Next Article in Journal
Primer Choice and Xylem-Microbiome-Extraction Method Are Important Determinants in Assessing Xylem Bacterial Community in Olive Trees
Previous Article in Journal
Late Blight Resistance Conferred by Rpi-Smira2/R8 in Potato Genotypes In Vitro Depends on the Genetic Background
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula

by
Francesco Panara
1,
Valentina Passeri
2,
Loredana Lopez
1,
Andrea Porceddu
3,
Ornella Calderini
2,*,† and
Francesco Paolocci
2,†
1
Trisaia Research Center, Italian National Agency for New Technologies Energy and Sustainable Economic Development, (ENEA), 75026 Rotondella, MT, Italy
2
Institute of Biosciences and Bioresources, Consiglio Nazionale delle Ricerche, 06128 Perugia, PG, Italy
3
Department of Agriculture, University of Sassari, Viale Italia, 39a, 07100 Sassari, SS, Italy
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Plants 2022, 11(10), 1318; https://doi.org/10.3390/plants11101318
Submission received: 15 April 2022 / Revised: 10 May 2022 / Accepted: 11 May 2022 / Published: 16 May 2022
(This article belongs to the Special Issue Molecular Analysis of Medicago spp.—the Second Edition)

Abstract

:
Flavonoids are essential compounds widespread in plants and exert many functions such as defence, definition of organ colour and protection against stresses. In Medicago truncatula, flavonoid biosynthesis and accumulation is finely regulated in terms of tissue specificity and induction by external factors, such as cold and other stresses. Among flavonoids, anthocyanin precursors are synthesised in the cytoplasm, transported to the tonoplast, then imported into the vacuole for further modifications and storage. In the present work, we functionally characterised MtrGSTF7, a phi-class glutathione S-transferase involved in anthocyanin transport to the tonoplast. The mtrgstf7 mutant completely lost the ability to accumulate anthocyanins in leaves both under control and anthocyanin inductive conditions. On the contrary, this mutant showed an increase in the levels of soluble proanthocyanidins (Pas) in their seeds with respect to the wild type. By complementation and expression data analysis, we showed that, differently from A. thaliana and similarly to V. vinifera, transport of anthocyanin and proanthocyanidins is likely carried out by different GSTs belonging to the phi-class. Such functional diversification likely results from the plant need to finely tune the accumulation of diverse classes of flavonoids according to the target organs and developmental stages.

1. Introduction

Flavonoids comprise a large group of secondary metabolites, including anthocyanins, proanthocyanidins (PAs), flavonols and isoflavones, which contribute in various ways to the growth and survival of plants [1,2,3]. Anthocyanidins are attractants for pollinators [4], protect plants against UV light damage and serve as defense molecules toward pathogens. Anthocyanins and simple monomeric and/or oligomeric PAs have been reported to protect against free radical injury and cardiovascular disease in humans [4]. PAs also act as antinutrients affecting both dietary protein and micronutrient availability in animals [5].
As other flavonoids, anthocyanin and the flavan 3-ols, catechins and epicatechins, the building blocks of PAs, are synthesised in the cytosol but accumulate within the vacuole, and therefore the efficiency of their transportation across the tonoplast affects their accumulation [6]. At least two different routes of flavonoid transport have been proposed: vesicle trafficking and transporter-mediated [7]. GSTs have been recognised as flavonoid transporters in a number of different taxa [6]. Moreover, they have been involved in the detoxification of a wide range of heterocyclic compounds (xenobiotics) by linking glutathione to the substrate giving rise to S-conjugates. To give an example, several classes of herbicides are glutathionated in the cytoplasm while the conjugate forms are accumulated within the vacuole [8,9,10].
GSTs form a large family of proteins, amounting to about 1% of total soluble leaf proteins [11]. Based on amino acid sequence similarity and exon-intron organization of genic models, plant GSTs have been divided in at least ten groups, including phi, tau, tetha, zeta, lambda, iota, dehydroascorbate reductase (DHAR), tetrachlorohydroquinone dehalogenase (TCHQD) and gamma subunit of the translation elongation factor 1B (EF1Bg) and hemerythrin [12,13]. Tau and phi GSTs are the most abundant in vascular plants [11]. The first demonstration that GSTs transport anthocyanins into vacuoles came from genetic analyses of maize bz2, a mutant line with bronze-coloured tissues and accumulating anthocyanins in the cytosol [14]. Since then, several other GSTs have been characterised as responsible for anthocyanin accumulation deficiency in plants. A seminal paper from Kitamura et al. [15] have demonstrated that tt19, a phi GST knockout, is impaired in both anthocyanin deposition in leaves and PA accumulation in seed testa. The double tt19 phenotype has become an experimental model system to assay the activity of heterologous phi GSTs in either anthocyanin or PA transport [16,17,18]. For example, expression of MdGSTF6 in tt19 background restored the accumulation of anthocyanin in leaves but not of PAs in seeds of Malus domestica [19]. Three phi GSTs have been functionally characterized in Vitis vinifera for their involvement in anthocyanins and PA accumulation [18]. Two of these, VviGST1 and VviGST3, were able to restore PA accumulation in seeds but not anthocyanin in leaves when constitutively expressed in tt19 Arabidopsis plants. VviGST4, instead, restored both anthocyanin and PA accumulation in tt19 background [18]. Bioinformatic analyses of protein ligand interactions suggested that these GSTs can bind glutathione, monomers of anthocyanins, PAs and flavonols. However, while the sites for GSH and flavonoids partially overlapped in the VviGST3 and VviGST1 proteins, they were well separated in VviGST4, similarly to the TT19 protein.
A modest amount of PAs in forage promotes an increased use of nitrogen derived from dietary protein and a reduction of pasture bloat [20,21,22]. When fed with forages rich in proteins, such as alfalfa or clover, plant species lacking PAs in their aerial portion, the pasture bloat phenomenon may occur in ruminants. To reduce bloating, surfactants able to break down foams or forages known to contain moderate levels of PAs can be added to the diet [21]. Both are costly options that determine a certain reluctance toward the use of alfalfa or clovers despite their excellent nutrient quality. Medicago truncatula has become the model forage species for genomic and functional studies and a large body of knowledge on flavonoid biosynthesis is now available on this species.
M. truncatula GST family includes up to 73 members which have been divided in eight classes with tau and phi being the most numerous ones [13]. Lineage specific expansion of gene family arose from large- or small-scale gene duplications followed by sub-functionalization. In this work, we analyze the function of MtrGSTF7 a phi class GST. Although other phi GSTs are expressed in the same tissues of MtrGSTF7, the lack of MtrGSTF7 transcript resulted in complete loss of anthocyanins in leaves, suggesting that this gene is essential for their accumulation.

