Discerning Transcriptomic and Biochemical Responses of Arabidopsis thaliana Treated with the Biofertilizer Strain Priestia megaterium YC4-R4: Boosting Plant Central and Secondary Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria Growth and Inoculation Process
2.2. Plant Material, Growth Conditions, and Phenotyping
2.3. Total RNA Extraction and Transcriptomic Analysis
2.4. Gene Expression Level by qPCR
2.5. Iron Determination
2.6. Quantification of Chlorophyll Levels
2.7. Cellulose and Lipid Determination
2.8. Determination of Total Phenol and Flavonoid Compounds
2.9. Soluble Sugar Measuring
2.10. Statistical and Analysis Software
3. Results
3.1. Bacteria Inoculation and Plant Phenotyping
3.2. Total RNA Extraction and Transcriptomic Analysis
3.3. Gene Expression Level by qRT-PCR
3.4. Iron and Chlorophyll Content
3.5. Cellulose and Lipid Determination
3.6. Total Phenol and Flavonoid Content
3.7. Soluble Sugar Content
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- DeLucia, E.H.; Gomez-Casanovas, N.; Greenberg, J.A.; Hudiburg, T.W.; Kantola, I.B.; Long, S.P.; Miller, A.D.; Ort, D.R.; Parton, W.J. The theoretical limit to plant productivity. Environ. Sci. Technol. 2014, 48, 9471–9477. [Google Scholar] [CrossRef] [PubMed]
- Manners, R.; van Etten, J. Are agricultural researchers working on the right crops to enable food and nutrition security under future climates? Glob. Environ. Chang. 2018, 53, 182–194. [Google Scholar] [CrossRef]
- Mosier, S.; Córdova, S.C.; Robertson, G.P. Restoring soil fertility on degraded lands to meet food, fuel, and climate security needs via perennialization. Front. Sustain. Food Syst. 2021, 5, 706142. [Google Scholar] [CrossRef]
- Borrelli, P.; Robinson, D.A.; Panagos, P.; Lugato, E.; Yang, J.E.; Alewell, C.; Wuepper, D.; Montanarella, L.; Ballabio, C. Land use and climate change impacts on global soil erosion by water (2015–2070). Proc. Natl. Acad. Sci. USA 2020, 117, 21994–22001. [Google Scholar] [CrossRef] [PubMed]
- Camacho, A.; Mora, C.; Picazo, A.; Rochera, C.; Camacho-Santamans, A.; Morant, D.; Roca-Pérez, L.; Ramos-Miras, J.J.; Rodríguez-Martín, J.A.; Boluda, R. Effects of soil quality on the microbial community structure of poorly evolved Mediterranean soils. Toxics 2022, 10, 14. [Google Scholar] [CrossRef]
- Hermans, S.M.; Buckley, H.L.; Case, B.S.; Curran-Cournane, F.; Taylor, M.; Lear, G. Using soil bacterial communities to predict physico-chemical variables and soil quality. Microbiome 2020, 8, 79. [Google Scholar] [CrossRef]
- Timmis, K.; Ramos, J.L. The soil crisis: The need to treat as a global health problem and the pivotal role of microbes in prophylaxis and therapy. Microb. Biotechnol. 2021, 14, 769–797. [Google Scholar] [CrossRef]
- Bonanomi, G.; Idbella, M.; Abd-ElGawad, A. Microbiota management for effective disease suppression: A systematic comparison between soil and mammals gut. Sustainability 2021, 13, 7608. [Google Scholar] [CrossRef]
- Santos, L.F.; Olivares, F.L. Plant microbiome structure and benefits for sustainable agriculture. Curr. Plant Biol. 2021, 26, 100198. [Google Scholar] [CrossRef]
- Trivedi, P.; Mattupalli, C.; Eversole, K.; Leach, J.E. Enabling sustainable agriculture through understanding and enhancement of microbiomes. New Physiol. 2021, 230, 2129–2147. [Google Scholar] [CrossRef]
