Survey for Major Grapevine Viruses in Commercial Vineyards of Northwestern Argentina
Abstract
:1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Sampling Survey
3.2. Molecular Diagnosis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- OIV (International Organization of Vine and Wine). 2019 Statistical Report on World Vitiviniculture; OIV: Paris, France, 2019; 23p. [Google Scholar]
- INV (Instituto Nacional de Vitivinicultura). Regiones Vitivinícolas Argentinas: Noroeste (Provincias: La Rioja, Salta, Catamarca, Tucumán y Jujuy); INV: Mendoza, Argentina, 2018; 35p. [Google Scholar]
- Fuchs, M. Grapevine viruses: A multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. J. Plant Pathol. 2020, 102, 643–653. [Google Scholar] [CrossRef]
- Mannini, F.; Digiaro, M. The effects of viruses and viral diseases on grapes and wine. In Grapevine Viruses: Molecular Biology, Diagnostics and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: Cham, Switzerland, 2017; pp. 453–482. [Google Scholar]
- Perrone, I.; Chitarra, W.; Boccacci, P.; Gambino, G. Grapevine–virus–environment interactions: An intriguing puzzle to solve. New Phytol. 2017, 213, 983–987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martelli, G.P. An overview on grapevine viruses, viroids and the diseases they cause. In Grapevine Viruses: Molecular Biology, Diagnostic and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: Cham, Switzerland, 2017; pp. 31–46. [Google Scholar]
- Gómez Talquenca, S.; Muñoz, C.; Grau, O.; Gracia, O. First description of Grapevine leafroll-associated virus 5 in Argentina and partial genome sequence. Virus Genes 2009, 38, 184–186. [Google Scholar] [CrossRef] [PubMed]
- Lanza-Volpe, M.; Talquenca, S.G.; Engel, E.A.; Gracia, O. Incidence of grapevine leafroll associated viruses-1, -2, and -3 in mendoza vineyards. Trop. Plant Pathol. 2010, 35, 377–380. [Google Scholar]
- Lanza-Volpe, M.; Moyano, S.; Lijavetzky, D.; Talquenca, S.G. Partial molecular and biological characterization of Grapevine leafroll-associated virus 2 isolates from Argentina. J. Plant. Pathol. 2015, 97, 349–355. [Google Scholar]
- Luna, F.; Debat, H.; Moyano, S.; Zavallo, D.; Asurmendi, S.; Gomez-Talquenca, S. First report of grapevine red blotch virus infecting grapevine in Argentina. J. Plant Pathol. 2019, 101, 1239. [Google Scholar] [CrossRef] [Green Version]
- Salguero, K.; Mestre, E.; Payo, G.; y Churquina, S. Strategies of control of mealybugs (Planococcus ficus) in vineyard of Cafayate—Salta. In Proceedings of the 20 International Meeting GiESCO, Mendoza, Argentina, 5–10 November 2017; Perez Peña, J.E., Carbonneau, A., Torregrosa, L., Eds.; GIESCO: Mendoza, Argentina, 2017; Volume 20, p. 212. [Google Scholar]
- De Borbón, C.M.; Gracia, O.; Talquenca, G.S.G. Mealybugs and grapevine leafroll-associated virus 3 in vineyards of Mendoza, Argentina. Am. J. Enol. Vitic. 2004, 55, 283–285. [Google Scholar]
- Naidu, R.A.; Rowhani, A.; Fuchs, M.; Golino, D.; Martelli, G.P. Grapevine leafroll: A complex viral disease affecting a high-value fruit crop. Plant Dis. 2014, 98, 1172–1185. [Google Scholar] [CrossRef] [Green Version]
- Sharma, A.M.; Baraff, B.; Hutchins, J.T.; Wong, M.K.; Blaisdell, G.K.; Cooper, M.L.; Daane, K.M.; Almeida, R.P. Relative prevalence of grapevine leafroll-associated virus species in wine grape-growing regions of California. PLoS ONE 2015, 10, e0142120. [Google Scholar] [CrossRef] [Green Version]