2. Results

2.1. MtrGSTF7 Knockout Prevents Anthocyanin but Not Proanthocyanin Accumulation in M. truncatula Organs

During a phenotypic screening of a Tnt1 mutagenized collection [23], M. truncatula R108 lines R45 and R39 were noticed for the lack of leaf blots and red pigmentation on the aerial organs (Figure 1).
Tnt1 flanking regions from both lines were cloned by thermal asymmetric interlaced PCR (TAIL-PCR), and their genomic positions were identified within the R108 reference sequence [24]. It is noteworthy that one insertion from R45 and one from line R39 were mapped to close genomic positions, both within the MtrunR108HiC_012760, which encodes for the MtrGSTF7 phi class glutathione S-transferase protein [13]. Sequence tagged site (STS) markers were developed for each cloned insertion (see Figure 2A) and tested on sibs of the two mutant lines. Both STS markers tagging the MtrGSTF7 insertions co-segregated with the phenotype according to mono-factorial recessive mutation models. These findings were also confirmed on progenies produced by selfed heterozygous sibs of R45 and R39 lines (Figure 2B).
Anthocyanins were undetectable by spectrophotometric analysis of leaves of both R45 and R39 homozygous individuals. A segregating progeny of an R45 heterozygous sib was cultivated in vitro on anthocyanin inducing medium (6% sucrose). Even under these conditions, we could not detect anthocyanins in leaves of R45 homozygous individuals, whereas individuals heterozygous for the insertions accumulated anthocyanins in leaves, though at levels significantly lower than wild-type sibs (Figure 3). R45 mutant sibs did not show qualitative differences for PAs when glandular trichomes and seed coats were stained with 4-(dimethylamino)-cinnamaldehyde (DMACA) (data not shown).
Notably, spectrophotometric analysis of extracts from seeds harvested from R45 homozygotes and heterozygotes showed a significant increase in soluble PAs compared to the wild-type seeds (t-test, p < 0.05), whereas the levels of insoluble PAs did not change (Figure 4).
Previous studies have identified 9 phi GSTs in M. truncatula [13]. Based on sequence homology, we analysed the genetic distances among these proteins and phi GSTs characterised in other species (Figure 5).
M. truncatula phi GSTs were assigned to four clusters. MtrGSTF7 grouped in cluster I with GSTs essential for anthocyanin transport from the cytoplasm to the vacuole. The Malus domestica MdGST6 and the V. vinifera VVGST4 which complement both the anthocyanin and PA deposition in Arabidopsis tt19 mutant belong to this cluster [19].
MtrGSTF6, MtrGSTF8 and MtrGSTF9 were in cluster 2 along with V. vinifera VvGST3, which complements PAs but not anthocyanin accumulation defect in tt19 mutant [18]. The remaining phi GSTs from M. truncatula were positioned in two additional clusters (3 and 4), which showed the least distance from VvGST1 [18] and bz2 [14] tau GSTs.

2.2. Expression Analysis

Several studies have demonstrated that phi GSTs transcript levels are differentiated among organs and developmental stages. The gene expression atlas of Medicago organs [25] was interrogated for all available phi GSTs probes. MtrGSTF9 and 4 showed the highest levels of tissue specificity being readily detectable only in roots and almost not detectable in other organs. MtrGSTF8 was expressed at high levels almost exclusively in seeds at the first developmental stages. MtrGSTF7 and MtrGSTF1 transcripts were readily detectable in aerial organs: MtrGSTF7 was almost undetectable in seeds while a decreasing trend was observed for MtrGSTF1.
In M. truncatula, high amounts of PAs accumulate in the seed coat. Phi GST expression data in seed coat indicate a high expression for MtrGSTF6, MtrGSTF8 and MtrGSTF1, suggesting that these three GSTs are possibly involved in PA accumulation in this tissue (Figure 6).
Next, we analysed in silico the expression of phi GSTs in leaves of M. truncatula overexpressing the transcription factor LAP1 and showing hyperaccumulation of anthocyanins in leaves [26]. As shown in Figure 7, only MtrGSTF7 was upregulated in these conditions, while the expression of other GSTs was nearly unchanged.
Since glandular trichomes are known sites of PA accumulation, we interrogated the Trichome expression database [27] for phi GST accumulation. Figure 8 reports the expression levels of M. truncatula phi GSTs in glandular and non-glandular trichomes. Higher expression was detected for MtrGSTF1 and MtrGSTF6 with log2FC value below 2 between the two types of trichomes. All other MtrGSTFs showed lower expression values. This was expected for MtrGSTFs with organ-specific expression in root and seeds. Interestingly, MtrGSTF7, which is highly expressed in leaves, showed low expression in trichomes.
A redirection of metabolic flux from anthocyanin to flavonol biosynthesis has been demonstrated in the Arabidopsis tt19 mutant background [15]. It is noteworthy that the metabolic shift is not associated with a reduced expression of anthocyanin biosynthetic genes which are instead expressed at higher levels in tt19 compared to wt plants. A similar picture was observed in MtrGSTF7 mutant lines, in which the dramatic reduction in the MtrGSTF7 transcripts levels was paralleled neither from that of early (C4H, 4CL, CHS, CHI and F3H) nor from that of late (DFR, ANS and ANR) key genes of the phenylpropanoid pathway when compared to wt plants grown under controlled conditions (Figure 9). However, when the same plants were grown under cold condition (cold greenhouse with average temperatures of 10 °C, see Figure 1A,B,D,E), an increase in the expression levels of DFR and a decrease in those of MtrGSTF6 was detected in R45 leaves (Figure 10). Since R45 showed an increment in the levels of soluble PAs in the seeds, we decided to investigate the expression patterns of key genes as above along with that of LAR and UGT72L1 in wt and R45 pods collected at an early stage (6 days after pollination) of their development when immature seeds therein stained positively with DMACA. As shown in Figure 11, the steady state mRNA levels were not statistically different for all the genes investigated except for LAR and UGT72L1. The former codes for the enzyme are not only responsible for the synthesis of catechin [28,29] but also for the control of the degree of PA polymerisation in that it promotes the accumulation of soluble rather than insoluble PAs [30]. The latter codes for an epicatechin-specific glucosyltransferase, which is expressed in the seed coat of M. truncatula [31].

2.3. Restoration of Anthocyanin Transport Deficiency of the Arabidopsis tt19 Mutant

Arabidopsis tt19 mutant is defective in anthocyanin accumulation in vegetative tissues and shows pale testa colour in the seeds [15]. To better elucidate MtrGSTF7 function in vivo, we adopted a functional complementation approach on tt19-1 by generating transgenic tt19-1 plants expressing MtrGSTF7 under the constitutive promoter 35S from CaMV. Seedlings of transgenic and control plants were grown on high sucrose substrate to induce anthocyanin accumulation. As shown in Figure 12, the 35S::MtrGSTF7 construct in tt19 fully restored the anthocyanin accumulation in vegetative organs but had no effect on the levels of soluble PAs in seeds (Figure 12).