- Anzalone, A.; Di Guardo, M.; Bella, P.; Ghadamgahi, F.; Dimaria, G.; Zago, R.; Cirvilleri, G.; Catara, V. Bioprospecting of beneficial bacteria traits associated with tomato root in greenhouse environment reveals that sampling sites impact more than the root compartment. Front. Plant Sci. 2021, 12, 637582. [Google Scholar] [CrossRef]
- Ortuño, N.; Castillo, J.A.; Claros, M.; Navia, O.; Angulo, M.; Barja, D.; Gutiérrez, C.; Angulo, V. Enhancing the sustainability of quinoa production and soil resilience by using bioproducts made with native microorganisms. Agronomy 2013, 3, 732–746. [Google Scholar] [CrossRef]
- Peng, J.; Ma, J.; Wei, X.; Zhang, C.; Jia, N.; Wang, X.; Wang, E.T.; Hu, D.; Wang, Z. Accumulation of beneficial bacteria in the rhizosphere of maize (Zea mays L.) grown in a saline soil in responding to a consortium of plant growth promoting rhizobacteria. Ann. Microbiol. 2021, 71, 40. [Google Scholar] [CrossRef]
- Santos, M.S.; Nogueira, M.A.; Hungria, M. Microbial inoculants: Reviewing the past, discussing the present and previewing an outstanding future for the use of beneficial bacteria in agriculture. AMB Express 2019, 9, 205. [Google Scholar] [CrossRef] [PubMed]
- Yañez-Yazlle, M.F.; Romano-Armada, N.; Rajal, V.B.; Irazusta, V.P. Amelioration of saline stress on chia (Salvia hispanica L.) seedlings inoculated with halotolerant plant growth-promoting bacteria isolated from hypersaline environments. Front. Agron. 2021, 3, 665798. [Google Scholar] [CrossRef]
- Nelson, L.M. Plant growth promoting rhizobacteria (PGPR): Prospects for new inoculants. Crop Manag. 2004, 3, 1–7. [Google Scholar] [CrossRef]
- Bhardwaj, D.; Ansari, M.W.; Sahoo, R.K.; Tuteja, N. Biofertilizers function as key player in sustainable agriculture by improving soil fertility, plant tolerance and crop productivity. Microb. Cell Factories 2014, 13, 66. [Google Scholar] [CrossRef] [PubMed]
- Ahemad, M.; Kibret, M. Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J. King Saud Univ. Sci. 2014, 26, 1–20. [Google Scholar] [CrossRef]
- Olanrewaju, O.S.; Glick, B.R.; Babalola, O.O. Mechanisms of action of plant growth promoting bacteria. World J. Microbiol. Biotechnol. 2017, 33, 197. [Google Scholar] [CrossRef]
- Backer, R.; Rokem, J.S.; Ilangumaran, G.; Lamont, J.; Praslickova, D.; Ricci, E.; Subramanian, S.; Smith, D.L. Plant growth-promoting rhizobacteria: Context, mechanisms of action, and roadmap to commercialization of biostimulants for sustainable agriculture. Front. Sci. 2018, 9, 1473. [Google Scholar] [CrossRef]
- Galicia-Campos, E.; Ramos-Solano, B.; Montero-Palmero, M.B.; Gutierrez-Mañero, F.J.; García-Villaraco, A. Management of plant physiology with beneficial bacteria to improve leaf bioactive profiles and plant adaptation under saline stress in Olea europea L. Foods 2020, 9, 57. [Google Scholar] [CrossRef] [PubMed]
- Prado, R.M.d.; Porto, C.; Nunes, E.; Aguiar, C.L.d.; Pilau, E.J. Metabolomics and agriculture: What can be done? mSystems 2018, 3, e00156-17. [Google Scholar] [CrossRef] [PubMed]
- Song, J.B.; Huang, R.K.; Guo, M.J.; Zhou, Q.; Guo, R.; Zhang, S.Y.; Yao, J.W.; Bai, Y.N.; Huang, X. Lipids associated with plant-bacteria interaction identified using a metabolomics approach in an Arabidopsis thaliana model. PeerJ 2022, 10, e13293. [Google Scholar] [CrossRef] [PubMed]
