Plant DNA Barcode as a Tool for Root Identification in Hypogea: The Case of the Etruscan Tombs of Tarquinia (Central Italy)
Abstract
:1. Introduction
2. Results
2.1. DNA Marker Performances and Root Identification
2.2. Integrated Taxonomic Identification Method
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. Root Sampling, DNA Extraction, Amplification, and Sequence Comparison
4.3. Integrated Taxonomic Identification Method
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Caneva, G.; De Marco, G.; Pontrandolfi, M.A. Plant communities of the walls of Venosa Castle (Basilicata, Italy) as biodeteriogens and bioindicators. In Conservation of Stone and Other Materials; Thiel, M.J., Ed.; UNESCO: Paris, France, 1993; Volume 1, pp. 263–270. [Google Scholar]
- Caneva, G.; Benelli, F.; Bartoli, F.; Cicinelli, E. Safeguarding natural and cultural heritage on Etruscan tombs (La Banditaccia, Cerveteri, Italy). Rend Lincei Sci. Fis. 2018, 29, 891–907. [Google Scholar] [CrossRef]
- Celesti Grapow, L.; Caneva, G.; Pacini, A. La Flora dell’Anfiteatro Flavio (Roma). Webbia 2001, 56, 321–342. [Google Scholar]
- Corbetta, F.; Pavone, P.; Spampinato, G.; Tomaselli, V.; Trigilia, A. Studio della vegetazione dell’area archeologica della Neapolis (Siracusa, Sicilia) finalizzato alla conservazione dei manufatti architettonici. Fitosociologia 2002, 39, 3–24. [Google Scholar]
- Ceschin, S.; Caneva, G.; Kumbaric, A. Biodiversità ed emergenze floristiche nelle aree archeologiche romane. Webbia 2006, 61, 133–144. [Google Scholar] [CrossRef]
- Ceschin, S.; Cancellieri, L.; Caneva, G.; Battisti, C. Size area, patch heterogeneity and plant species richness across archaeological sites of Rome: Different patterns for different guilds. Vie Milieu 2012, 62, 165–171. [Google Scholar]
- Ceschin, S.; Kumbaric, A.; Caneva, G.; Zuccarello, V. Testing flora as bioindicator of buried structures in the archaeological area of Maxentius’s villa (Rome, Italy). J. Archaeol. Sci. 2012, 39, 1288–1295. [Google Scholar] [CrossRef]
- Cicinelli, E.; Benelli, F.; Bartoli, F.; Traversetti, L.; Caneva, G. Trends of plant communities growing on the Etruscan tombs (Cerveteri, Italy) related to different management practices. Plant. Biosyst. Int. J. Deal. all Asp. Plant Biol. 2020, 154, 158–164. [Google Scholar] [CrossRef]
- Caneva, G. A botanical approach to the planning of archaeological, parks in Italy. Conserv. Manag. Archaeol. Sites 1999, 3, 127–134. [Google Scholar] [CrossRef]
- Caneva, G.; Pacini, A.; Grapow, L.C.; Ceschin, S. The Colosseum’s use and state of abandonment as analysed through its flora. Int. Biodet. Biodeg. 2003, 51, 211–219. [Google Scholar] [CrossRef]
- Almeida, M.; Mouga, T.; Barracosa, P. The weathering ability of higher plants. The case of Ailanthus altissima (Miller) Swingle. Int. Biodet. Biodeg. 1994, 33, 333–343. [Google Scholar] [CrossRef]
- Motti, R.; Bonanomi, G. Vascular plant colonization of four castles in southern Italy: Effects of substrate bioreceptivity, local environmental factors, and current management. Int. Biodet. Biodeg. 2018, 133, 26–33. [Google Scholar] [CrossRef]
- Awang, A.; Nasir, M.R.M.; Mohamad, W.S.N.W. A Review on the Impacts of Plants Towards Heritage Buildings. J. Appl. Arts 2020, 2, 94–101. [Google Scholar]
