Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viral Isolate
2.2. Purification of CMV and Transmission Electron Microscopy
2.3. Molecular Characterization of CMV and Construction of a Phylogenetic Tree
2.4. Greenhouse Experimental Design and Sample Collection
2.5. Determination of Defense Responses Using Real-Time Quantitative PCR (qPCR)
2.6. Preparation of Ethanol Extract and HPLC Conditions
2.7. GC–MS Analysis
2.8. Statistical Analysis
3. Results
3.1. Virus Isolation, Purification and Molecular Identification of the CMV-CP Gene
3.2. Time-Course Expression of Defense-Related Genes
3.3. HPLC Analysis of Phenolic Compounds in Ethanolic Squash Extracts
3.4. HPLC Analysis of Flavonoid Compounds in Ethanolic Squash Extracts
3.5. GC–MS Analysis of Ethanolic Squash Extracts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Palukaitis, P.; García-Arenal, F. Cucumoviruses. Adv. Virus Res. 2003, 62, 241–323. [Google Scholar]
- Roossinck, M.J.; Bujorski, J.; Ding, S.W.; Hajimorad, R.; Hanada, K.; Scott, S.; Tousignant, M. Family Bromoviridae. In Virus Taxonomy—Seventh Report of the International Committee on Taxonomy of Viruses; van Regenmortel, M.H.V., Fauquet, C.M., Bishop, D.H.L., Castens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., et al., Eds.; Academic Press: San Diego, CA, USA, 1999; pp. 923–935. [Google Scholar]
- Douine, L. Recensement des especes vegetales sensibles au virus de la mosaique duconcombre (CMV) etude bibliographique. Ann. Phytopathol. 1979, 11, 439–475. [Google Scholar]
- Kaper, J.M.; Waterworth, H.E. Cucumoviruses. In Handbook of Plant Virus Infections and Comparative Diagnosis; Kurstak, E., Ed.; Elsevier: Amsterdam, The Netherlands, 1981; pp. 257–332. [Google Scholar]
- Palukaitis, P.; Roossinck, M.J.; Dietzgen, R.G.; Francki, R.I.B. Cucumber mosaic virus. Adv. Virus Res. 1992, 41, 281–348. [Google Scholar] [PubMed]
- Al-Saeedi, A.H.; Hossain, M.A. Total phenols, total flavonoids contents and free radical scavenging activity of seeds crude extracts of pigeon pea traditionally used in Oman for the treatment of several chronic diseases. Asian Pacific J. Trop. Dis. 2015, 5, 316–321. [Google Scholar] [CrossRef]
- Cheynier, V.; Comte, G.; Davies, K.M.; Lattanzio, V.; Martens, S. Plant phenolics: Recent advances on their biosynthesis, genetics, and ecophysiology. Plant Physiol. Biochem. 2013, 72, 1–20. [Google Scholar] [CrossRef]
- Bahar, T.; Qureshi, A.M.; Qurashi, F.; Abid, M.; Zahra, M.B.; Haider, M.S. Changes in phyto-chemical status upon viral infections in plant: A critical review. Phyton (B. Aires) 2021, 90, 75. [Google Scholar] [CrossRef]
- Jaiswal, N.; Singh, M.; Dubey, R.S.; Venkataramanappa, V.; Datta, D. Phytochemicals and antioxidative enzymes defence mechanism on occurrence of yellow vein mosaic disease of pumpkin (Cucurbita moschata). 3 Biotech 2013, 3, 287–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jabeen, N.; Ahmed, N.; Ghani, M.Y.; Sofi, P.A. Role of phenolic compounds in resistance to chilli wilt. Commun. Biometry Crop Sci. 2009, 4, 52–61. [Google Scholar]
- Sudhakar, N.; Nagendra-Prasad, D.; Mohan, N.; Murugesan, K. Induction of systemic resistance in Lycopersicon esculentum cv. PKM1 (tomato) against Cucumber mosaic virus by using ozone. J. Virol. Methods 2007, 139, 71–77. [Google Scholar] [CrossRef]
- Theapparat, Y.; Khongthong, S.; Rodjan, P.; Lertwittayanon, K.; Faroongsarng, D. Physicochemical properties and in vitro antioxidant activities of pyroligneous acid prepared from brushwood biomass waste of Mangosteen, Durian, Rambutan, and Langsat. J. For. Res. 2019, 30, 1139–1148. [Google Scholar] [CrossRef]
- Clark, M.F.; Adams, A.N. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