3. Discussion

Anthocyanins are part of the flavonoid family, and they are the final products of a specific branch leading to the formation of flavonols, phlobaphenes and proanthocyanidins as well [32]. This class of metabolites confers resistance to several stresses in plant species via ROS signalling [33]. The biosynthesis of anthocyanins is extensively characterised, and both biosynthetic and regulatory genes have been identified in several plant species [34] showing a high degree of conservation. Concerning the transport of anthocyanins to the vacuole, two main mechanisms have been proposed, one using membrane transporters, and the second one involving the formation of vesicles which will merge with the tonoplast. In both models, the transport is assisted by GST. In particular, GST of the phi group are those involved in anthocyanin transport, with GSTs also having a plethora of different roles [35]. Biochemical assay has proved the binding of GST to anthocyanin in a few species, including Arabidopsis tt19; the conservation of the anthocyanin binding function was proved for GST from several other species by complementation analysis of the Arabidopsis tt19 mutant. Among these are FL3 from carnation [36], PfGST1 from Perilla frutescens [37], VvGST1 and VvGST4 from grapevine [18,38], CkmGST3 from Cyclamen [39], CMGSTF12 from Camelina sativa [40], LcGST4 from Litchi chinensis [16], PpRiant1 from peach [41], FvRAP from strawberry [42], IbGSTF4 from sweet potato [43], MdGSTF6 from apple [19] and AcGST1 from kiwifruit [44].
Here, we report on the cloning and functional characterization of MtrGSTF7. M. truncatula functional genomics via mutant analysis has proved very powerful in understanding several aspects of plant biology of legumes, with particular focus on nodulation [45] and biosynthesis of secondary metabolites [46]. In this context, the presence of a leaf red blot is a useful marker to detect mutations in the anthocyanin pathway. In our work, the visual screening of a Tnt1 mutagenized M. truncatula collection [23] led to the original identification of two mutants lacking the anthocyanin pigmentation of the leaf typical of the R108 genotype. The anthocyanin content remained negligible even after sucrose induction in in vitro grown plants of the mutant for MtrGSTF7 compared to the wild-type R108. The cloning of the gene responsible for the mutation undertaken by TAIL-PCR analysis of the transposon flanking regions led to the identification of MtrGSTF7. The two independent knock-out mutants, though lacking the ability to accumulate anthocyanins, are able to store PAs in both seed coat and glandular trichomes. Expression analysis by qRT-PCR of key biosynthetic genes of the phenylpropanoid pathway in leaves of plants grown under controlled conditions, while confirming a dramatic decrease in the levels of MtrGSTF7 in the mutant line, did not show any significant difference between this and wt for all the other genes considered. Conversely, under cold conditions, differences emerged between R45 and wt plants, namely the upregulation of DFR in R45 and that of MtrGSTF6 in wt leaves. Although both these results call for an in depth characterisation of both transcriptional profile and function of these genes, they let us argue that the block of the anthocyanin pathway due to the knocking out of MtrGSTF7 causes a reprogramming of the metabolic pathway in leaves only under environmental conditions that promote flavonoid biosynthesis. Accurate targeted metabolomic analyses by HPLC-MS would help us to address this issue.
A thorough M. truncatula GST gene family characterisation has revealed the presence of nine phi GSTs with partially overlapping expression patterns. It is noteworthy that while the expression of MtrGSTF2-3 is mainly root-specific and that of MtrGSTF8 is concentrated in the last stages of seed development, the other M. truncatula GSTFs show overlapping patterns of expression in vegetative tissues. However, the observation that MtrGSTF7 knockout totally abolishes the anthocyanin accumulation in vegetative tissues demonstrates that other M. truncatula phi GSTs, although being co-expressed with MtrGSTF7, are unable to functionally complement it. Several hypotheses could explain such a conclusion. First, other phi GSTs have a non-redundant function, for example they are not able to bind anthocyanin. Second, other GSTs are engaged in anthocyanin transport downstream of MtrGSTF7. One possibility would be that MtrGSTF7 could transform anthocyanin to a form recognisable by other GSTs. Enzymatic studies in Petunia and Arabidopsis have excluded that enzymatic modification of anthocyanin mediated by GSTs is needed for their binding and transport. Other studies have demonstrated that anthocyanin can also be transported by other transporters, such as MATE2 [47], and that, differently from MtrGSTF7, their knockout does not impair completely anthocyanin accumulation. These data lend support to the hypothesis of anthocyanin transport as a sequence of events, with MtrGSTF7 working at the early stages of this sequence. At the same time, MtrGSTF7 mutant seeds do not show loss in PA content, highlighting the specific involvement of MtrGSTF7 in the transport of one subclass of flavonoid, the anthocyanin. Interestingly, only MtrGSTF7 expression notably increases upon overexpression of the MYB transcription factor LAP1, with LAP1 being an inducer of anthocyanin synthesis and accumulation in M. truncatula and M. sativa [26]. The other phi GSTs expressed in leaves do not show significant expression changes in LAP1 overexpressing leaves. At the same time, the expression of MtrGSTF7 is low in glandular trichomes, which accumulate PAs compared to whole leaf. Other GSTs, such as MtrGSTF1 and MtrGSTF6, showed higher expression in trichomes. These GSTs are also expressed in other sites of preferential PA accumulation (e.g., seeds), in which MtrGSTF7 expression is barely detectable. All these data suggest that MtrGSTF7 expression is associated with anthocyanin but not with PA accumulation. Better still, the increase in the levels of soluble PAs in the seeds of R45, coupled to the increase in the steady state levels of LAR and UGT72L1 genes in the pods at early stage of R45 with respect to those from wt, are all evidence suggesting that knocking out of MtrGSTF7 causes a flux diversion from anthocyanin towards PAs in M. truncatula reproductive organs. In turn, these results pave the way to future time course analyses to compare the metabolic and molecular profiles between R45 and wt developing seeds.
The complementation experiment of Arabidopsis tt19 mutant showed that MtrGSTF7 is able to rescue the accumulation of anthocyanins in plant tissues but does not restore the presence of soluble PAs in the seeds. Thus, the transport mechanism in which MtrGSTF7 is involved is similar to what happens in Arabidopsis but limited to the anthocyanins. The tt19 complementation assay is able to discriminate between GST transporters of anthocyanins and GST transporters of both anthocyanins and PAs. For instance, AN9, PpGST, LcGST4, Bract1, RAP, ScGST3, MdGSTF6, GhGSTF12, LhGST and PpGST1 only complement anthocyanin accumulation in vegetative tissues [16,19,25,41,42,48,49,50,51,52]. Differently, heterologous expression of Camelina sativa CMGSTF12, grape VviGST4, radish RsGST1, tea CsGSTa, CsGSTb and CsGSTc in Arabidopsis tt19 mutant not only complements the anthocyanin accumulation in vegetative tissues but also complements the brown pigmentation in the seed coat [17,18,40,44]. Therefore, in M. truncatula, either a fine subfunctionalisation between GSTs involved in the transport of terminal branches of the flavonoid pathway occurs, or the GST responsible for the transport of both compounds has not been identified yet. Embracing the latter hypothesis, we note that the M. truncatula genome harbours several phi type GSTs, some of which, namely MtrGSTF1, 6 and 8, have high expression in seeds. Further analysis, based on mutant characterisation, needs to be undertaken to unravel the function and organ specificity of the above mentioned M. truncatula genes in flavonoid transport under different environmental conditions. Finally, we note that while the writing of the current manuscript was underway, the paper by Wang et al. [17] concerning the functional characterisation of MtrGSTF7 as an anthocyanins specific transporter has been published. The present study not only reinforces but also provides additional evidence with respect to the above-mentioned study about the functional role of MtrGSTF7.

4. Materials and Methods

4.1. Plant Material

M. truncatula plants, both wild-type and Tnt-1 mutants, were grown in three different conditions: (a) a cold containment greenhouse in the autumn-spring period, (b) under controlled conditions in a growth chamber at 23 °C under a 16/8 h (light/dark) photoperiod, in 2.5-L pots with commercial loam mixed 10% with expanded clay provided with irrigation and (c) in vitro at 23 °C under a 16/8 h (light/dark) photoperiod on SHM2/2 medium [53] with and without 50 g/L of additional sucrose (final concentrations 1% and 6% respectively). A. thaliana plants, Columbia and tt19-1 mutant [15], were grown in a growth chamber under the same conditions used for M. truncatula. Samples were collected from plants and immediately frozen in liquid nitrogen. Frozen samples were stored at −80 °C until analysis.

4.2. Quantification of Anthocyanins and PAs

DMACA staining was used for qualitative estimation of PA accumulation plant organs as well as the analyses of soluble and insoluble PAs were performed according to [54]. Anthocyanin extraction and quantification were carried out as reported in [55].