- Dahmani, J.; Benharbit, M.; Fassar, M.; Hajila, R.; Zidane, L.; Magri, N.; Belahbib, N. Vascular plants census linked to the biodeterioration process of the Portuguese city of Mazagan in El Jadida, Morocco. J. King Saud Univ. Sci. 2020, 32, 682–689. [Google Scholar] [CrossRef]
- Trotta, G.; Savo, V.; Cicinelli, E.; Carboni, M.; Caneva, G. Colonization and damages of Ailanthus altissima (Mill.) Swingle on archaeological structures: Evidence from the Aurelian Walls in Rome (Italy). Int. Biodet. Biodeg. 2020, 153, 105054. [Google Scholar] [CrossRef]
- Caneva, G.; Galotta, G.; Cancellieri, L.; Savo, V. Tree roots and damages in the Jewish catacombs of Villa Torlonia (Roma). J. Cult. Heritage 2009, 10, 53–62. [Google Scholar] [CrossRef]
- Caneva, G. Tree roots and hypogeans conservation. Braun Blanquetia 1989, 3, 329–336. [Google Scholar]
- Caneva, G.; Ceschin, S.; De Marco, G. Mapping the risk of damage from tree roots for the conservation of archaeological sites: The case of the Domus Aurea, Rome. Conserv. Manag. Archaeol. Sites 2006, 7, 163–170. [Google Scholar] [CrossRef]
- Caneva, G.; Agostini, D.; Baldini, D. Domus Tiberiana and Horti Farnesiani (Rome): Further investigations on tree roots for the conservation of the archaeological site. In Proceedings of the 10th ICOMOS International Congress on Deterioration and Conservation of Stone, Stockholm, Sweden, 27 June–2 July 2004; Kwiatkowski, D., Löfvendahl, R., Eds.; Volume 2, pp. 955–961. [Google Scholar]
- Cuttler, D.F.; Richardson, I.B.K. Tree Root and Buildings; Kew Garden: London, UK, 1981; pp. 1–94. [Google Scholar]
- Biddle, P.G. Tree root damage to buildings. In Causes, Diagnosis, Remedy/Patterns of Soil Drying in Proximity to Trees on Clays Soils; Willowmead Publishing Ltd: Wantage, UK, 1998. [Google Scholar]
- Diaz–Herraiz, M.; Jurado, V.; Cuezva, S.; Laiz, L.; Pallecchi, P.; Tiano, P.; Sanchez-Moral, S.; Saiz-Jimenez, C. The actinobacterial colonisation of Etruscan paintings. Sci. Rep. 2013, 3, 1440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caneva, G.; Isola, D.; Lee, H.J.; Chung, Y.J. Biological Risk for Hypogea: Shared Data from Etruscan Tombs in Italy and Ancient Tombs of the Baekje Dynasty in Republic of Korea. Appl. Sci. 2020, 10, 6104. [Google Scholar] [CrossRef]
- Jasinska, E.J.; Knott, B.; McComb, A.J. Root Mats in Ground Water: A Fauna-Rich Cave Habitat. J. N. Am. Benthol. Soc. 1996, 15, 508–519. [Google Scholar] [CrossRef]
- Diaz-Herraiz, M.; Jurado, V.; Cuezva, S.; Laiz, L.; Pallecchi, P.; Tiano, P.; Sanchez-Moral, S.; Saiz-Jimenez, C. Deterioration of an Etruscan tomb by bacteria from the order Rhizobiales. Sci. Rep. 2015, 4, 3610. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Isola, D.; Zucconi, L.; Cecchini, A.; Caneva, G. Dark-pigmented biodeteriogenic fungi in etruscan hypogeal tombs: New data on their culture-dependent diversity, favouring conditions, and resistance to biocidal treatments. Fungal Biol. 2021. [Google Scholar] [CrossRef]
- Catizone, P. Il contenimento delle piante infestanti nelle aree di interesse archeologico. In Archeologia e Botanica; Mastroroberto, M., Ed.; L’Erma di Bretschneider Editore: Roma, Italy, 1990; pp. 59–64. [Google Scholar]
- Mishra, A.; Jain, K.K.; Garg, K. Role of higher plants in the deterioration of historic buildings. Sci. Total Environ. 1995, 167, 375–392. [Google Scholar] [CrossRef]