- Bedini, E.; De Castro, C.; Erbs, G.; Mangoni, L.; Dow, J.M.; Newman, M.-A.; Parrilli, M.; Unverzagt, C. Structure-dependent modulation of a pathogen response in plants by synthetic o-antigen polysaccharides. J. Am. Chem. Soc. 2005, 127, 2414–2416. [Google Scholar] [CrossRef] [PubMed]
- Salwan, R.; Sharma, A.; Sharma, V. Microbes mediated plant stress tolerance in saline agricultural ecosystem. Plant Soil 2019, 442, 1–22. [Google Scholar] [CrossRef]
- Oleńska, E.; Małek, W.; Wójcik, M.; Swiecicka, I.; Thijs, S.; Vangronsveld, J. Beneficial features of plant growth-promoting rhizobacteria for improving plant growth and health in challenging conditions: A methodical review. Sci. Total Environ. 2020, 743, 140682. [Google Scholar] [CrossRef]
- Sicuia, O.; Constantinescu, F.; Cornea, C.P. Biodiversity of Bacillus subtilis group and beneficial traits of Bacillus species useful in plant protection. Rom. Biotechnol. Lett. 2015, 20, 10737–10750. [Google Scholar]
- Radhakrishnan, R.; Hashem, A.; Abd Allah, E.F. Bacillus: A biological tool for crop improvement through bio-molecular changes in adverse environments. Front. Physiol. 2017, 8, 667. [Google Scholar] [CrossRef]
- Gupta, R.S.; Patel, S.; Saini, N.; Chen, S. Robust demarcation of 17 distinct Bacillus species clades, proposed as novel Bacillaceae genera, by phylogenomics and comparative genomic analyses: Description of Robertmurraya kyonggiensis sp. nov. and proposal for an emended genus Bacillus limiting it only to the members of the Subtilis and Cereus clades of species. Int. J. Syst. Evol. Microbiol. 2020, 70, 5753–5798. [Google Scholar] [CrossRef]
- Vílchez, J.I.; Tang, Q.; Kaushal, R.; Wang, W.; Lv, S.; He, D.; Chu, Z.; Zhang, H.; Liu, R.; Zhang, H. Genome sequence of Bacillus megaterium strain YC4-R4, a plant growth-promoting rhizobacterium isolated from a high-salinity environment. Genome Announc. 2018, 6, e00527-18. [Google Scholar] [CrossRef]
- Vílchez, J.I.; Tang, Q.; Kaushal, R.; Wang, W.; Lv, S.; He, D.; Chu, Z.; Zhang, H.; Liu, R.; Zhang, H. Complete genome sequence of Bacillus megaterium strain TG1-E1, a plant drought tolerance-enhancing bacterium. Microbiol. Resour. Announc. 2018, 7, e00842-18. [Google Scholar] [CrossRef] [PubMed]
- Nascimento, F.X.; Hernández, A.G.; Glick, B.R.; Rossi, M.J. Plant growth-promoting activities and genomic analysis of the stress-resistant Bacillus megaterium STB1, a bacterium of agricultural and biotechnological interest. Biotechnol. Rep. 2020, 25, e00406. [Google Scholar] [CrossRef] [PubMed]
- Dahmani, M.A.; Desrut, A.; Moumen, B.; Verdon, J.; Mermouri, L.; Kacem, M.; Coutos-Thévenot, P.; Kaid-Harche, M.; Bergès, T.; Vriet, C. Unearthing the plant growth-promoting traits of Bacillus megaterium RmBm31, an endophytic bacterium isolated from root nodules of Retama monosperma. Front. Plant Sci. 2020, 11, 124. [Google Scholar] [CrossRef] [PubMed]
- Vílchez, J.I.; Yang, Y.; He, D.; Zi, H.; Peng, L.; Lv, S.; Kaushal, R.; Wang, W.; Huang, W.; Liu, R.; et al. DNA demethylases are required for myo-inositol-mediated mutualism between plants and beneficial rhizobacteria. Nat. Plants 2020, 6, 983–995. [Google Scholar] [CrossRef] [PubMed]
- Edgar, R.; Domrachev, M.; Lash, A.E. Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 2002, 30, 207–210. [Google Scholar] [CrossRef]