4.3. Identification of the Mutated Gene

Tnt1 insertions in R45 and R39 mutants were recovered using a TAIL-PCR protocol as described in the M. truncatula handbook [56]. TAIL-PCR products were inserted in pGEM-T easy vector and cloned in E. coli XL1-blue cells. Transformed colonies were analyzed by PCR and sequenced by Sanger method with T7/Sp6 primer. Insertion sites sequences were analysed by Blast on the M. truncatula genome, and their position on available genome assembly was assigned. DNA from M. truncatula plants was extracted with GenElute Plant Genomic DNA Miniprep Kit (Sigma Aldrich, St. Louis, MO, USA) according to the manufacturer’s protocol. Segregation of Tnt-1 insertions was analyzed by PCR using primers spanning 100–200 bp in 5′ and in 3′ of the insertion site used in combination with the primer Tnt2rev (5′-GCA CAT GCC TAA TAC TTC TTC-3′) on Tnt-1 LTR.

4.4. RNA Isolation and cDNA Synthesis

RNA was extracted by Spectrum Plant Total RNA kit (Sigma–Aldrich, St Louis, MO, USA). After isolation, RNA was treated with DNase (Sigma–Aldrich) according to the supplier’s instructions, and the absence of any DNA contamination verified by the null PCR amplification of the RNA preps in the presence of the ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′) ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) primer pair as reported in [57] Three micrograms of RNA were reverse transcribed in the presence of Maxima H Minus Reverse Transcriptase (Thermo Scientific, Milan, Italy) and 100 pmol of random hexamers (Euroclone, Milan, Italy) according to the supplier’s instructions.

4.5. Gene Expression Analysis

4.5.1. Real-Time PCR

A primer pair specific to each gene tested was designed with the help of OligoExpress Software (Applied Biosystems, Waltham, MA, USA). The primers are given in Table 1.
An aliquot of 2 µL of 1:10 diluted cDNA was used in the PCR reaction, which was performed using the BlasTaq 2X qPCR Mater Mix (ABM, Richmond, Canada) and carried out in an ABI PRISM 7300 SDS apparatus (Applied Biosystems) according to the following cycling parameters: an initial step at 95 °C for 3 min, followed by 40 cycles each, including a step at 95 °C, 15 s and a step at 60 °C, 1 min. A melting curve was added after each run. For each gene, four technical replicates were amplified. The PCR efficiency for each primer pair was tested as reported in [58]. Gene expression quantification was calculated using the (2−ΔCt) method as reported in [59] with actin as a reference gene. Three biological replicates were analysed, and the significance of the differences between mean expression values was analysed by t-test.

4.5.2. In Silico Expression Analysis

MtrGSTFs expression was investigated by analyzing data available for two microarray experiments on plant tissues and seed coat [25,31]. M. truncatula gene expression data was downloaded from the Medicago Gene Expression Atlas web server [60] currently available at https://medicago.toulouse.inrae.fr/GEA, accessed on 25 February 2022 [61]. Expression data in glandular and non-glandular trichomes was downloaded from the TrichOME database currently available at https://trichome.zhaolab.org/trichomedb/, accessed on 10 December 2021 [27].

4.6. Phylogenetic Analysis

Sequences of GST proteins related to flavonoid transport were retrieved from the GenBank database. Accession numbers are shown in Figure 5 caption. M. truncatula GSTs of the phi class in the R108 genotype were retrieved based on previous genome wide analysis [13] by Blastp of A17 (M. truncatula v4.01 genome) proteins on R108 v1.0 genome. Proteins were aligned using ClustalW and a phylogenetic tree was constructed with the neighbor joining method (1000 replications of bootstrap test) and p-distance substitution model, pairwise deletion using the MEGA 6 program.

4.7. Arabidopsis tt19 Complementation

The ORF of MtrGSTF7 was PCR amplified from leaves cDNA of M. truncatula cv. R108 obtained by standard protocols. Primer GST_ATG_FW (5′-ATG GTG GTG AAA GTT TAT GGT TCA-3′) and GST_TAA_REV (5′-TTA CTT AGC CAA TTC CTT CAA C-3′) were used. The PCR product was cloned into RBCTA cloning vector (RBC Biosciences, Taiwan) according to the manufacturer’s instructions. Plasmids were isolated from positive colonies with an Innuprep plasmid mini kit (Analytik Jena, Germany) and sequenced by Sanger methods with an ABI3130 sequencing machine. Sequences were verified by Blast analysis with the available genomic resources of M. truncatula; the correct clone was used for sub-cloning into the plant binary vector pBI121 by substituting the GUS gene (XmaI-SacI fragment) with the GST gene obtaining the plasmid pBI121-GST7, which was verified by sequencing with primers 35sFW (5’-CTA TCC TTC GCA AGA CCC TTC-3’) and M13(-21) forward. The pBI121-GST7 plasmid was transferred into Agrobacterium tumefaciens GV3101 cells by electroporation. Colonies were verified by PCR, and the correct colony was stored with glycerol at −80°C and used for plant transformation via the floral dip method [62]. The Arabidopsis mutant tt19-1 [15] was used for transformation. Transgenic plants were selected on MS plates added with kanamycin 50 mg/L, two independent homozygous lines for a single T-DNA insertion were obtained in T3 generation and seeds were used for further phenotypic analysis.

Author Contributions

Conceptualisation and methodology, F.P. (Francesco Panara), A.P., O.C. and F.P. (Francesco Paolocci); experiments F.P. (Francesco Panara), V.P., L.L., O.C. and F.P. (Francesco Paolocci); data analysis, F.P. (Francesco Panara), L.L. and F.P. (Francesco Paolocci); writing—original draft preparation, F.P. (Francesco Panara), A.P. and O.C.; writing—review and editing, F.P. (Francesco Panara), A.P., O.C. and F.P. (Francesco Paolocci). All authors have read and agreed to the published version of the manuscript.

Funding

The present research was partly funded by the University of Sassari with “Fondo di Ateneo per la Ricerca 2020”, by CNR DISBA Biomemory SAC.AD002.173/ Potenziamento Infrastrutturale: progetti di ricerca strategici per l’ente and by CNR/ANAS bilateral project 2021–2022.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All references to publicly archived datasets were reported in the Section 4 of the manuscript.