- Signorini, M.A. L’Indice di Pericolosità: Un contributo del botanico al controllo della vegetazione infestante nelle aree monumentali. Inf. Bot. Ital. 1996, 28, 7–14. [Google Scholar]
- Bruni, I.; De Mattia, F.; Martellos, S.; Galimberti, A.; Savadori, P.; Casiraghi, M.; Nimis, P.L.; Labra, M. DNA Barcoding as an Effective Tool in Improving a Digital Plant Identification System: A Case Study for the Area of Mt. Valerio, Trieste (NE Italy). PLoS ONE 2011, 7, e43256. [Google Scholar] [CrossRef] [PubMed]
- Bellini, C.; Pacurar, D.I.; Perrone, I. Adventitious Roots and Lateral Roots: Similarities and Differences. Annu. Rev. Plant Biol. 2014, 65, 639–666. [Google Scholar] [CrossRef] [PubMed]
- Cesari, M.G.; Rossi, W. Le radici minacciano le tombe dipinte di Tarquinia. Archeologia 1972, 3, 20–25. [Google Scholar]
- Kutschera, L. Root Atlas of Central European Weeds and Crop. Plants of Arable Land; DLG Verlag: Frankfurt am Main, Germany, 1960; p. 544. [Google Scholar]
- Kutschera, L.; Lichtenegger, E.; Sobotik, M.; Lichtenegger, E.; Haas, D. Würzeln. Bewurzelung von Pflanzen in verschidenen Lebensräumen. Stapfia 1997, 49, 1e331. [Google Scholar]
- Paribeni, M. Cause di Deperimento e Metodi di Conservazione Delle Pitture Murali Delle Tombe Sotterranee di Tarquinia. Scientific Report of C.N.R.—Istituto di Fisica Tecnica di Roma; Edizioni Sistema: Rome, Italy, 1970. [Google Scholar]
- Cecchini, A. Le Tombe Dipinte di Tarquinia. Vicenda Conservativa, Restauri e Tecnica di Esecuzione; Nardini Ed: Firenze, Italy, 2012; p. 102. [Google Scholar]
- Altieri, A.; Bartolini, M.; Pietrini, A.M. Relazione del Laboratorio di Indagini Biologiche: Tarquinia Necropoli dei Monterozzi—Consulenza Scientifica; ISCR Report: Rome, Italy, 2013. [Google Scholar]
- Adamowicz, S.J. International Barcode of Life: Evolution of a global research community. Genome 2015, 58, 151–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khaksar, R.; Carlson, T.; Schaffner, D.W.; Ghorashi, M.; Best, D.; Jandhyala, S.; Traverso, J.; Amini, S. Unmasking seafood mislabeling in U.S. markets: DNA barcoding as a unique technology for food authentication and quality control. Food Control 2015, 56, 71–76. [Google Scholar] [CrossRef]
- Pappalardo, A.M.; Ferrito, M. DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets. Fish. Res. 2015, 164, 153–158. [Google Scholar] [CrossRef]
- Chimeno, C.; Morinière, J.; Podhorna, J.; Hardulak, L.; Hausmann, A.; Reckel, F.; Grunwald, J.E.; Penning, R.; Haszprunar, G. DNA Barcoding in Forensic Entomology—Establishing a DNA Reference Library of Potentially Forensic Relevant Arthropod Species. J. Forensic. Sci. 2019, 64, 593–601. [Google Scholar] [CrossRef]
- Weigand, H.; Beermann, A.J.; Čiampor, F.; Costa, F.O.; Csabai, Z.; Duarte, S.; Geiger, M.F.; Grabowski, M.; Rimet, F.; Rulik, B.; et al. DNA barcode reference libraries for the monitoring of aquatic biota in Europe: Gap-analysis and recommendations for future work. Sci. Total Environ. 2019, 678, 499–524. [Google Scholar] [CrossRef]
- CBOL Plant Working Group; Hollingsworth, P.M.; Forrest, L.L.; Spouge, J.L.; Hajibabaei, M.; Ratnasingham, S.; van der Bank, M.; Chase, M.W.; Cowan, R.S.; Erickson, D.L.; et al. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 2009, 106, 12794–12797. [Google Scholar]