- Younes, H.A.A. Studies on Certain Virus Diseases Affecting Some Vegetable Crops under Greenhouse Conditions. Ph.D. Thesis, Faculty of Agriculture Saba Basha—Alexandria University, Bab Sharqi, Egypt, 1995. [Google Scholar]
- Abdelkhalek, A.; Ismail, I.A.I.A.; Dessoky, E.S.E.S.; El-Hallous, E.I.E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Green Version]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Hafez, E.E.; El-Morsi, A.A.; El-Shahaby, O.A.; Abdelkhalek, A.A. Occurrence of iris yellow spot virus from onion crops in Egypt. VirusDisease 2014, 25, 455–459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelkhalek, A.; Sanan-Mishra, N. Differential expression profiles of tomato miRNAs induced by tobacco mosaic virus. J. Agric. Sci. Technol. 2019, 21, 475–485. [Google Scholar]
- Abdelkhalek, A.; Qari, S.H.; Abu-Saied, M.A.A.-R.; Khalil, A.M.; Younes, H.A.; Nehela, Y.; Behiry, S.I. Chitosan Nanoparticles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants 2021, 10, 2701. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 16120. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. [Google Scholar] [CrossRef]
- Farahat, A.S.; El-Morsi, A.A.; Soweha, H.E.; Sofy, A.; Refaey, E. Metabolic Changes of Cucumber Plants Due to Two Cmv Egyptian Isolates. Arab Univ. J. Agric. Sci. 2018, 26, 2019–2028. [Google Scholar] [CrossRef] [Green Version]
- Elsharkawy, M.M. Induced systemic resistance against Cucumber mosaic virus by Phoma sp. GS8-2 stimulates transcription of pathogenesis-related genes in Arabidopsis. Pest Manag. Sci. 2019, 75, 859–866. [Google Scholar] [CrossRef] [PubMed]
- Daayf, F.; El Hadrami, A.; El-Bebany, A.F.; Henriquez, M.A.; Yao, Z.; Derksen, H.; El Hadrami, I.; Adam, L.R. Phenolic Compounds in Plant Defense and Pathogen Counter-Defense Mechanisms; Wiley-Blackwell: Oxford, UK, 2012; Volume 3. [Google Scholar]
- D’Maris Amick Dempsey, A.C.; Vlot, M.C.W.; Daniel, F.K.; Dempsey, D.A.; Vlot, A.C.; Wildermuth, M.C.; Klessig, D.F.; D’Maris Amick Dempsey, A.C.; Vlot, M.C.W.; Daniel, F.K.; et al. Salicylic acid biosynthesis and metabolism. Arab. Book/Am. Soc. Plant Biol. 2011, 9, e0156. [Google Scholar] [CrossRef] [Green Version]
- Abdelkhalek, A.; Salem, M.Z.M.; Hafez, E.; Behiry, S.I.; Qari, S.H. The Phytochemical, Antifungal, and First Report of the Antiviral Properties of Egyptian Haplophyllum tuberculatum Extract. Biology 2020, 9, 248. [Google Scholar] [CrossRef] [PubMed]
- Abdelkhalek, A.; Al-Askar, A.A.; Alsubaie, M.M.; Behiry, S.I. First Report of Protective Activity of Paronychia argentea Extract against Tobacco Mosaic Virus Infection. Plants 2021, 10, 2435. [Google Scholar] [CrossRef] [PubMed]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. J. 2013, 29, 193. [Google Scholar] [CrossRef] [Green Version]
- Mayers, C.N.; Lee, K.-C.; Moore, C.A.; Wong, S.-M.; Carr, J.P. Salicylic acid-induced resistance to Cucumber mosaic virus in squash and Arabidopsis thaliana: Contrasting mechanisms of induction and antiviral action. Mol. Plant-Microbe Interact. 2005, 18, 428–434. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelkhalek, A.; Dessoky, E.S.E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef]
- Niggeweg, R.; Michael, A.J.; Martin, C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 2004, 22, 746. [Google Scholar] [CrossRef]
- Kundu, A.; Vadassery, J. Chlorogenic acid-mediated chemical defence of plants against insect herbivores. Plant Biol. 2019, 21, 185–189. [Google Scholar] [CrossRef]