Acknowledgments

We would like to acknowledge Elio Fantini for providing the pBI121 vector. We would also like to thank Pascal Ratet for the initial support in establishing the mutant collection and suggestions during the years.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dixon, R.A.; Pasinetti, G.M. Flavonoids and isoflavonoids: From plant biology to agriculture and neuroscience. Plant Physiol. 2010, 154, 453–457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Harborne, J.B.; Williams, C.A. Anthocyanins and other flavonoids. Nat. Prod. Rep. 2001, 18, 310–333. [Google Scholar] [CrossRef] [PubMed]
  3. Veitch, N.C.; Grayer, R.J. Flavonoids and their glycosides, including anthocyanins. Nat. Prod. Rep. 2008, 25, 555–611. [Google Scholar] [CrossRef] [PubMed]
  4. Iwashina, T. Flavonoid function and activity to plants and other organisms. Biol. Sci. Space 2003, 17, 24–44. [Google Scholar] [CrossRef] [Green Version]
  5. Antony, U.; Chandra, T.S. Antinutrient Reduction and Enhancement in Protein, Starch, and Mineral Availability in Fermented Flour of Finger Millet (Eleusine coracana). J. Agric. Food Chem. 1998, 46, 2578–2582. [Google Scholar] [CrossRef]
  6. Zhao, J. Flavonoid transport mechanisms: How to go, and with whom. Trends Plant Sci. 2015, 20, 576–585. [Google Scholar] [CrossRef]
  7. Zhao, J.; Pang, Y.; Dixon, R.A. The mysteries of proanthocyanidin transport and polymerization. Plant Physiol. 2010, 153, 437–443. [Google Scholar] [CrossRef] [Green Version]
  8. Blakc-Kalff, M.M.A.; Coleman, J.O.D. Detoxification of xenobiotics by plant cells: Characterisation of vacuolar amphiphilic organic anion transporters. Planta 1996, 200, 426–431. [Google Scholar] [CrossRef]
  9. Coleman, J.O.D.; Blake-Kalff, M.M.A.; Davies, T.G.E. Detoxification of xenobiotics by plants: Chemical modification and vacuolar compartmentation. Trends Plant Sci. 1997, 2, 144–151. [Google Scholar] [CrossRef] [Green Version]
  10. Lamoureux, G.L.; Shimabukuro, R.H.; Frear, D.S. Glutathione and glucoside conjugation in herbicide selectivity. In Herbicide Resistance in Weeds and Crops; Elsevier: Amsterdam, The Netherlands, 1991; pp. 227–261. [Google Scholar]
  11. Dixon, D.P.; Davis, B.G.; Edwards, R. Functional divergence in the glutathione transferase superfamily in plants: Identification of two classes with putative functions in redox homeostasis in Arabidopsis thaliana. J. Biol. Chem. 2002, 277, 30859–30869. [Google Scholar] [CrossRef] [Green Version]
  12. Edwards, R.; Dixon, D.P. Plant glutathione transferases. Methods Enzymol. 2005, 401, 169–186. [Google Scholar] [CrossRef] [Green Version]
  13. Han, X.M.; Yang, Z.L.; Liu, Y.J.; Yang, H.L.; Zeng, Q.Y. Genome-wide profiling of expression and biochemical functions of the Medicago glutathione S-transferase gene family. Plant Physiol. Biochem. 2018, 126, 126–133. [Google Scholar] [CrossRef]
  14. Marrs, K.A.; Alfenito, M.R.; Lloyd, A.M.; Walbot, V. A glutathione S-transferase involved in vacuolar transfer encoded by the maize gene Bronze-2. Nature 1995, 375, 397–400. [Google Scholar] [CrossRef]
  15. Kitamura, S.; Shikazono, N.; Tanaka, A. TRANSPARENT TESTA 19 is involved in the accumulation of both anthocyanins and proanthocyanidins in Arabidopsis. Plant J. 2004, 37, 104–114. [Google Scholar] [CrossRef]
  16. Hu, B.; Zhao, J.; Lai, B.; Qin, Y.; Wang, H.; Hu, G. LcGST4 is an anthocyanin-related glutathione S-transferase gene in Litchi chinensis Sonn. Plant Cell Rep. 2016, 35, 831–843. [Google Scholar] [CrossRef]
  17. Lai, B.; You, Y.; Zhang, L.; Wang, Q.; Chen, F.; Luo, G.; Du, L.; Wang, H. Identification and functional characterization of RsGST1, an anthocyanin-related glutathione S-transferase gene in radish. J. Plant Physiol. 2021, 263, 153468. [Google Scholar] [CrossRef]
  18. Pérez-Díaz, R.; Madrid-Espinoza, J.; Salinas-Cornejo, J.; González-Villanueva, E.; Ruiz-Lara, S. Differential Roles for VviGST1, VviGST3, and VviGST4 in Proanthocyanidin and Anthocyanin Transport in Vitis vinífera. Front. Plant Sci. 2016, 7, 1166. [Google Scholar] [CrossRef] [Green Version]
  19. Jiang, S.; Chen, M.; He, N.; Chen, X.; Wang, N.; Sun, Q.; Zhang, T.; Xu, H.; Fang, H.; Wang, Y.; et al. MdGSTF6, activated by MdMYB1, plays an essential role in anthocyanin accumulation in apple. Hortic. Res. 2019, 6, 40. [Google Scholar] [CrossRef] [Green Version]
  20. Jonker, A.; Yu, P. The Role of Proanthocyanidins Complex in Structure and Nutrition Interaction in Alfalfa Forage. Int. J. Mol. Sci. 2016, 17, 793. [Google Scholar] [CrossRef] [Green Version]
  21. McMahon, L.R.; McAllister, T.A.; Berg, B.P.; Majak, W.; Acharya, S.N.; Popp, J.D.; Coulman, B.E.; Wang, Y.; Cheng, K.J. A review of the effects of forage condensed tannins on ruminal fermentation and bloat in grazing cattle. Can. J. Plant Sci. 2000, 80, 469–485. [Google Scholar] [CrossRef] [Green Version]
  22. Popp, J.D.; McCaughey, W.P.; Cohen, R.D.H.; McAllister, T.A.; Majak, W. Enhancing pasture productivity with alfalfa: A review. Can. J. Plant Sci. 2000, 80, 513–519. [Google Scholar] [CrossRef]
  23. Porceddu, A.; Panara, F.; Calderini, O.; Molinari, L.; Taviani, P.; Lanfaloni, L.; Scotti, C.; Carelli, M.; Scaramelli, L.; Bruschi, G.; et al. An Italian functional genomic resource for Medicago truncatula. BMC Res. Notes 2008, 1, 129. [Google Scholar] [CrossRef]
  24. Kaur, P.; Lui, C.; Dudchenko, O.; Nandety, R.S.; Hurgobin, B.; Pham, M.; Aiden, E.L.; Wen, J.; Mysore, K. Delineating the Tnt1 Insertion Landscape of the Model Legume Medicago truncatula cv. R108 at the Hi-C Resolution Using a Chromosome-Length Genome Assembly. Int. J. Mol. Sci. 2021, 22, 4326. [Google Scholar] [CrossRef]
  25. Benedito, V.A.; Torres-Jerez, I.; Murray, J.D.; Andriankaja, A.; Allen, S.; Kakar, K.; Wandrey, M.; Verdier, J.; Zuber, H.; Ott, T.; et al. A gene expression atlas of the model legume Medicago truncatula. Plant J. 2008, 55, 504–513. [Google Scholar] [CrossRef]
  26. Peel, G.J.; Pang, Y.; Modolo, L.V.; Dixon, R.A. The LAP1 MYB transcription factor orchestrates anthocyanidin biosynthesis and glycosylation in Medicago. Plant J. 2009, 59, 136–149. [Google Scholar] [CrossRef]
  27. Dai, X.; Wang, G.; Yang, D.S.; Tang, Y.; Broun, P.; Marks, M.D.; Sumner, L.W.; Dixon, R.A.; Zhao, P.X. TrichOME: A Comparative Omics Database for Plant Trichomes. Plant Physiol. 2010, 152, 44. [Google Scholar] [CrossRef] [Green Version]