- Hollingsworth, M.L.; Clark, A.A.; Forrest, L.L.; Richardson, J.; Pennington, R.T.; Long, D.G.; Cowan, R.; Chase, M.W.; Gaudeul, M.; Hollingsworth, P.M. Selecting barcoding loci for plants: Evaluation of seven candidate loci with species-level sampling in three divergent groups of land plants. Mol. Ecol. Resour. 2009, 9, 439–457. [Google Scholar] [CrossRef] [PubMed]
- Hollingsworth, P.M.; Graham, S.; Little, D.P. Choosing and Using a Plant DNA Barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef] [PubMed]
- Du, Z.-Y.; Qimike, A.; Yang, C.-F.; Chen, J.-M.; Wang, Q.-F. Testing four barcoding markers for species identification of Potamogetonaceae. J. Syst. Evol. 2011, 49, 246–251. [Google Scholar] [CrossRef]
- Guo, X.; Wang, X.; Su, W.; Zhang, G.; Zhou, R. DNA Barcodes for Discriminating the Medicinal Plant Scutellaria baicalensis (Lamiaceae) and Its Adulterants. Biol. Pharm. Bull. 2011, 34, 1198–1203. [Google Scholar] [CrossRef] [Green Version]
- De Mattia, F.; Gentili, R.; Bruni, I.; Galimberti, A.; Sgorbati, S.; Casiraghi, M.; Labra, M. A multi-marker DNA barcoding approach to save time and resources in vegetation surveys. Bot. J. Linn. Soc. 2012, 169, 518–529. [Google Scholar] [CrossRef] [Green Version]
- Zhang, C.Y.; Wang, F.Y.; Yan, H.F.; Hao, G.; Hu, C.M.; Ge, X.J. Testing DNA barcoding in closely related groups of Lysimachia L. (Myrsinaceae). Mol. Ecol. Resour. 2012, 12, 98–108. [Google Scholar] [CrossRef]
- Amritha, N.; Bhooma, V.; Parani, M. Authentication of the market samples of Ashwagandha by DNA barcoding reveals that powders are significantly more adulterated than roots. J. Ethnopharmacol. 2020, 256, 112725. [Google Scholar] [CrossRef]
- Jones, F.A.; Erickson, D.L.; Bernal, M.A.; Bermingham, E.; Kress, W.J.; Herre, E.A.; Muller-Landau, H.C.; Turner, B.L. The roots of diversity: Below ground species richness and rooting distributions in a tropical forest revealed by DNA barcodes and inverse modeling. PLoS ONE 2011, 6, e24506. [Google Scholar] [CrossRef]
- Kesanakurti, P.R.; Fazekas, A.J.; Burgess, K.S.; Percy, D.M.; Newmaster, S.G.; Graham, S.; Barrett, S.C.H.; Hajibabaei, M.; Husband, B.C. Spatial patterns of plant diversity below-ground as revealed by DNA barcoding. Mol. Ecol. 2011, 20, 1289–1302. [Google Scholar] [CrossRef] [PubMed]
- Park, I.; Yang, S.; Kim, W.J.; Noh, P.; Lee, H.O.; Moon, B.C. Authentication of Herbal Medicines Dipsacus asper and Phlomoides umbrosa Using DNA Barcodes, Chloroplast Genome, and Sequence Characterized Amplified Region (SCAR) Marker. Molecules 2018, 23, 1748. [Google Scholar] [CrossRef] [Green Version]
- Wallace, L.J.; Boilard, S.M.; Eagle, S.H.; Spall, J.L.; Shokralla, S.; Hajibabaei, M. DNA barcodes for everyday life: Routine authentication of Natural Health Products. Food Res. Int. 2012, 49, 446–452. [Google Scholar] [CrossRef]
- Lutz, K.A.; Wang, W.; Zdepski, A.; Michael, T.P. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing. BMC Biotechnol. 2011, 11, 54–59. [Google Scholar] [CrossRef] [Green Version]
- Varma, A.; Padh, H.; Shrivastava, N. Plant genomic DNA isolation: An art or a science. Biotechnol. J. 2007, 2, 386–392. [Google Scholar] [CrossRef]
- Fazekas, A.J.; Burgess, K.S.; Kesanakurti, P.R.; Graham, S.; Newmaster, S.G.; Husband, B.C.; Percy, D.M.; Hajibabaei, M.; Barrett, S.C.H. Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well. PLoS ONE 2008, 3, e2802. [Google Scholar] [CrossRef] [Green Version]
