.; Lin, J.; Xue, B.; Chen, Y.; Guan, D.; Wang, Y.; He, S. CaWRKY27 negatively regulates H2O2-mediated thermotolerance in pepper (Capsicum annuum). Front. Plant Sci. 2018, 9, 1633. [Google Scholar] [CrossRef]
- Pan, C.Z.; Zhang, H.; Ma, Q.M.; Fan, F.J.; Fu, R.S.; Ahammed, G.J.; Yu, J.Q.; Shi, K. Role of ethylene biosynthesis and signaling in elevated CO2-induced heat stress response in tomato. Planta 2019, 250, 563–572. [Google Scholar] [CrossRef] [PubMed]
- Cheng, F.; Zhou, Y.H.; Xia, X.J.; Shi, K.; Zhou, J.; Yu, J.Q. Chloroplastic thioredoxin-f and thioredoxin-m1/4 play important roles in brassinosteroids-induced changes in CO2 assimilation and cellular redox homeostasis in tomato. J. Exp. Bot. 2014, 65, 4335–4347. [Google Scholar] [CrossRef] [Green Version]
- Hu, Z.; Sun, Z.; Ma, Q.; Yang, X.; Feng, S.; Shao, S.; Shi, K. N-decanoyl-homoserine lactone alleviates elevated CO2-induced defense suppression to Botrytis cinerea in tomato. Sci. Hortic. 2020, 268, 109353. [Google Scholar] [CrossRef]
- Noctor, G.; Mhamdi, A.; Foyer, C.H. Oxidative stress and antioxidative systems: Recipes for successful data collection and interpretation. Plant Cell Environ. 2016, 39, 1140–1160. [Google Scholar] [CrossRef] [Green Version]
Gene Name | Gene ID | Forward Primer, 5′-3′ | Reverse Primer, 5′-3′ |
---|---|---|---|
Actin | Solyc03g078400 | TGTCCCTATTTACGAGGGTTATGC | CAGTTAAATCACGACCAGCAAGAT |
APX | Solyc11g018550 | CGCCATATCACACAAGAAGC | TAACTCAGAGCCACCACTGC |
GR | Solyc09g065900 | GATGATGAAATGCGAGCTGT | TTGTGTTAGGGAGACGACCA |
DHAR | Solyc05g054760 | CCCTGATGTCCTTGGAGACT | AAGAACCATTTGGGCTTGTC |
CAT | Solyc12g094620 | TGATCGCGAGAAGATACCTG | CTTCCACGTTCATGGACAAC |
HSP90 | Solyc06g036290 | TGTGGGTTTCTACTCTGCGT | CTGCCCAATTGCTCTCCATC |
HSP70 | Solyc09g010630 | CAAGCTGAAAGAGCTCAAGG | CTGTCCCAGCTGCATTACTT |
HsfA2 | Solyc09g082670 | TCTGTTGTGACAGCAAATGG | TACTTCCTCTGCTGCTCGAT |
WRKY10 | Solyc12g096350 | TGGCTGAAGACGGAGGGATA | ACGTTTGAAGCCATAGGGATCT |
WRKY33 | Solyc09g014990 | CCAAACCGAGACTCGTCCAA | CGAATCCTGTGGTGCTCTGT |
WRKY41 | Solyc01g095630 | ATTGGGAGCGGAGGAGTTTG | ACGATGGAGAAGACGAACCC |
WRKY46 | Solyc08g067340 | GCACGCATCGATTCACACAA | CCACAACCAATCCTGTCCGA |
WRKY55 | Solyc04g072070 | CCGTTGATGGTGGTGGAGAA | TCTTGGCCGGGCAATTGTAT |
WRKY81 | Solyc09g015770 | GGTCAAGTCGCCGGAAGATT | AACATCGGGCGAGGTCATAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Z.; Li, J.; Zhu, C.; Jing, B.; Shi, K.; Yu, J.; Hu, Z. Exogenous Rosmarinic Acid Application Enhances Thermotolerance in Tomatoes. Plants 2022, 11, 1172. https://doi.org/10.3390/plants11091172
Zhou Z, Li J, Zhu C, Jing B, Shi K, Yu J, Hu Z. Exogenous Rosmarinic Acid Application Enhances Thermotolerance in Tomatoes. Plants. 2022; 11(9):1172. https://doi.org/10.3390/plants11091172
Chicago/Turabian StyleZhou, Zhiwen, Jiajia Li, Changan Zhu, Beiyu Jing, Kai Shi, Jingquan Yu, and Zhangjian Hu. 2022. "Exogenous Rosmarinic Acid Application Enhances Thermotolerance in Tomatoes" Plants 11, no. 9: 1172. https://doi.org/10.3390/plants11091172
APA StyleZhou, Z., Li, J., Zhu, C., Jing, B., Shi, K., Yu, J., & Hu, Z. (2022). Exogenous Rosmarinic Acid Application Enhances Thermotolerance in Tomatoes. Plants, 11(9), 1172. https://doi.org/10.3390/plants11091172