  28. Tanner, G.J.; Francki, K.T.; Abrahams, S.; Watson, J.M.; Larkin, P.J.; Ashton, A.R. Proanthocyanidin biosynthesis in plants. Purification of legume leucoanthocyanidin reductase and molecular cloning of its cDNA. J. Biol. Chem. 2003, 278, 31647–31656. [Google Scholar] [CrossRef] [Green Version]
  29. Paolocci, F.; Robbins, M.P.; Madeo, L.; Arcioni, S.; Martens, S.; Damiani, F. Ectopic Expression of a Basic Helix-Loop-Helix Gene Transactivates Parallel Pathways of Proanthocyanidin Biosynthesis. Structure, Expression Analysis, and Genetic Control of Leucoanthocyanidin 4-Reductase and Anthocyanidin Reductase Genes in Lotus corn. Plant Physiol. 2007, 143, 504. [Google Scholar] [CrossRef] [Green Version]
  30. Liu, C.; Wang, X.; Shulaev, V.; Dixon, R.A. A role for leucoanthocyanidin reductase in the extension of proanthocyanidins. Nat. Plants 2016, 2, 1–7. [Google Scholar] [CrossRef]
  31. Pang, Y.; Peel, G.J.; Sharma, S.B.; Tang, Y.; Dixon, R.A. A transcript profiling approach reveals an epicatechin-specific glucosyltransferase expressed in the seed coat of Medicago truncatula. Proc. Natl. Acad. Sci. USA 2008, 105, 14210–14215. [Google Scholar] [CrossRef] [Green Version]
  32. Liu, W.; Feng, Y.; Yu, S.; Fan, Z.; Li, X.; Li, J.; Yin, H. The flavonoid biosynthesis network in plants. Int. J. Mol. Sci. 2021, 22, 2824. [Google Scholar] [CrossRef] [PubMed]
  33. Naing, A.H.; Kim, C.K. Abiotic stress-induced anthocyanins in plants: Their role in tolerance to abiotic stresses. Physiol. Plant. 2021, 172, 1711–1723. [Google Scholar] [CrossRef] [PubMed]
  34. Cappellini, F.; Marinelli, A.; Toccaceli, M.; Tonelli, C.; Petroni, K. Anthocyanins: From Mechanisms of Regulation in Plants to Health Benefits in Foods. Front. Plant Sci. 2021, 12. [Google Scholar] [CrossRef] [PubMed]
  35. Kaur, S.; Sharma, N.; Kapoor, P.; Chunduri, V.; Pandey, A.K.; Garg, M. Spotlight on the overlapping routes and partners for anthocyanin transport in plants. Physiol. Plant. 2021, 171, 868–881. [Google Scholar] [CrossRef]
  36. Larsen, E.S.; Alfenito, M.R.; Briggs, W.R.; Walbot, V. A carnation anthocyanin mutant is complemented by the glutathione S-transferases encoded by maize Bz2 and petunia An9. Plant Cell Rep. 2003, 21, 900–904. [Google Scholar] [CrossRef]
  37. Yamazaki, M.; Shibata, M.; Nishiyama, Y.; Springob, K.; Kitayama, M.; Shimada, N.; Aoki, T.; Ayabe, S.I.; Saito, K. Differential gene expression profiles of red and green forms of Perilla frutescens leading to comprehensive identification of anthocyanin biosynthetic genes. FEBS J. 2008, 275, 3494–3502. [Google Scholar] [CrossRef]
  38. Conn, S.; Curtin, C.; Bézier, A.; Franco, C.; Zhang, W. Purification, molecular cloning, and characterization of glutathione S-transferases (GSTs) from pigmented Vitis vinifera L. cell suspension cultures as putative anthocyanin transport proteins. J. Exp. Bot. 2008, 59, 3621–3634. [Google Scholar] [CrossRef] [Green Version]
  39. Kitamura, S.; Akita, Y.; Ishizaka, H.; Narumi, I.; Tanaka, A. Molecular characterization of an anthocyanin-related glutathione S-transferase gene in cyclamen. J. Plant Physiol. 2012, 169, 636–642. [Google Scholar] [CrossRef]
  40. Wang, Y.; Tang, Y.; Zhang, M.; Cai, F.; Qin, J.; Wang, Q.; Liu, C.; Wang, G.; Xu, L.; Yang, L.; et al. Molecular cloning and functional characterization of a glutathione S-transferase involved in both anthocyanin and proanthocyanidin accumulation in Camelina sativa (Brassicaceae). Genet. Mol. Res. 2012, 11, 4711–4719. [Google Scholar] [CrossRef]
  41. Cheng, J.; Liao, L.; Zhou, H.; Gu, C.; Wang, L.; Han, Y. A small indel mutation in an anthocyanin transporter causes variegated colouration of peach flowers. J. Exp. Bot. 2015, 66, 7227–7239. [Google Scholar] [CrossRef] [Green Version]
  42. Luo, H.; Dai, C.; Li, Y.; Feng, J.; Liu, Z.; Kang, C. Reduced Anthocyanins in Petioles codes for a GST anthocyanin transporter that is essential for the foliage and fruit coloration in strawberry. J. Exp. Bot. 2018, 69, 2595–2608. [Google Scholar] [CrossRef] [Green Version]
  43. Kou, M.; Liu, Y.J.; Li, Z.Y.; Zhang, Y.G.; Tang, W.; Yan, H.; Wang, X.; Chen, X.G.; Su, Z.X.; Arisha, M.H.; et al. A novel glutathione S-transferase gene from sweetpotato, IbGSTF4, is involved in anthocyanin sequestration. Plant Physiol. Biochem. 2019, 135, 395–403. [Google Scholar] [CrossRef]
  44. Liu, Y.; Qi, Y.; Zhang, A.; Wu, H.; Liu, Z.; Ren, X. Molecular cloning and functional characterization of AcGST1, an anthocyanin-related glutathione S-transferase gene in kiwifruit (Actinidia chinensis). Plant Mol. Biol. 2019, 100, 451–465. [Google Scholar] [CrossRef]
  45. Roy, S.; Liu, W.; Nandety, R.S.; Crook, A.; Mysore, K.S.; Pislariu, C.I.; Frugoli, J.; Dickstein, R.; Udvardi, M.K. Celebrating 20 Years of Genetic Discoveries in Legume Nodulation and Symbiotic Nitrogen Fixation. Plant Cell 2020, 32, 15–41. [Google Scholar] [CrossRef] [Green Version]
  46. Liu, C.; Ha, C.M.; Dixon, R.A. Functional genomics in the study of metabolic pathways in Medicago truncatula: An overview. Methods Mol. Biol. 2018, 1822, 315–337. [Google Scholar] [CrossRef]
  47. Zhao, J.; Huhman, D.; Shadle, G.; He, X.Z.; Sumner, L.W.; Tang, Y.; Dixon, R.A. MATE2 Mediates Vacuolar Sequestration of Flavonoid Glycosides and Glycoside Malonates in Medicago truncatula. Plant Cell 2011, 23, 1536–1555. [Google Scholar] [CrossRef] [Green Version]
  48. Mueller, L.A.; Goodman, C.D.; Silady, R.A.; Walbot, V. AN9, a petunia glutathione S-transferase required for anthocyanin sequestration, is a flavonoid-binding protein. Plant Physiol. 2000, 123, 1561–1570. [Google Scholar] [CrossRef] [Green Version]
  49. Vilperte, V.; Boehm, R.; Debener, T. A highly mutable GST is essential for bract colouration in Euphorbia pulcherrima Willd. Ex Klotsch. BMC Genom. 2021, 22. [Google Scholar] [CrossRef]
  50. Cui, Y.; Fan, J.; Lu, C.; Ren, J.; Qi, F.; Huang, H.; Dai, S. ScGST3 and multiple R2R3-MYB transcription factors function in anthocyanin accumulation in Senecio cruentus. Plant Sci. 2021, 313, 111094. [Google Scholar] [CrossRef]