- Cummings, M.P.; Nugent, J.M.; Olmstead, R.G.; Palmer, J.D. Phylogenetic analysis reveals five independent transfers of the chloroplast gene rbcL to the mitochondrial genome in angiosperms. Curr. Genet. 2003, 43, 131–138. [Google Scholar] [CrossRef] [Green Version]
- Lahaye, R.; van der Bank, M.; Bogarin, D.; Warner, J.; Pupulin, F.; Gigot, G.; Maurin, O.; Duthoit, S.; Barraclough, T.G.; Savolainen, V. DNA barcoding the floras of biodiversity hotspots. Proc. Natl. Acad. Sci. USA 2008, 105, 2923–2928. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pang, X.; Liu, C.; Shi, L.; Liu, R.; Liang, D.; Li, H.; Cherny, S.; Chen, S. Utility of the trnH–psbA Intergenic Spacer Region and Its Combinations as Plant DNA Barcodes: A Meta-Analysis. PLoS ONE 2012, 7, e48833. [Google Scholar] [CrossRef] [PubMed]
- Uncu, A.T.; Uncu, A.O. Plastid trnH–psbA intergenic spacer serves as a PCR–based marker to detect common grain adulterants of coffee (Coffea arabica L.). Food Control. 2018, 91, 32–39. [Google Scholar] [CrossRef]
- Bugini, R.; Folli, L. Masonries and stone materials of Romanesque architecture (Northern Italy). Int. J. Mason. Res. Innov. 2021, 6, 45. [Google Scholar] [CrossRef]
- Pignatti, S. Flora d’Italia; Edagricole: Bologna, Italy, 1982; Volume 1–3. [Google Scholar]
- Cicinelli, E.; Salerno, G.; Caneva, G. An assessment methodology to combine the preservation of biodiversity and cultural heritage: The San Vincenzo al Volturno historical site (Molise, Italy). Biodivers. Conserv. 2018, 27, 1073–1093. [Google Scholar] [CrossRef]
- Lucchese, F.; Pignatti, E. La vegetazione delle aree archeologiche di Roma e della Campagna Romana. Quad. Bot. Ambient. Appl. 2009, 20, 3–89. [Google Scholar]
- Caneva, G.; Langone, S.; Bartoli, F.; Cecchini, A.; Meneghini, C. Vegetation Cover and Tumuli’s Shape as Affecting Factors of Microclimate and Biodeterioration Risk for the Conservation of Etruscan Tombs (Tarquinia, Italy). Sustainability 2021, 13, 3393. [Google Scholar] [CrossRef]
- Urzì, C.; De Leo, F.; Krakova, L.; Pangallo, D.; Bruno, L. Effects of biocide treatments on the biofilm community in Domitilla’s catacombs in Rome. Sci. Total Environ. 2016, 572, 252–262. [Google Scholar] [CrossRef]
- Marzullo, M. Grotte Cornetane: Materiale e Apparato Critico per lo Studio Delle Tombe Dipinte di Tarquinia; Ledizioni Ledi Publishing: Milano, Italy, 2016. [Google Scholar]
- De Vere, N.; Rich, T.C.; Trinder, S.A.; Long, C. DNA barcoding for plants. In Plant Genotyping; Batley, J., Ed.; Humana Press: New York, NY, USA, 2014; pp. 101–118. [Google Scholar]
- Ford, C.S.; Ayres, K.L.; Toomey, N.; Haider, N.; van AlphenStahl, J.; Kelly, L.J.; Wikström, N.; Hollingsworth, P.M.; Duff, R.J.; Hoot, S.B.; et al. Selection of candidate coding DNA barcoding regions for use on land plants. Bot. J. Linn. Soc. 2009, 159, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Cuénoud, P.; Savolainen, V.; Chatrou, L.; Powell, M.; Grayer, R.J.; Chase, M.W. Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. Am. J. Bot. 2002, 89, 132–144. [Google Scholar] [CrossRef]
- Fay, M.F.; Bayer, C.; Alverson, W.S.; de Bruijn, A.Y.; Chase, M.W. Plastid rbcL sequence data indicate a close affinity between Diegodendron and Bixa. Taxon 1998, 47, 43–50. [Google Scholar] [CrossRef]
- Newmaster, S.G.; Ragupathy, S. Testing plant barcoding in a sister species complex of pantropical Acacia (Mimosoideae, Fabaceae). Mol. Ecol. Res. 2009, 9, S172–S180. [Google Scholar]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press Inc: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