- Maree, H.J.; Almeida, R.P.; Bester, R.; Chooi, K.M.; Cohen, D.; Dolja, V.V.; Fuchs, M.F.; Golino, D.A.; Jooste, A.E.; Martelli, G.P.; et al. Grapevine leafroll-associated virus 3. Front. Microbiol. 2013, 4, 82. [Google Scholar] [CrossRef] [Green Version]
- Rowhani, A.; Daubert, S.; Arnold, K.; Al Rwahnih, M.; Klaassen, V.; Golino, D.; Uyemoto, J.K. Synergy between grapevine vitiviruses and grapevine leafroll viruses. Eur. J. Plant Pathol. 2018, 151, 919–925. [Google Scholar] [CrossRef]
- Herrbach, E.; Alliaume, A.; Prator, C.A.; Daane, K.M.; Cooper, M.L.; Almeida, R.P.P. Vector transmission of Grapevine Leafroll-Asocciated viruses. In Grapevine Viruses: Molecular Biology, Diagnostic and Management; Meng, B., Martelli, G.P., Golino, D.A., Fuchs, M., Eds.; Springer: Cham, Switzerland, 2017; pp. 483–504. [Google Scholar]
- Andret-Link, P.; Laporte, C.; Valat, L.; Ritzenthaler, C.; Demangeat, G.; Vigne, E.; Laval, V.; Pfeiffer, P.; Stussi-Garaud, C.; Fuchs, M. Grapevine fanleaf virus: Still a major threat to the grapevine industry. J. Plant Pathol. 2004, 183–195. [Google Scholar]
- Montero, R.; El Aou Ouad, H.; Pacifico, D.; Marzachì, C.; Castillo, N.; García, E.; Del Saz, N.F.; Florez-Sarasa, I.; Flexas, J.; Bota, J. Effects of Grapevine leafroll-associated virus 3 on the physiology in asymptomatic plants of Vitis vinifera. Ann. Appl. Biol. 2017, 171, 155–171. [Google Scholar] [CrossRef]
- Zherdev, A.V.; Vinogradova, S.V.; Byzova, N.A.; Porotikova, E.V.; Kamionskaya, A.M.; Dzantiev, B.B. Methods for the diagnosis of grapevine viral infections: A review. Agriculture 2018, 8, 195. [Google Scholar] [CrossRef] [Green Version]
- Meng, B.; Rebelo, A.R.; Fisher, H. Genetic diversity analyses of grapevine Rupestris stem pitting-associated virus reveal distinct population structures in scion versus rootstock varieties. J. Gen. Virol. 2006, 87, 1725–1733. [Google Scholar] [CrossRef]
- Poojari, S.; Alabi, O.J.; Naidu, R.A. Molecular characterization and impacts of a strain of Grapevine leafroll-associated virus 2 causing asymptomatic infection in a wine grape cultivar. Virol. J. 2013, 10, 324. [Google Scholar] [CrossRef] [Green Version]
- Debat, H.J.; Zavallo, D.; Luna, F.N.; Moyano, S.N.; Asurmendi, S.; Gómez Talquenca, S. First report of grapevine virus E infecting grapevine in Argentina. J. Plant Pathol. 2019, 101, 1221–1222. [Google Scholar] [CrossRef]
- Gambino, G.; Perrone, I.; Gribaudo, I. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytocem. Anal. 2008, 19, 520–525. [Google Scholar] [CrossRef]
- Gambino, G.; Gribaudo, I. Simultaneous detection of nine grapevine viruses by multiplex reverse transcription-polymerase chain reaction with coamplification of a plant RNA as internal control. Phytopathology 2006, 96, 1223–1229. [Google Scholar] [CrossRef] [Green Version]
- Poojari, S.; Alabi, O.J.; Okubara, P.A.; Naidu, R.A. SYBR® Green-based real-time quantitative reverse-transcription PCR for detection and discrimination of grapevine viruses. J. Virol. Methods 2016, 235, 112–118. [Google Scholar] [CrossRef] [Green Version]
- Goszczynski, D.E.; Jooste, A.E.C. Identification of divergent variants of Grapevine virus A. Eur. J. Plant Pathol. 2003, 109, 397–403. [Google Scholar] [CrossRef]