  51. Shao, D.; Li, Y.; Zhu, Q.; Zhang, X.; Liu, F.; Xue, F.; Sun, J. GhGSTF12, a glutathione S-transferase gene, is essential for anthocyanin accumulation in cotton (Gossypium hirsutum L.). Plant Sci. 2021, 305, 110827. [Google Scholar] [CrossRef]
  52. Cao, Y.; Xu, L.; Xu, H.; Yang, P.; He, G.; Tang, Y.; Qi, X.; Song, M.; Ming, J. LhGST is an anthocyanin-related glutathione S-transferase gene in Asiatic hybrid lilies (Lilium spp.). Plant Cell Rep. 2021, 40, 85–95. [Google Scholar] [CrossRef]
  53. Trinh, T.H.; Ratet, P.; Kondorosi, E.; Durand, P.; Kamaté, K.; Bauer, P.; Kondorosi, A. Rapid and efficient transformation of diploid Medicago truncatula and Medicago sativa ssp. falcata lines improved in somatic embryogenesis. Plant Cell Rep. 1998, 17, 345–355. [Google Scholar] [CrossRef]
  54. Li, Y.G.; Tanner, G.; Larkin, P. The DMACA-HCl protocol and the threshold proanthocyanidin content for bloat safety in forage legumes. J. Sci. Food Agric. 1996, 70, 89–101. [Google Scholar] [CrossRef]
  55. Dong, X.; Braun, E.L.; Grotewold, E. Functional Conservation of Plant Secondary Metabolic Enzymes Revealed by Complementation of Arabidopsis Flavonoid Mutants with Maize Genes. Plant Physiol. 2001, 127, 46. [Google Scholar] [CrossRef] [Green Version]
  56. Medicago truncatula Handbook; Samuel Roberts Noble Foundation: Ardmore, OK, USA, 2006.
  57. Paolocci, F.; Bovone, T.; Tosti, N.; Arcioni, S.; Damiani, F. Light and an exogenous transcription factor qualitatively and quantitatively affect the biosynthetic pathway of condensed tannins in Lotus corniculatus leaves. J. Exp. Bot. 2005, 56, 1093–1103. [Google Scholar] [CrossRef] [Green Version]
  58. Escaray, F.J.; Passeri, V.; Perea-García, A.; Antonelli, C.J.; Damiani, F.; Ruiz, O.A.; Paolocci, F. The R2R3-MYB TT2b and the bHLH TT8 genes are the major regulators of proanthocyanidin biosynthesis in the leaves of Lotus species. Planta 2017, 246, 243–261. [Google Scholar] [CrossRef]
  59. Bizzarri, M.; Delledonne, M.; Ferrarini, A.; Tononi, P.; Zago, E.; Vittori, D.; Damiani, F.; Paolocci, F. Whole-Transcriptome Analysis Unveils the Synchronized Activities of Genes for Fructans in Developing Tubers of the Jerusalem Artichoke. Front. Plant Sci. 2020, 11, 101. [Google Scholar] [CrossRef]
  60. He, J.; Benedito, V.A.; Wang, M.; Murray, J.D.; Zhao, P.X.; Tang, Y.; Udvardi, M.K. The Medicago truncatula gene expression atlas web server. BMC Bioinform. 2009, 10, 1–9. [Google Scholar] [CrossRef] [Green Version]
  61. Carrere, S.; Verdier, J.; Gamas, P. MtExpress, a Comprehensive and Curated RNAseq-based Gene Expression Atlas for the Model Legume Medicago truncatula. Plant Cell Physiol. 2021, 62, 1494–1500. [Google Scholar] [CrossRef]
  62. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Pictures of wild -type plants (AC,F) and R45 mutant line (D,E,G,H). Arrows in (F,H) point to the leaf blot (F) and to the corresponding position in R45 (H). Arrows in (C,G) point to the darkened region at the junction of pedicel and calyx (C) and to the corresponding position in R45 (G). Pictures (A,B,D) E were taken in a cold greenhouse where pigmentation in the aerial tissues was induced by low temperatures in the wild type (A,B), while no pigmentation was observable in R45 (D,E).
Figure 1. Pictures of wild -type plants (AC,F) and R45 mutant line (D,E,G,H). Arrows in (F,H) point to the leaf blot (F) and to the corresponding position in R45 (H). Arrows in (C,G) point to the darkened region at the junction of pedicel and calyx (C) and to the corresponding position in R45 (G). Pictures (A,B,D) E were taken in a cold greenhouse where pigmentation in the aerial tissues was induced by low temperatures in the wild type (A,B), while no pigmentation was observable in R45 (D,E).
Plants 11 01318 g001
Figure 2. Intron-exon structure of MtrunR108HiC_012760 corresponding to MtrGSTF7 and position of Tnt1 insertions in exon 3 in R39 and R45 mutant lines (A). Segregation analysis on 10 plants in the R45 T1 progeny. P1–P3 primed amplification fails in presence of the 5kbps Tnt1 insertion. Plants 3, 4 and 8 (circled in red) showed the mutant phenotype (B).
Figure 2. Intron-exon structure of MtrunR108HiC_012760 corresponding to MtrGSTF7 and position of Tnt1 insertions in exon 3 in R39 and R45 mutant lines (A). Segregation analysis on 10 plants in the R45 T1 progeny. P1–P3 primed amplification fails in presence of the 5kbps Tnt1 insertion. Plants 3, 4 and 8 (circled in red) showed the mutant phenotype (B).
Plants 11 01318 g002
Figure 3. Anthocyanin content measured in leaves of plants cultivated in vitro on high sucrose (6%) containing medium. WT is wild-type R108. HET and MUT stands for heterozygous and homozygous referred to Tnt1 insertion in MtrGSTF7. Anthocyanins could not be detected in MUT. Data indicate mean values ±SD of four replicates (*** p < 0.001).
Figure 3. Anthocyanin content measured in leaves of plants cultivated in vitro on high sucrose (6%) containing medium. WT is wild-type R108. HET and MUT stands for heterozygous and homozygous referred to Tnt1 insertion in MtrGSTF7. Anthocyanins could not be detected in MUT. Data indicate mean values ±SD of four replicates (*** p < 0.001).
Plants 11 01318 g003
Figure 4. Contents of soluble and insoluble PAs measured in R45 and R108 (WT) seeds (* p < 0.05).
Figure 4. Contents of soluble and insoluble PAs measured in R45 and R108 (WT) seeds (* p < 0.05).
Plants 11 01318 g004
Figure 5. Phylogenetic tree with R108 MtrGSTFs and other GSTs involved in flavonoid transportation. The tree was constructed with the neighbor joining method (1000 replications of bootstrap test) and p-distance substitution model, pairwise deletion using the MEGA 6 program. PpRiant1 (Prunus persica ALE31199.1); MdGSTF6 (Malus domestica NP 001315851.1); FvRAP (Fragaria vesca XP 004288578.1); CsGST (Citrus sinensis ABA42223.1); VvGST4 (Vitis vinifera AAX81329.1); LcGST4 (Litchi chinensis ALY05893.1); AtTT19 (Arabidopsis thaliana OAO91277.1); CkmGST3 (Cyclamen persicum x Cyclamen purpurascens BAM14584.1); AcGST1 (Actinidia chinensis QCQ77644.1); PhAN9 (Petunia x hybrida CAA68993.1); PfGST1 (Perilla frutescens var. crispa BAG14300.1); DcGST (Dianthus caryophyllus BAM21533.1); PcGST (Pyrus communis ABI79308.1); VvGST3 (Vitis vinifera ABO64930.1); DcGSTa (Dracaena cambodiana ANH58194.1); DcGSTb (Dracaena cambodiana, ANH58192.1); ZmBz2 (Zea mays AAA50245.1); VvGST1 (Vitis vinifera AAN85826.1).