- Czechowski, T.; Bari, R.P.; Stitt, M.; Scheible, W.R.; Udvardi, M.K. Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: Unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant J. Cell Mol. Biol. 2004, 38, 366–379. [Google Scholar] [CrossRef]
- Gautam, C.K.; Tsai, H.-H.; Schmidt, W. A Quick method to quantify iron in Arabidopsis seedlings. Bio Protoc. 2022, 12, e4342. [Google Scholar] [CrossRef]
- Wellburn, A.R. The spectral determination of chlorophylls a and b, as well as total carotenoids, using various solvents with spectrophotometers of different resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
- Rui, Y.; Anderson, C.T. Functional analysis of cellulose and xyloglucan in the walls of stomatal guard cells of Arabidopsis. Plant Physiol. 2016, 170, 1398–1419. [Google Scholar] [CrossRef]
- Updegraff, D.M. Semimicro determination of cellulose in biological materials. Anal. Biochem. 1969, 32, 420–424. [Google Scholar] [CrossRef]
- Men, T.; Trang, D.; Nguyen, Y.; Nguyen, T.; Binh, T. A simple spectrophotometric method for quantifying total lipids in plants and animals. Can. Tho. Univ. J. Sci. 2019, 11, 106. [Google Scholar] [CrossRef]
- Ainsworth, E.A.; Gillespie, K.M. Estimation of total phenolic content and other oxidation substrates in plant tissues using Folin-Ciocalteu reagent. Nat. Protoc. 2007, 2, 875–877. [Google Scholar] [CrossRef] [PubMed]
- López-Hidalgo, C.; Meijón, M.; Lamelas, L.; Valledor, L. The rainbow protocol: A sequential method for quantifying pigments, sugars, free amino acids, phenolics, flavonoids and MDA from a small amount of sample. Plant Cell Environ. 2021, 44, 1977–1986. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Wu, W.; Shen, S.; Fan, J.; Chang, Y.; Chen, S.; Ye, X. Evaluation of colorimetric methods for quantification of citrus flavonoids to avoid misuse. Anal. Methods 2018, 10, 2575–2587. [Google Scholar] [CrossRef]
- Chow, P.S.; Landhäusser, S.M. A method for routine measurements of total sugar and starch content in woody plant tissues. Tree Physiol. 2004, 24, 1129–1136. [Google Scholar] [CrossRef]
- Basu, A.; Prasad, P.; Das, S.N.; Kalam, S.; Sayyed, R.Z.; Reddy, M.S.; El Enshasy, H. Plant growth promoting rhizobacteria (PGPR) as green bioinoculants: Recent developments, constraints, and prospects. Sustainability 2021, 13, 1140. [Google Scholar] [CrossRef]
- Barros-Rodríguez, A.; Rangseekaew, P.; Lasudee, K.; Pathom-aree, W.; Manzanera, M. Regulatory risks associated with bacteria as biostimulants and biofertilizers in the frame of the European Regulation (EU) 2019/1009. Sci. Total Environ. 2020, 740, 140239. [Google Scholar] [CrossRef]
- Herrmann, L.; Lesueur, D. Challenges of formulation and quality of biofertilizers for successful inoculation. Appl. Microbiol. Biotechnol. 2013, 97, 8859–8873. [Google Scholar] [CrossRef]
- Malusá, E.; Sas-Paszt, L.; Ciesielska, J. Technologies for beneficial microorganisms inocula used as biofertilizers. Sci. J. 2012, 2012, 491206. [Google Scholar] [CrossRef]
- Ambreetha, S.; Chinnadurai, C.; Marimuthu, P.; Balachandar, D. Plant-associated Bacillus modulates the expression of auxin-responsive genes of rice and modifies the root architecture. Rhizosphere 2018, 5, 57–66. [Google Scholar] [CrossRef]