- Leiss, K.A.; Maltese, F.; Choi, Y.H.; Verpoorte, R.; Klinkhamer, P.G.L. Identification of chlorogenic acid as a resistance factor for thrips in chrysanthemum. Plant Physiol. 2009, 150, 1567–1575. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wojciechowska, E.; Weinert, C.H.; Egert, B.; Trierweiler, B.; Schmidt-Heydt, M.; Horneburg, B.; Graeff-Hönninger, S.; Kulling, S.E.; Geisen, R. Chlorogenic acid, a metabolite identified by untargeted metabolome analysis in resistant tomatoes, inhibits the colonization by Alternaria alternata by inhibiting alternariol biosynthesis. Eur. J. Plant Pathol. 2014, 139, 735–747. [Google Scholar] [CrossRef] [Green Version]
- Ai, H.-W.; Kang, Y.-X.; Cao, Y.; Zheng, C.-J. Antifungal properties and chemical analysis of essential oil from Vitex negundo seeds. J. Pharm. Res. Int. 2014, 541–548. [Google Scholar] [CrossRef]
- Ngadze, E.; Icishahayo, D.; Coutinho, T.A.; Van der Waals, J.E. Role of polyphenol oxidase, peroxidase, phenylalanine ammonia lyase, chlorogenic acid, and total soluble phenols in resistance of potatoes to soft rot. Plant Dis. 2012, 96, 186–192. [Google Scholar] [CrossRef] [Green Version]
- Anuradha, C.; Selvarajan, R.; Vasantha, S.; Suresha, G.S. Biochemical Characterization of Compatible Plant Virus Interaction: A Case Study with Bunchy Top Virus-Banana Host-Pathosystem. Plant Signal Behav. 2011, 6, 501–509. [Google Scholar] [CrossRef] [Green Version]
- Siddique, Z.; Akhtar, K.P.; Hameed, A.; Sarwar, N.; Imran-Ul-Haq; Khan, S.A. Biochemical alterations in leaves of resistant and susceptible cotton genotypes infected systemically by cotton leaf curl Burewala virus. J. Plant Interact. 2014, 9, 702–711. [Google Scholar] [CrossRef] [Green Version]
- Farkas, G.L.; Kiraly, Z.; Solymosy, F. Role of oxidative metabolism in the localization of plant viruses. Virology 1960, 12, 408–421. [Google Scholar] [CrossRef]
- Ashmawy, N.A.; Behiry, S.I.; Al-Huqail, A.A.; Ali, H.M.; Salem, M.Z.M. Bioactivity of Selected Phenolic Acids and Hexane Extracts from Bougainvilla spectabilis and Citharexylum spinosum on the Growth of Pectobacterium carotovorum and Dickeya solani Bacteria: An Opportunity to Save the Environment. Processes 2020, 8, 482. [Google Scholar] [CrossRef]
- Rai, V.P.; Jaiswal, N.; Kumar, S.; Singh, S.P.; Kumar, R.; Rai, A.B. Response of total phenols and peroxidase activity in Chilli exposed to pepper leaf curl virus disease. Veg. Sci. 2010, 37, 78–80. [Google Scholar]
- Song, X.; Wang, Y.; Mao, W.; Shi, K.; Zhou, Y.; Nogués, S.; Yu, J. Effects of cucumber mosaic virus infection on electron transport and antioxidant system in chloroplasts and mitochondria of cucumber and tomato leaves. Physiol. Plant 2009, 135, 246–257. [Google Scholar] [CrossRef]
- El-Dougdoug, K.A.; Sofy, A.R.; Mousa, A.A.; Refaey, E.E. Monitoring variability responses of cultivated potato varieties infected with Potato virus Y pepper isolate. Egypt. J. Virol. 2014, 11, 82–101. [Google Scholar]
- Khalil, R.R.; Bassiouny, F.M.; El-Dougdoug, K.A.; Abo-Elmaty, S.; Yousef, M.S. A dramatic physiological and anatomical changes of tomato plants infecting with tomato yellow leaf curl germinivirus. Int. J. Agric. Sustain. 2014, 10, 1213–1229. [Google Scholar]
- Hutson, R.A.; Smith, I.M. Phytoalexins and tyloses in tomato cultivars infected with Fusarium oxysporum f. sp. lycopersici or Verticillium albo-atrum. Physiol. Plant Pathol. 1980, 17, 245–257. [Google Scholar] [CrossRef]
- Lan, H.; Lai, B.; Zhao, P.; Dong, X.; Wei, W.; Ye, Y.; Wu, Z. Cucumber mosaic virus infection modulated the phytochemical contents of Passiflora edulis. Microb. Pathog. 2020, 138, 103828. [Google Scholar] [CrossRef] [PubMed]
- Lou, L.; Su, X.; Liu, X.; Liu, Z. Transcriptome analysis of Luffa cylindrica (L.) Roem response to infection with Cucumber mosaic virus (CMV). Gene 2020, 737, 144451. [Google Scholar] [CrossRef] [PubMed]
- Aseel, D.G.; Rashad, Y.M.; Hammad, S.M. Arbuscular mycorrhizal fungi trigger transcriptional expression of flavonoid and chlorogenic acid biosynthetic pathways genes in tomato against Tomato Mosaic Virus. Sci. Rep. 2019, 9, 9692. [Google Scholar] [CrossRef] [Green Version]
- Gutha, L.R.; Casassa, L.F.; Harbertson, J.F.; Naidu, R.A. Modulation of flavonoid biosynthetic pathway genes and anthocyanins due to virus infection in grapevine (Vitis vinifera L.) leaves. BMC Plant Biol. 2010, 10, 187. [Google Scholar] [CrossRef] [Green Version]
- Sade, D.; Shriki, O.; Cuadros-Inostroza, A.; Tohge, T.; Semel, Y.; Haviv, Y.; Willmitzer, L.; Fernie, A.R.; Czosnek, H.; Brotman, Y. Comparative metabolomics and transcriptomics of plant response to Tomato yellow leaf curl virus infection in resistant and susceptible tomato cultivars. Metabolomics 2015, 11, 81–97. [Google Scholar] [CrossRef]
- Chandrasekaran, M.; Senthilkumar, A.; Venkatesalu, V. Antibacterial and antifungal efficacy of fatty acid methyl esters from the leaves of Sesuvium portulacastrum L. Eur. Rev. Med. Pharmacol. Sci. 2011, 15, 775–780. [Google Scholar]
- Awa, E.P.; Ibrahim, S.; Ameh, D.A. GC/MS analysis and antimicrobial activity of diethyl ether fraction of methanolic extract from the stem bark of Annona senegalensis Pers. Int. J. Pharm. Sci. Res. 2012, 3, 4213. [Google Scholar]
- Akram, W.; Ahmad, A.; Fatima, S.; Anjum, T.; Ali, B.; Ahmed, S.; Simirgiotis, M.J.; Abbas, H.M.K.; Aslam, M.; Guo, J. Foliar application of liquiritin protects Chinese flowering cabbage against cucumber mosaic virus and increases health-promoting compounds. J. Plant Interact. 2021, 16, 377–384. [Google Scholar] [CrossRef]









| Primer Name | Primer Code | Direction | Nucleotide Sequences (5′-3′) |
|---|---|---|---|
| Cucumber mosaic virus-coat protein | CMV-CP | Forward | GGATGCTTCTCCACGAG |
| Reverse | AGTGACTTCAGGCAGT | ||
| Pathogenesis related protein-1 | PR-1 | Forward | CCAAGACTATCTTGCGGTTC |
| Reverse | GAACCTAAGCCACGATACCA | ||
| Endoglucanase | PR-2 | Forward | TCAATTATCAAAACTTGTTC |
| Reverse | AACCGGTCTCGGATACAAC | ||
| Phenylalanine ammonia-lyase | PAL | Forward | ATGGAGGCAACTTCCAAGGA |
| Reverse | CCATGGCAATCTCAGCACCT | ||
| Chalcone synthase | CHS | Forward | CACCGTGGAGGAGTATCGTAAGGC |
| Reverse | TGATCAACACAGTTGGAAGGCG | ||
| Hydroxycinnamoyl CoA: quinate hydroxycinnamoyl transferase | HQT | Forward | CCCAATGGCTGGAAGATTAGCTA |
| Reverse | CATGAATCACTTTCAGCCTCAACAA | ||
| Elongation factor 1-alpha | EF1a | Forward | ATTCGAGAAGGAAGCTGCTG |
| Reverse | TTGGTGGTCTAAACTTCCAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelkhalek, A.; Király, L.; Al-Mansori, A.-N.A.; Younes, H.A.; Zeid, A.; Elsharkawy, M.M.; Behiry, S.I. Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection. Plants 2022, 11, 1908. https://doi.org/10.3390/plants11151908
Abdelkhalek A, Király L, Al-Mansori A-NA, Younes HA, Zeid A, Elsharkawy MM, Behiry SI. Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection. Plants. 2022; 11(15):1908. https://doi.org/10.3390/plants11151908
Chicago/Turabian StyleAbdelkhalek, Ahmed, Lóránt Király, Al-Naji A. Al-Mansori, Hosny A. Younes, Ahmed Zeid, Mohsen Mohamed Elsharkawy, and Said I. Behiry. 2022. "Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection" Plants 11, no. 15: 1908. https://doi.org/10.3390/plants11151908
APA StyleAbdelkhalek, A., Király, L., Al-Mansori, A.-N. A., Younes, H. A., Zeid, A., Elsharkawy, M. M., & Behiry, S. I. (2022). Defense Responses and Metabolic Changes Involving Phenylpropanoid Pathway and PR Genes in Squash (Cucurbita pepo L.) following Cucumber mosaic virus Infection. Plants, 11(15), 1908. https://doi.org/10.3390/plants11151908