- Nolasco, G.; Mansinho, A.; Santos, M.T.; Soares, C.; Sequeira, Z.; Sequeira, C.; Correia, P.K.; Sequeira, O.A. Large scale evaluation of primers for diagnosis of rupestris stem pitting associated virus-1. Eur. J. Plant Pathol. 2000, 106, 311–318. [Google Scholar] [CrossRef]
- Krenz, B.; Thompson, J.R.; McLane, H.L.; Fuchs, M.; Perry, K.L. Grapevine red blotch-associated virus is widespread in the United States. Phytopathology 2014, 104, 1232–1240. [Google Scholar] [CrossRef] [PubMed] [Green Version]


| Location | N a | P. ficusb | GLRaV-1 c | GLRaV-2 | GLRaV-3 | GLRaV-4 | GRBV | GFLV | GRSPaV | GVA |
|---|---|---|---|---|---|---|---|---|---|---|
| Cachi | 27 | - | 3 | 4 | 6 | 1 | 0 | 5 | 0 | 6 |
| Molinos | 27 | - | 1 | 2 | 1 | 1 | 0 | 4 | 1 | 1 |
| San Carlos | 5 | - | 0 | 0 | 3 | 1 | 0 | 1 | 0 | 2 |
| Cafayate | 22 | + | 6 | 1 | 22 | 0 | 0 | 6 | 2 | 4 |
| Tafí del Valle | 22 | - | 1 | 1 | 3 | 0 | 0 | 6 | 0 | 0 |
| Total | 103 | 11 | 8 | 35 | 3 | 0 | 22 | 3 | 13 |
| Target | Primer sequences (5′-3′) | Location | Product Size (bp) | Gene | Reference |
|---|---|---|---|---|---|
| 18S rRNA | F: CGCATCATTCAAATTTCTGC R: TTCAGCCTTGCGACCATACT | 215-234 1039-1058 | 844 | Internal control | [25] |
| GLRaV-1 | F: TCTTTACCAACCCCGAGATGAA R: GTGTCTGGTGACGTGCTAAACG | 7245-7266 7455-7476 | 232 | Coat protein | [25] |
| GLRaV-2 | F: GGTGATAACCGACGCCTCTA R: CCTAGCTGACGCAGATTGCT | 6745-6764 7268-7287 | 543 | Coat protein | [25] |
| GLRaV-3 | F: TACGTTAAGGACGGGACACAGG R: TGCGGCATTAATCTTCATTG | 13383-13404 13699-13718 | 336 | Coat protein | [25] |
| GLRaV-4 | F: TGAGGTCCCATGTCATGAC R: CCTCAATCTRTTSACCAAYTCAC | 7499-7517 7934-7956 | 457 | RNA-dependent RNA polimerase | [26] |
| GVA | F: GAGGTAGATATAGTAGGACCTA R: TCGAACATAACCTGTGGCTC | 6591-6612 6843-6862 | 272 | Coat protein | [27] |
| GFLV | F: ATGCTGGATATCGTGACCCTGT R: GAAGGTATGCCTGCTTCAGTGG | 5506-5527 5602-5623 | 118 | RNA-dependent RNA polimerase | [25] |
| RSPaV | F: TGAAGGCTTTAGGGGTTAG R: CTTAACCCAGCCTTGAAAT | 7708-7726 8612-8593 | 905 | Coat protein | [28] |
| GRBaV | F: CAAGTCGTTGTAGATTGAGGACGTATTGG R: AGCCACACCTACACGCCTTGCTCATC | 2567-2595 2884-2850 | 318 | Replication-associated protein gene fragment (Rep) | [29] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rivadeneira, M.; Galván, M.Z.; Abán, M.; Semke, R.E.; Rivadeneira, J.; Lanza Volpe, M.; Gomez Talquenca, S. Survey for Major Grapevine Viruses in Commercial Vineyards of Northwestern Argentina. Plants 2022, 11, 1720. https://doi.org/10.3390/plants11131720
Rivadeneira M, Galván MZ, Abán M, Semke RE, Rivadeneira J, Lanza Volpe M, Gomez Talquenca S. Survey for Major Grapevine Viruses in Commercial Vineyards of Northwestern Argentina. Plants. 2022; 11(13):1720. https://doi.org/10.3390/plants11131720
Chicago/Turabian StyleRivadeneira, Mónica, Marta Zulema Galván, Marina Abán, Rosa Elena Semke, Josefina Rivadeneira, Melisa Lanza Volpe, and Sebastián Gomez Talquenca. 2022. "Survey for Major Grapevine Viruses in Commercial Vineyards of Northwestern Argentina" Plants 11, no. 13: 1720. https://doi.org/10.3390/plants11131720
APA StyleRivadeneira, M., Galván, M. Z., Abán, M., Semke, R. E., Rivadeneira, J., Lanza Volpe, M., & Gomez Talquenca, S. (2022). Survey for Major Grapevine Viruses in Commercial Vineyards of Northwestern Argentina. Plants, 11(13), 1720. https://doi.org/10.3390/plants11131720