- López-Bucio, J.; Campos-Cuevas, J.C.; Hernández-Calderón, E.; Velásquez-Becerra, C.; Farías-Rodríguez, R.; Macías-Rodríguez, L.I.; Valencia-Cantero, E. Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin- and ethylene-independent signaling mechanism in Arabidopsis thaliana. Mol. Plant Microbe Interact. MPMI 2007, 20, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Wei, T.; Nelson, A.; Johnson, E. Increasing cellulose production and transgenic plant growth in forest tree species. J. For. Res. 2005, 16, 67–72. [Google Scholar] [CrossRef]
- Sumiyoshi, M.; Nakamura, A.; Nakamura, H.; Hakata, M.; Ichikawa, H.; Hirochika, H.; Ishii, T.; Satoh, S.; Iwai, H. Increase in cellulose accumulation and improvement of saccharification by overexpression of arabinofuranosidase in rice. PLoS ONE 2013, 8, e78269. [Google Scholar] [CrossRef] [PubMed]
- Menna, A.; Dora, S.; Sancho-Andrés, G.; Kashyap, A.; Meena, M.K.; Sklodowski, K.; Gasperini, D.; Coll, N.S.; Sánchez-Rodríguez, C. A primary cell wall cellulose-dependent defense mechanism against vascular pathogens revealed by time-resolved dual transcriptomics. BMC Biol. 2021, 19, 161. [Google Scholar] [CrossRef] [PubMed]
- Kesten, C.; Menna, A.; Sánchez-Rodríguez, C. Regulation of cellulose synthesis in response to stress. Curr. Opin. Plant Biol. 2017, 40, 106–113. [Google Scholar] [CrossRef]
- Gigli-Bisceglia, N.; Engelsdorf, T.; Hamann, T. Plant cell wall integrity maintenance in model plants and crop species-relevant cell wall components and underlying guiding principles. Cell. Mol. Life Sci. CMLS 2020, 77, 2049–2077. [Google Scholar] [CrossRef]
- Pršić, J.; Ongena, M. Elicitors of plant immunity triggered by beneficial bacteria. Front. Plant Sci. 2020, 11, 594530. [Google Scholar] [CrossRef]
- Bag, S.; Mondal, A.; Majumder, A.; Mondal, S.K.; Banik, A. Flavonoid mediated selective cross-talk between plants and beneficial soil microbiome. Phytochem. Rev. 2022, 21, 1739–1760. [Google Scholar] [CrossRef]
- Zuluaga, M.Y.A.; Milani, K.M.L.; Miras-Moreno, B.; Lucini, L.; Valentinuzzi, F.; Mimmo, T.; Pii, Y.; Cesco, S.; Rodrigues, E.P.; de Oliveira, A.L.M. Inoculation with plant growth-promoting bacteria alters the rhizosphere functioning of tomato plants. Appl. Soil Ecol. 2021, 158, 103784. [Google Scholar] [CrossRef]
- He, D.; Singh, S.K.; Peng, L.; Kaushal, R.; Vílchez, J.I.; Shao, C.; Wu, X.; Zheng, S.; Morcillo, R.J.L.; Paré, P.W.; et al. Flavonoid-attracted Aeromonas sp. from the Arabidopsis root microbiome enhances plant dehydration resistance. ISME J. 2022, 16, 2622–2632. [Google Scholar] [CrossRef]
- Mierziak, J.; Kostyn, K.; Kulma, A. Flavonoids as important molecules of plant interactions with the environment. Molecules 2014, 19, 16240–16265. [Google Scholar] [CrossRef] [PubMed]
- Bomal, C.; Bedon, F.; Caron, S.; Mansfield, S.D.; Levasseur, C.; Cooke, J.E.K.; Blais, S.; Tremblay, L.; Morency, M.-J.; Pavy, N.; et al. Involvement of Pinus taeda MYB1 and MYB8 in phenylpropanoid metabolism and secondary cell wall biogenesis: A comparative in planta analysis. J. Exp. Bot. 2008, 59, 3925–3939. [Google Scholar] [CrossRef] [PubMed]
- Spencer, J.P.E. Beyond antioxidants: The cellular and molecular interactions of flavonoids and how these underpin their actions on the brain. Proc. Nutr. Soc. 2010, 69, 244–260. [Google Scholar] [CrossRef] [PubMed]