Figure 5. Phylogenetic tree with R108 MtrGSTFs and other GSTs involved in flavonoid transportation. The tree was constructed with the neighbor joining method (1000 replications of bootstrap test) and p-distance substitution model, pairwise deletion using the MEGA 6 program. PpRiant1 (Prunus persica ALE31199.1); MdGSTF6 (Malus domestica NP 001315851.1); FvRAP (Fragaria vesca XP 004288578.1); CsGST (Citrus sinensis ABA42223.1); VvGST4 (Vitis vinifera AAX81329.1); LcGST4 (Litchi chinensis ALY05893.1); AtTT19 (Arabidopsis thaliana OAO91277.1); CkmGST3 (Cyclamen persicum x Cyclamen purpurascens BAM14584.1); AcGST1 (Actinidia chinensis QCQ77644.1); PhAN9 (Petunia x hybrida CAA68993.1); PfGST1 (Perilla frutescens var. crispa BAG14300.1); DcGST (Dianthus caryophyllus BAM21533.1); PcGST (Pyrus communis ABI79308.1); VvGST3 (Vitis vinifera ABO64930.1); DcGSTa (Dracaena cambodiana ANH58194.1); DcGSTb (Dracaena cambodiana, ANH58192.1); ZmBz2 (Zea mays AAA50245.1); VvGST1 (Vitis vinifera AAN85826.1).
Plants 11 01318 g005
Figure 6. MtrGSTFs, expression in plant organs and in the seed coat.
Figure 6. MtrGSTFs, expression in plant organs and in the seed coat.
Plants 11 01318 g006
Figure 7. Expression of MtrGSTFs in leaves of 35S::LAP1 (LAP1), showing hyperaccumulation of anthocyanins, and 35S::GUS used as control (GUS). Asterisk indicates log2FC > 2.
Figure 7. Expression of MtrGSTFs in leaves of 35S::LAP1 (LAP1), showing hyperaccumulation of anthocyanins, and 35S::GUS used as control (GUS). Asterisk indicates log2FC > 2.
Plants 11 01318 g007
Figure 8. MtrGSTFs expression in glandular (black bars) and non-glandular trichomes (white bars).
Figure 8. MtrGSTFs expression in glandular (black bars) and non-glandular trichomes (white bars).
Plants 11 01318 g008
Figure 9. Expression levels of key genes of the phenylpropanoid pathway in M. truncatula leaves of wild-type R108 (WT) and mutant plants (R45) grown under controlled conditions. The relative expression of each gene is calculated using the [2−(ΔCt)] algorithm using actin as housekeeping gene. Significance of differences between means was determined by t-test (*** p < 0.001).
Figure 9. Expression levels of key genes of the phenylpropanoid pathway in M. truncatula leaves of wild-type R108 (WT) and mutant plants (R45) grown under controlled conditions. The relative expression of each gene is calculated using the [2−(ΔCt)] algorithm using actin as housekeeping gene. Significance of differences between means was determined by t-test (*** p < 0.001).
Plants 11 01318 g009
Figure 10. Gene expression in leaves of M. truncatula R108 (WT) vs. mutant plants (R45) grown in cold conditions. Expression levels are calculated as in legend of Figure 9 (* p < 0.05).
Figure 10. Gene expression in leaves of M. truncatula R108 (WT) vs. mutant plants (R45) grown in cold conditions. Expression levels are calculated as in legend of Figure 9 (* p < 0.05).
Plants 11 01318 g010
Figure 11. Gene expression in pods of M. truncatula R108 (WT) and mutant (R45). The stage of the sampled pods is shown (bar = 1 mm). Expression levels are calculated as in legend of Figure 9 (* p < 0.05).
Figure 11. Gene expression in pods of M. truncatula R108 (WT) and mutant (R45). The stage of the sampled pods is shown (bar = 1 mm). Expression levels are calculated as in legend of Figure 9 (* p < 0.05).
Plants 11 01318 g011
Figure 12. Functional complementation assay. From the top: seedlings; detail of anthocyanin colouration at the rosette base; seeds; relative content of soluble and insoluble PA in wt seeds vs. those from tt19-1 mutant and tt19-1 mutant transformed with the 35S::MtrGSTF7 construct. Significant differences (p < 0.05) as determined by Tukey’s multiple comparisons test are indicated with different letters.
Figure 12. Functional complementation assay. From the top: seedlings; detail of anthocyanin colouration at the rosette base; seeds; relative content of soluble and insoluble PA in wt seeds vs. those from tt19-1 mutant and tt19-1 mutant transformed with the 35S::MtrGSTF7 construct. Significant differences (p < 0.05) as determined by Tukey’s multiple comparisons test are indicated with different letters.
Plants 11 01318 g012
Table 1. List of primers employed in qRT-PCR assays.
Table 1. List of primers employed in qRT-PCR assays.
Gene Forward Primer (5′-3′)Reverse Primer (5′-3′)N° Accession
ActinTCAATGTGCCTGCCATGTATGTACTCACACCGTCACCAGAATCCJQ028731.1
4CLAGGAGGCAACCAGATCGACCATCAAACGATCGACGACAAATAAGAATCCXM_013610757.3
C4HCGATATCCCAGCCGAGAGCAAAAGAACCGTTCGGGCCTGAATHM627322.1
CHSGGTTCAGACCCATTACCACAAGTTGATGTAAGCCCGACTTCACGAAGGTXM_003601599.4
CHIGTAGCCATTTGGAAGTCTCTTGGGAATAGAGGAGCCTGGTGGAAATGTTTXM_003592720.4
F3’HGTCTTGGTCTTAGGATGGTTCAACTTCTTACTCTGTAAGGTGAGCCCATATGCTTCAXM_013602525.3
DFR1GGCTATGTGTCTTTATGTGTGTTTCTGTGAGTTTGGGCTTCAACAGGATTGCAY389346.1
ANSAAGAAGCTGGTGGAATGGAAGAGGGTTGAGGGCAAATTGGGTAGEF544389.1
ANRGTCGGGCTCATATTTTTGTGGCGAAACTTTGCAAGCTCGGGAACACTGAY184243.1
UGT72L1CACTGGCTTGGAGCTTCTATTTGCAGCCCGGTACTTTGATAGGCEU434684.1
GSTF7CAGTTGTAGAGGATGGTGATTTCAGAACCACGGTCTGCATACTTTGTT MtrunR108HiC_012760
LARGAGGTTTTTGCCTTCAGAATTTGGGGGTGGAGGAAGCTGTGATGGBN000703.1
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Panara, F.; Passeri, V.; Lopez, L.; Porceddu, A.; Calderini, O.; Paolocci, F. Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula. Plants 2022, 11, 1318. https://doi.org/10.3390/plants11101318

AMA Style

Panara F, Passeri V, Lopez L, Porceddu A, Calderini O, Paolocci F. Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula. Plants. 2022; 11(10):1318. https://doi.org/10.3390/plants11101318

Chicago/Turabian Style

Panara, Francesco, Valentina Passeri, Loredana Lopez, Andrea Porceddu, Ornella Calderini, and Francesco Paolocci. 2022. "Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula" Plants 11, no. 10: 1318. https://doi.org/10.3390/plants11101318

APA Style

Panara, F., Passeri, V., Lopez, L., Porceddu, A., Calderini, O., & Paolocci, F. (2022). Functional Characterization of MtrGSTF7, a Glutathione S-Transferase Essential for Anthocyanin Accumulation in Medicago truncatula. Plants, 11(10), 1318. https://doi.org/10.3390/plants11101318

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop