Near-Isogenic Barley Lines Show Enhanced Susceptibility to Powdery Mildew Infection Following High-Temperature Stress
Abstract
1. Introduction
2. Results
2.1. Determination of the Effect of Heat Stress on Powdery Mildew Infection in Near-Isogenic Barley Lines
2.2. Expression of Barley Defense/Stress Genes in Response to Heat Stress and/or Bgh Infection
3. Discussion
4. Materials and Methods
4.1. Plant Materials and Powdery Mildew Infection
4.2. Heat Stress
4.3. Evaluation of Powdery Mildew Symptoms Caused by Bgh
4.4. Quantitative Analyses of Powdery Mildew Biomass
4.5. Quantitative Analyses of Plant Defense Gene Expression
| Accession Number | Gene | Sequence 5′-3′ | Amplicon Length | Primer Efficiency | |
|---|---|---|---|---|---|
| CAUH01004767 | Glyceraldehyde 3-phosphate dehydrogenase (BgGAPDH) | Fw | GGAGCCGAGTACATAGTAGAGT | 105 bp | 104% |
| Rev | GGAGGGTGCCGAAATGATAAC | ||||
| M60175 | Ubiquitin (HvUbi) | Fw | ACCCTCGCCGACTACAACAT | 240 bp | 102% |
| Rev | CAGTAGTGGCGGTCGAAGTG | ||||
| XM045113197 | Heat shock protein 90-1 (HvHsp90-1) | Fw | ACAAGAACGACAAGTCCGTCAA | 119 bp | 104% |
| Rev | GAGCATGCGGTGGATCCT | ||||
| AJ290421 | BAX inhibitor-1 (HvBI-1) | Fw | ATGTTCTCGGTGCCAGTCT | 409 bp | 101% |
| Rev | GGGCGTGCTTGATGTAGTC | ||||
| X74940 | Pathogenesis related -1b (HvPR1-b) | Fw | GGACTACGACTACGGCTCCA | 150 bp | 104% |
| Rev | GGCTCGTAGTTGCAGGTGAT | ||||
| EU566856.1 | Respiratory burst oxidase homologue F2 (HvRBOHF2) | Fw | TGCTCGGTCAGCACTC | 175 bp | 104% |
| Rev | TCCGCAATAGAACACTCC | ||||
4.6. Statistical Analyses
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Desaint, H.; Aoun, N.; Deslandes, L.; Vailleau, F.; Roux, F.; Berthomé, R. Fight hard or die trying: When plants face pathogens under heat stress. New Phytol. 2021, 229, 712–734. [Google Scholar] [CrossRef] [PubMed]
- Atkinson, N.J.; Urwin, P.E. The interaction of plant biotic and abiotic stresses: From genes to the field. J. Exp. Bot. 2012, 63, 3523–3544. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, N.; Rivero, R.M.; Shulaev, V.; Blumwald, E.; Mittler, R. Abiotic and biotic stress combinations. New Phytol. 2014, 203, 32–43. [Google Scholar] [CrossRef]
- Onaga, G.; Wydra, K.; Koopmann, B.; Chebotarov, D.; Séré, Y.; Von Tiedemann, A. High temperature effects on Pi54 conferred resistance to Magnaporthe oryzae in two genetic backgrounds of Oryza sativa. J. Plant Physiol. 2017, 212, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Bita, C.E.; Gerats, T. Plant tolerance to high temperature in a changing environment: Scientific fundamentals and production of heat stress-tolerant crops. Front. Plant Sci. 2013, 4, 273. [Google Scholar] [CrossRef]
- Jagadish, S.V.K.; Way, D.A.; Sharkey, T.D. Plant heat stress: Concepts directing future research. Plant Cell Environ. 2021, 44, 1992–2005. [Google Scholar] [CrossRef]
- Cantalapiedra, C.P.; García-Pereira, M.J.; Gracia, M.P.; Igartua, E.; Casas, A.M.; Contreras-Moreira, B. Large differences in gene expression responses to drought and heat stress between elite barley cultivar Scarlett and a Spanish landrace. Front. Plant Sci. 2017, 8, 647. [Google Scholar] [CrossRef]
- Challinor, A.J.; Watson, J.; Lobell, D.B.; Howden, S.M.; Smith, D.R.; Chhetri, N. A meta-analysis of crop yield under climate change and adaptation. Nat. Clim. Chang. 2014, 4, 287–291. [Google Scholar] [CrossRef]
- Dean, R.; van Kan, J.A.L.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef]
- Hacquard, S.; Kracher, B.; Maekawa, T.; Vernaldi, S.; Schulze-Lefert, P.; Van Themaat, E.V.L. Mosaic genome structure of the barley powdery mildew pathogen and conservation of transcriptional programs in divergent hosts. Proc. Natl. Acad. Sci. USA 2013, 110, E2219–E2228. [Google Scholar] [CrossRef]
- Jørgensen, J.H. Discovery, characterization and exploitation of Mlo powdery mildew resistance in barley. Euphytica 1992, 63, 141–152. [Google Scholar] [CrossRef]
- Freialdenhoven, A.; Peterhansel, C.; Kurth, J.; Kreuzaler, F.; Schulze-Lefert, P. Identification of genes required for the function of non-race-specific mlo resistance to powdery mildew in barley. Plant Cell 1996, 8, 5–14. [Google Scholar] [CrossRef] [PubMed]
- Büschges, R.; Hollricher, K.; Panstruga, R.; Simons, G.; Wolter, M.; Frijters, A.; Van Daelen, R.; Van der Lee, T.; Diergaarde, P.; Groenendijk, J.; et al. The barley Mlo gene: A novel control element of plant pathogen resistance. Cell 1997, 88, 695–705. [Google Scholar] [CrossRef]
- Von Röpenack, E.; Parr, A.; Schulze-Lefert, P. Structural analyses and dynamics of soluble and cell wall-bound phenolics in a broad spectrum resistance to the powdery mildew fungus in barley. J. Biol. Chem. 1998, 273, 9013–9022. [Google Scholar] [CrossRef]
- Hückelhoven, R.; Trujillo, M.; Kogel, K.-H. Mutations in Ror1 and Ror2 genes cause modification of hydrogen peroxide accumulation in mlo-barley under attack from the powdery mildew fungus. Mol. Plant Pathol. 2000, 1, 287–292. [Google Scholar] [CrossRef] [PubMed]
- Kusch, S.; Panstruga, R. Mlo-based resistance: An apparently universal ‘weapon’ to defeat powdery mildew disease. Mol. Plant-Microbe Interact. 2017, 30, 179–189. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Lin, D.; Zhang, Y.; Deng, M.; Chen, Y.; Lv, B.; Li, B.; Lei, Y.; Wang, Y.; Zhao, L.; et al. Genome-edited powdery mildew resistance in wheat without growth penalties. Nature 2022, 602, 455–460. [Google Scholar] [CrossRef]
- Jørgensen, J.H.; Wolfe, P.M. Genetics of powdery mildew resistance in barley. Crit. Rev. Plant Sci. 1994, 13, 97–119. [Google Scholar] [CrossRef]
- Freialdenhoven, A.; Scherag, B.; Hollricher, K.; Coilingelb, D.B.; Thordal-Christensenlb, H.; Schulze-Leferta, P. Nar-1 and Nar-2, two loci required for Mla12-specified race-specific resistance to powdery mildew in barley. Plant Cell 1994, 6, 983–994. [Google Scholar] [CrossRef]
- Hückelhoven, R.; Fodor, J.; Preis, C.; Kogel, K.-H. Hypersensitive cell death and papilla formation in barley attacked by the powdery mildew fungus are associated with hydrogen peroxide but not with salicylic acid accumulation 1. Plant Physiol. 1999, 119, 1251–1260. [Google Scholar] [CrossRef]
- Jaswal, R.; Kiran, K.; Rajarammohan, S.; Dubey, H.; Singh, P.K.; Sharma, Y.; Deshmukh, R.; Sonah, H.; Gupta, N.; Sharma, T.R. Effector biology of biotrophic plant fungal pathogens: Current advances and future prospects. Microbiol. Res. 2020, 241, 126567. [Google Scholar] [CrossRef] [PubMed]
- Barna, B.; Harrach, B.D.; Viczián, O.; Fodor, J. Heat induced susceptibility of barley lines with various types of resistance genes to powdery mildew. Acta Phytopathol. Entomol. Hung. 2014, 49, 177–188. [Google Scholar] [CrossRef]
- Künstler, A.; Bacsó, R.; Albert, R.; Barna, B.; Király, Z.; Hafez, Y.M.; Fodor, J.; Schwarczinger, I.; Király, L. Superoxide (O2.-) accumulation contributes to symptomless (type I) nonhost resistance of plants to biotrophic pathogens. Plant Physiol. Biochem. 2018, 128, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Schweizer, P.; Vallélian-Bindschedler, L.; Mösinger, E. Heat-induced resistance in barley to the powdery mildew fungus Erysiphe graminis f. sp. hordei. Physiol. Mol. Plant Pathol. 1995, 47, 51–66. [Google Scholar] [CrossRef]
- Vallélian-Bindschedler, L.; Schweizer, P.; Mösinger, E.; Métraux, J.P. Heat-induced resistance in barley to powdery mildew (Blumeria graminis f. sp. hordei) is associated with a burst of active oxygen species. Physiol. Mol. Plant Pathol. 1998, 52, 185–199. [Google Scholar] [CrossRef]
- Schwarzbach, E. Heat induced susceptibility of mlo-barley to powdery mildew (Blumeria graminis D.C. f. sp. hordei Marchal). Czech J. Genet. Plant Breed. 2001, 37, 82–87. [Google Scholar]
- Matić, S.; Cucu, M.A.; Garibaldi, A.; Gullino, M.L. Combined effect of CO2 and temperature on wheat powdery mildew development. Plant Pathol. J. 2018, 34, 316–326. [Google Scholar] [CrossRef]
- Schwarczinger, I.; Kolozsváriné Nagy, J.; Király, L.; Mészáros, K.; Bányai, J.; Kunos, V.; Fodor, J.; Künstler, A. Heat stress pre-exposure may differentially modulate plant defense to powdery mildew in a resistant and susceptible barley genotype. Genes 2021, 12, 776. [Google Scholar] [CrossRef]
- Driedonks, N.; Xu, J.; Peters, J.L.; Park, S.; Rieu, I. Multi-level interactions between heat shock factors, heat shock proteins, and the redox system regulate acclimation to heat. Front. Plant Sci. 2015, 6, 999. [Google Scholar] [CrossRef]
- Hazen, B.E.; Bushnell, W.R. Inhibition of the hypersensitive reaction in barley to powdery mildew by heat shock and cytochalasin B. Physiol. Plant Pathol. 1983, 23, 421–438. [Google Scholar] [CrossRef]
- Pandey, P.; Senthil-Kumar, M. Plant-pathogen interaction in the presence of abiotic stress: What do we know about plant responses? Plant Physiol. Rep. 2019, 24, 541–549. [Google Scholar] [CrossRef]
- Bourgine, B.; Guihur, A. Heat shock signaling in land plants: From plasma membrane sensing to the transcription of small heat shock proteins. Front. Plant Sci. 2021, 12, 710801. [Google Scholar] [CrossRef] [PubMed]
- Ritossa, F. A new puffing pattern induced by temperature shock and DNP in Drosophila. Experientia 1962, 18, 571–573. [Google Scholar] [CrossRef]
- Boston, R.S.; Viitanen, P.V.; Vierling, E. Molecular chaperones and protein folding in plants. Plant Mol. Biol. 1996, 32, 191–222. [Google Scholar] [CrossRef] [PubMed]
- Park, C.-J.; Seo, Y.-S. Heat shock proteins: A review of the molecular chaperones for plant immunity. Plant Pathol. J. 2015, 31, 323–333. [Google Scholar] [CrossRef] [PubMed]
- Walther-Larsen, H.; Brandt, J.; Collinge, D.B.; Thordal-Christensen, H. A pathogen-induced gene of barley encodes a HSP90 homologue showing striking similarity to vertebrate forms resident in the endoplasmic reticulum. Plant Mol. Biol. 1993, 21, 1097–1108. [Google Scholar] [CrossRef]
- Hein, I.; Barciszewska-Pacak, M.; Hrubikova, K.; Williamson, S.; Dinesen, M.; Soenderby, I.E.; Sundar, S.; Jarmolowski, A.; Shirasu, K.; Lacomme, C. Virus-induced gene silencing-based functional characterization of genes associated with powdery mildew resistance in barley. Plant Physiol. 2005, 138, 2155–2164. [Google Scholar] [CrossRef]
- Shirasu, K. The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu. Rev. Plant Biol. 2009, 60, 139–164. [Google Scholar] [CrossRef]
- Suzuki, N.; Mittler, R. Reactive oxygen species and temperature stresses: A delicate balance between signaling and destruction. Physiol. Plant. 2006, 126, 45–51. [Google Scholar] [CrossRef]
- Medina, E.; Kim, S.H.; Yun, M.; Choi, W.G. Recapitulation of the function and role of ros generated in response to heat stress in plants. Plants 2021, 10, 371. [Google Scholar] [CrossRef]
- Künstler, A.; Bacsó, R.; Hafez, Y.M.; Király, L. Reactive oxygen species and plant disease resistance. In Reactive Oxygen Species Oxidative Damage Plants under Stress; Gupta, D.K., Palma, J.M., Corpas, F.J., Eds.; Springer International Publishing: Cham, Switzerland, 2015; pp. 269–303. [Google Scholar] [CrossRef]
- Lee, D.H.; Lal, N.K.; Lin, Z.J.D.; Ma, S.; Liu, J.; Castro, B.; Toruño, T.; Dinesh-Kumar, S.P.; Coaker, G. Regulation of reactive oxygen species during plant immunity through phosphorylation and ubiquitination of RBOHD. Nat. Commun. 2020, 11, 1838. [Google Scholar] [CrossRef]
- Marcec, M.J.; Tanaka, K. Crosstalk between calcium and ROS signaling during flg22-triggered immune response in Arabidopsis leaves. Plants 2022, 11, 14. [Google Scholar] [CrossRef] [PubMed]
- Marino, D.; Dunand, C.; Puppo, A.; Pauly, N. A burst of plant NADPH oxidases. Trends Plant Sci. 2012, 17, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Navathe, S.; Singh, S.; Singh, V.K.; Chand, R.; Mishra, V.K.; Joshi, A.K. Genome-wide mining of respiratory burst homologs and its expression in response to biotic and abiotic stresses in Triticum aestivum. Genes Genom. 2019, 41, 1027–1043. [Google Scholar] [CrossRef] [PubMed]
- Proels, R.K.; Oberhollenzer, K.; Pathuri, I.P.; Hensel, G.; Kumlehn, J.; Hückelhoven, R. RBOHF2 of barley is required for normal development of penetration resistance to the parasitic fungus Blumeria graminis f. sp. hordei. Mol. Plant-Microbe Interact. 2010, 23, 1143–1150. [Google Scholar] [CrossRef]
- Torres, D.P.; Proels, R.K.; Schempp, H.; Hückelhoven, R. Silencing of RBOHF2 causes leaf age–dependent accelerated senescence, salicylic acid accumulation, and powdery mildew resistance in barley. Mol. Plant-Microbe Interact. 2017, 30, 906–918. [Google Scholar] [CrossRef]
- Király, L.; Hafez, Y.M.; Fodor, J.; Király, Z. Suppression of Tobacco mosaic virus-induced hypersensitive-type necrotization in tobacco at high temperature is associated with downregulation of NADPH oxidase and superoxide and stimulation of dehydroascorbate reductase. J. Gen. Virol. 2008, 89, 799–808. [Google Scholar] [CrossRef]
- Bostancioglu, S.M.; Tombuloglu, G.; Tombuloglu, H. Genome-wide identification of barley MCs (metacaspases) and their possible roles in boron-induced programmed cell death. Mol. Biol. Rep. 2018, 45, 211–225. [Google Scholar] [CrossRef]
- Mittler, R.; Simon, L.; Lam, E. Pathogen-induced programmed cell death in tobacco. J. Cell Sci. 1997, 110, 1333–1344. [Google Scholar] [CrossRef]
- Dickman, M.B.; Fluhr, R. Centrality of host cell death in plant-microbe interactions. Annu. Rev. Phytopathol. 2013, 51, 543–570. [Google Scholar] [CrossRef]
- Ye, C.; Zheng, S.; Jiang, D.; Lu, J.; Huang, Z.; Liu, Z.; Zhou, H.; Zhuang, C.; Li, J. Initiation and execution of programmed cell death and regulation of reactive oxygen species in plants. Int. J. Mol. Sci. 2021, 22, 1294. [Google Scholar] [CrossRef] [PubMed]
- Fagundes, D.; Bohn, B.; Cabreira, C.; Leipelt, F.; Dias, N.; Bodanese-Zanettini, M.H.; Cagliari, A. Caspases in plants: Metacaspase gene family in plant stress responses. Funct. Integr. Genom. 2015, 15, 639–649. [Google Scholar] [CrossRef] [PubMed]
- Hückelhoven, R. BAX Inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives. Apoptosis 2004, 9, 299–307. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, N.; Lam, E. Bax inhibitor-1, a conserved cell death suppressor, is a key molecular switch downstream from a variety of biotic and abiotic stress signals in plants. Int. J. Mol. Sci. 2009, 10, 3149–3167. [Google Scholar] [CrossRef]
- Hückelhoven, R.; Dechert, C.; Trujillo, M.; Kogel, K.-H. Differential expression of putative cell death regulator genes in near-isogenic, resistant and susceptible barley lines during interaction with the powdery mildew fungus. Plant Mol. Biol. 2001, 47, 739–748. [Google Scholar] [CrossRef]
- Hückelhoven, R.; Dechert, C.; Kogel, K.-H. Overexpression of barley BAX inhibitor 1 induces breakdown of mlo-mediated penetration resistance to Blumeria graminis. Proc. Natl. Acad. Sci. USA 2003, 100, 5555–5560. [Google Scholar] [CrossRef]
- Eichmann, R.; Dechert, C.; Kogel, K.H.; Hückelhoven, R. Transient over-expression of barley BAX Inhibitor-1 weakens oxidative defence and MLA12-mediated resistance to Blumeria graminis f. sp. hordei. Mol. Plant Pathol. 2006, 7, 543–552. [Google Scholar] [CrossRef]
- Babaeizad, V.; Imani, J.; Kogel, K.H.; Eichmann, R.; Hückelhoven, R. Over-expression of the cell death regulator BAX inhibitor-1 in barley confers reduced or enhanced susceptibility to distinct fungal pathogens. Theor. Appl. Genet. 2009, 118, 455–463. [Google Scholar] [CrossRef]
- Watanabe, N.; Lam, E. Arabidopsis Bax inhibitor-1 functions as an attenuator of biotic and abiotic types of cell death. Plant J. 2006, 45, 884–894. [Google Scholar] [CrossRef]
- Isbat, M.; Zeba, N.; Kim, S.R.; Hong, C.B. A BAX inhibitor-1 gene in Capsicum annuum is induced under various abiotic stresses and endows multi-tolerance in transgenic tobacco. J. Plant Physiol. 2009, 166, 1685–1693. [Google Scholar] [CrossRef]
- Lu, P.-P.; Yu, T.-F.; Zheng, W.-J.; Chen, M.; Zhou, Y.-B.; Chen, J.; Ma, Y.-Z.; Xi, Y.-J.; Xu, Z.-S. The wheat Bax inhibitor-1 protein interacts with an aquaporin TaPIP1 and enhances disease resistance in Arabidopsis. Front. Plant Sci. 2018, 9, 20. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Tang, C.; Huang, X.; Li, F.; Chen, X.; Zhang, G.; Sun, Y.; Han, D.; Kang, Z. Wheat BAX inhibitor-1 contributes to wheat resistance to Puccinia striiformis. J. Exp. Bot. 2012, 63, 4571–4584. [Google Scholar] [CrossRef] [PubMed]
- Breen, S.; Williams, S.J.; Outram, M.; Kobe, B.; Solomon, P.S. Emerging insights into the functions of pathogenesis-related protein 1. Trends Plant Sci. 2017, 22, 871–879. [Google Scholar] [CrossRef] [PubMed]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef]
- Xin, M.; Wang, X.; Peng, H.; Yao, Y.; Xie, C.; Han, Y.; Ni, Z.; Sun, Q. Transcriptome comparison of susceptible and resistant wheat in response to powdery mildew infection. Genom. Proteom. Bioinform. 2012, 10, 94–106. [Google Scholar] [CrossRef]
- Schultheiss, H.; Dechert, C.; Király, L.; Fodor, J.; Michel, K.; Kogel, K.H.; Hückelhoven, R. Functional assessment of the pathogenesis-related protein PR-1b in barley. Plant Sci. 2003, 165, 1275–1280. [Google Scholar] [CrossRef]
- Zhang, W.-J.; Pedersen, C.; Kwaaitaal, M.; Gregersen, P.L.; Mørch, S.M.; Hanisch, S.; Kristensen, A.; Fuglsang, A.T.; Collinge, D.B.; Thordal-Christensen, H. Interaction of barley powdery mildew effector candidate CSEP0055 with the defence protein PR17c. Mol. Plant Pathol. 2012, 13, 1110–1119. [Google Scholar] [CrossRef]
- Ma, L.; Qiao, J.; Kong, X.; Zou, Y.; Xu, X.; Chen, X.; Hu, X. Effect of low temperature and wheat winter-hardiness on survival of Puccinia striiformis f. sp. tritici under controlled conditions. PLoS ONE 2015, 10, e0130691. [Google Scholar] [CrossRef]
- Pennington, H.G.; Li, L.; Spanu, P.D. Identification and selection of normalization controls for quantitative transcript analysis in Blumeria graminis. Mol. Plant Pathol. 2016, 17, 625–633. [Google Scholar] [CrossRef]
- Höller, K.; Király, L.; Künstler, A.; Müller, M.; Gullner, G.; Fattinger, M.; Zechmann, B. Enhanced glutathione metabolism is correlated with sulfur-induced resistance in Tobacco mosaic virus-infected genetically susceptible Nicotiana tabacum plants. Mol. Plant-Microbe Interact. 2010, 23, 1448–1459. [Google Scholar] [CrossRef]
- Trujillo, M.; Altschmied, L.; Schweizer, P.; Kogel, K.H.; Hückelhoven, R. Respiratory burst oxidase homologue A of barley contributes to penetration by the powdery mildew fungus Blumeria graminis f. sp. hordei. J. Exp. Bot. 2006, 57, 3781–3791. [Google Scholar] [CrossRef] [PubMed]
- Eichmann, R.; Bischof, M.; Weis, C.; Shaw, J.; Lacomme, C.; Schweizer, P.; Duchkov, D.; Hensel, G.; Kumlehn, J.; Hückelhoven, R. Bax inhibitor-1 is required for full susceptibility of barley to powdery mildew. Mol. Plant-Microbe Interact. 2010, 23, 1217–1227. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
- Chaudhary, R.; Baranwal, V.K.; Kumar, R.; Sircar, D.; Chauhan, H. Genome-wide identification and expression analysis of Hsp70, Hsp90, and Hsp100 heat shock protein genes in barley under stress conditions and reproductive development. Funct. Integr. Genom. 2019, 19, 1007–1022. [Google Scholar] [CrossRef]







Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kolozsváriné Nagy, J.; Schwarczinger, I.; Király, L.; Bacsó, R.; Ádám, A.L.; Künstler, A. Near-Isogenic Barley Lines Show Enhanced Susceptibility to Powdery Mildew Infection Following High-Temperature Stress. Plants 2022, 11, 903. https://doi.org/10.3390/plants11070903
Kolozsváriné Nagy J, Schwarczinger I, Király L, Bacsó R, Ádám AL, Künstler A. Near-Isogenic Barley Lines Show Enhanced Susceptibility to Powdery Mildew Infection Following High-Temperature Stress. Plants. 2022; 11(7):903. https://doi.org/10.3390/plants11070903
Chicago/Turabian StyleKolozsváriné Nagy, Judit, Ildikó Schwarczinger, Lóránt Király, Renáta Bacsó, Attila L. Ádám, and András Künstler. 2022. "Near-Isogenic Barley Lines Show Enhanced Susceptibility to Powdery Mildew Infection Following High-Temperature Stress" Plants 11, no. 7: 903. https://doi.org/10.3390/plants11070903
APA StyleKolozsváriné Nagy, J., Schwarczinger, I., Király, L., Bacsó, R., Ádám, A. L., & Künstler, A. (2022). Near-Isogenic Barley Lines Show Enhanced Susceptibility to Powdery Mildew Infection Following High-Temperature Stress. Plants, 11(7), 903. https://doi.org/10.3390/plants11070903