- Mnich, E.; Bjarnholt, N.; Eudes, A.; Harholt, J.; Holland, C.; Jørgensen, B.; Larsen, F.H.; Liu, M.; Manat, R.; Meyer, A.S.; et al. Phenolic cross-links: Building and de-constructing the plant cell wall. Nat. Prod. Rep. 2020, 37, 919–961. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ohyama, K.; Julie, B.; Chen, Z.; Yang, J.; Zhang, M.; Muranaka, T.; Maurel, C.; Zhu, J.-K.; Gong, Z. Dolichol biosynthesis and its effects on the unfolded protein response and abiotic stress resistance in Arabidopsis. Plant Cell 2008, 20, 1879–1898. [Google Scholar] [CrossRef]
- Champeyroux, C.; Stoof, C.; Rodriguez-Villalon, A. Signaling phospholipids in plant development: Small couriers determining cell fate. Curr. Opin. Plant Biol. 2020, 57, 61–71. [Google Scholar] [CrossRef] [PubMed]
- Brewin, N.J. Plant cell wall remodelling in the rhizobium–legume symbiosis. Crit. Rev. Plant Sci. 2004, 23, 293–316. [Google Scholar] [CrossRef]
- Ohto, M.; Onai, K.; Furukawa, Y.; Aoki, E.; Araki, T.; Nakamura, K. Effects of sugar on vegetative development and floral transition in Arabidopsis. Plant Physiol. 2001, 127, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Lastdrager, J.; Hanson, J.; Smeekens, S. Sugar signals and the control of plant growth and development. J. Exp. Bot. 2014, 65, 799–807. [Google Scholar] [CrossRef]
- Ciereszko, I. Regulatory roles of sugars in plant growth and development. Acta Soc. Bot. Pol. 2018, 87, 3583. [Google Scholar] [CrossRef]
- Chuljerm, H.; Deeudom, M.; Fucharoen, S.; Mazzacuva, F.; Hider, R.C.; Srichairatanakool, S.; Cilibrizzi, A. Characterization of two siderophores produced by Bacillus megaterium: A preliminary investigation into their potential as therapeutic agents. Biochim. Biophys. Acta Gen. Subj. 2020, 1864, 129670. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Gruissem, W.; Bhullar, N. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice. Front. Plant Sci. 2013, 4, 156. [Google Scholar] [CrossRef]
- Li, Y.; He, N.; Hou, J.; Xu, L.; Liu, C.; Zhang, J.; Wang, Q.; Zhang, X.; Wu, X. Factors influencing leaf chlorophyll content in natural forests at the biome scale. Front. Ecol. Evol. 2018, 6, 64. [Google Scholar] [CrossRef]
- Kasmiyati, S.; Kristiani, E.; Marina Herawati, M. Effect of induced polyploidy on plant growth, chlorophyll and flavonoid content of Artemisia cina. Biosaintifika J. Biol. Biol. Educ. 2020, 12, 90–96. [Google Scholar] [CrossRef]
- Xu, K.; Zhang, X.-M.; Chen, H.; Zhang, C.; Zhu, J.; Cheng, Z.; Huang, P.; Zhou, X.; Miao, Y.; Feng, X.; et al. Fine-tuning florigen increases field yield through improving photosynthesis in soybean. Front. Plant Sci. 2021, 12, 710754. [Google Scholar] [CrossRef]
- Zhang, H.; Zhao, Y.; Zhu, J.-K. Thriving under stress: How plants balance growth and the stress response. Dev. Cell 2020, 55, 529–543. [Google Scholar] [CrossRef]
- Xu, K.; Xu, X.; Fukao, T.; Canlas, P.; Maghirang-Rodriguez, R.; Heuer, S.; Ismail, A.M.; Bailey-Serres, J.; Ronald, P.C.; Mackill, D.J. Sub1A is an ethylene-response-factor-like gene that confers submergence tolerance to rice. Nature 2006, 442, 705–708. [Google Scholar] [CrossRef]
- Kudo, M.; Kidokoro, S.; Yoshida, T.; Mizoi, J.; Kojima, M.; Takebayashi, Y.; Sakakibara, H.; Fernie, A.R.; Shinozaki, K.; Yamaguchi-Shinozaki, K. A gene-stacking approach to overcome the trade-off between drought stress tolerance and growth in Arabidopsis. Plant J. 2019, 97, 240–256. [Google Scholar] [CrossRef]
- Rivero, R.M.; Kojima, M.; Gepstein, A.; Sakakibara, H.; Mittler, R.; Gepstein, S.; Blumwald, E. Delayed leaf senescence induces extreme drought tolerance in a flowering plant. Proc. Natl. Acad. Sci. USA 2007, 104, 19631–19636. [Google Scholar] [CrossRef]
- Zhao, Y.; Xing, L.; Wang, X.; Hou, Y.-J.; Gao, J.; Wang, P.; Duan, C.-G.; Zhu, X.; Zhu, J.-K. The ABA receptor PYL8 promotes lateral root growth by enhancing MYB77-dependent transcription of auxin-responsive genes. Sci. Signal. 2014, 7, ra53. [Google Scholar] [CrossRef] [PubMed]
- Saidi, S.; Cherif-Silini, H.; Chenari Bouket, A.; Silini, A.; Eshelli, M.; Luptakova, L.; Alenezi, F.N.; Belbahri, L. Improvement of Medicago sativa crops productivity by the co-inoculation of Sinorhizobium meliloti–actinobacteria under salt stress. Curr. Microbiol. 2021, 78, 1344–1357. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Z.; Zhang, H.; Leng, J.; Niu, H.; Chen, X.; Liu, D.; Chen, Y.; Gao, N.; Ying, H. Isolation and characterization of plant growth-promoting rhizobacteria and their effects on the growth of Medicago sativa L. under salinity conditions. Antonie Leeuwenhoek 2020, 113, 1263–1278. [Google Scholar] [CrossRef] [PubMed]
- Daur, I.; Saad, M.M.; Eida, A.A.; Ahmad, S.; Shah, Z.H.; Ihsan, M.Z.; Muhammad, Y.; Sohrab, S.S.; Hirt, H. Boosting Alfalfa (Medicago sativa L.) production with rhizobacteria from various plants in Saudi Arabia. Front. Microbiol. 2018, 9, 477. [Google Scholar] [CrossRef] [PubMed]
Gene | Locus | Read | Sequence (5′–3′) |
---|---|---|---|
IRT1 | AT4G19690 | Forward | GGAAGAATGTGGAAGCGAGT |
Reverse | TCTGGTTGGAGGAACGAAAC | ||
FRO2 | AT1G01580 | Forward | ATAGGGAGACGAAGGGAGGA |
Reverse | AGGAGTGATAGTGGCGAAGC | ||
FLS1 | AT5G08640 | Forward | TCCTCACTTCCTCCCTCCTT |
Reverse | CGCTGGTTGTTCTTTCTCTG | ||
XTH14 | AT4G25820 | Forward | CATCCTTACACTATCCACACCAA |
Reverse | CCACCCCATTTTTCTCGTT | ||
SPS4F | AT4G10120 | Forward | GCTCTTTGTGGTTGCTGTTG |
Reverse | CGCTTTGATGTTTCCGTTGT | ||
LAS1 | AT3G45130 | Forward | TGTTTCTCTTGCCTGCTCTG |
Reverse | GTAGTCCCCATCCTCCATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodrigues-dos Santos, A.S.; Rebelo-Romão, I.; Zhang, H.; Vílchez, J.I. Discerning Transcriptomic and Biochemical Responses of Arabidopsis thaliana Treated with the Biofertilizer Strain Priestia megaterium YC4-R4: Boosting Plant Central and Secondary Metabolism. Plants 2022, 11, 3039. https://doi.org/10.3390/plants11223039
Rodrigues-dos Santos AS, Rebelo-Romão I, Zhang H, Vílchez JI. Discerning Transcriptomic and Biochemical Responses of Arabidopsis thaliana Treated with the Biofertilizer Strain Priestia megaterium YC4-R4: Boosting Plant Central and Secondary Metabolism. Plants. 2022; 11(22):3039. https://doi.org/10.3390/plants11223039
Chicago/Turabian StyleRodrigues-dos Santos, Ana Sofia, Inês Rebelo-Romão, Huiming Zhang, and Juan Ignacio Vílchez. 2022. "Discerning Transcriptomic and Biochemical Responses of Arabidopsis thaliana Treated with the Biofertilizer Strain Priestia megaterium YC4-R4: Boosting Plant Central and Secondary Metabolism" Plants 11, no. 22: 3039. https://doi.org/10.3390/plants11223039
APA StyleRodrigues-dos Santos, A. S., Rebelo-Romão, I., Zhang, H., & Vílchez, J. I. (2022). Discerning Transcriptomic and Biochemical Responses of Arabidopsis thaliana Treated with the Biofertilizer Strain Priestia megaterium YC4-R4: Boosting Plant Central and Secondary Metabolism. Plants, 11(22), 3039. https://doi.org/10.3390/plants11223039