- Bartolucci, F.; Peruzzi, L.; Galasso, G.; Albano, A.; Alessandrini, A.; Ardenghi, N.M.G.; Astuti, G.; Bacchetta, G.; Ballelli, S.; Banfi, E.; et al. An updated checklist of the vascular flora native to Italy. Plant Biosyst. Int. J. Deal. All Asp. Plant. Biol. 2018, 152, 179–303. [Google Scholar] [CrossRef]
- Pignatti, S.; Guarino, R.; La Rosa, M. Flora d’Italia; Edagricole: Bologna, Italy, 2017. [Google Scholar]
Tomb | Sample ID | ITS | matK | rbcL | psbA-trnH | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BLASTn Match | % | Accession Nr. | BLASTn Match | % | Accession Nr. | BLASTn Match | % | Accession Nr. | BLASTn Match | % | Accession Nr. | ||
Hunting and Fishing | H2 | Foeniculum vulgare Anethum foeniculoides Ridolfia segetum Anethum graveolens | 99.84 99.4 98.84 97.34 | EU796894 HE602455 GQ148796 GQ148794 | Foeniculum vulgar Anethum graveolens Ridolfia segetum Cuminum cyminum | 100 99.71 99.71 99.57 | MK435626 MN216674 HM850713 MG946962 | Apium graveolens Prangos trifida Foeniculum vulgare Anethum graveolens | 99.76 99.76 99.76 99.76 | NC_041087 NC_037852 KR011054 MN216674 | Foeniculum vulgare Anethum foeniculoides Ammi majus Petroselium crispum | 99.63 99.63 98.15 98.15 | HE659550 MG947083 KU530039 HM596073 |
CP01 | Foeniculum vulgare Anethum graveolens Anethum foeniculoides Ridolfia segetum | 99.54 97.24 95.50 98.84 | FJ980395 MN257763 HE602455 CG148796 | Foeniculum vulgare Anethum graveolens Cuminum cyminum Apium graveolens | 99.75 99.37 99.12 98.74 | JN894477 EU016725 MG946962 AJ429370 | Apium graveolens Prangos trifida Foeniculum vulgare Ligusticum jeholense | 99.81 99.81 99.81 99.63 | NC_041087 NC_037852 LT576823 MN652885 | Foeniculum vulgare Anethum foeniculoides Ammi majus Petroselium crispum | 99.63 99.63 98.15 98.15 | HE659550 MG947083 KU530039 HM596073 | |
CP02 | Foeniculum vulgare F. vulgare subsp. vulgare Anethum foeniculoides Ridolfia segetum | 99.18 99.36 98.99 98.34 | EU796894 MH645764 HE602455 GQ148796 | Foeniculum vulgare Anethum graveolens Cuminum cyminum Apium graveolens | 100 99.54 99.19 99.08 | MG946964 KR011055 MG946962 AJ429370 | Apium graveolens Prangos trifida Foeniculum vulgare Ligusticum jeholense | 99.46 99.46 99.46 99.28 | NC_041087 NC_037852 LT576823 MN652885 | Foeniculum vulgare Anethum foeniculoides Ammi majus Petroselium crispum | 99.63 99.63 98.15 98.15 | HE659550 MG947083 KU530039 HM596073 | |
Lotus Flower | C2 | Centaurea aspera Centaurea napifolia Centaurea involucrata Centaurea pullata | 99.54 98.63 96.35 96.12 | DQ319086 DQ319135 DQ319123 DQ319154 | Centaurea diffusa Carthamus tinctorius Carthamus oxyacantha Centaurea nigra | 99.76 99.63 99.63 99.75 | KJ690264 HM989751 MG946998 EU385332 | Carthamus oxyacantha Carthamus tinctorius Centaurea involucrata Centaurea melitensis | 99.44 99.44 99.44 99.44 | MG946886 KX822074 KC589820 KC589820 | Centaurea aspera subsp.pseudoaerocephala Centaurea jacea Centaurea bracteata Cirsium vulgare | 100 99.13 98.47 98.26 | DQ846283 HE966554 FR865076 KY562585 |
C1 | Reseda lutea R. lutea subsp. lutea Reseda crystallina Reseda lanceolata | 99.38 99.38 98.55 96.69 | KR936125 DQ987095 DQ987088 DQ987099 | Reseda crystallina Reseda lutea Ochradenus baccatus Caylusea hexagyna | 100 99.73 98.64 97.68 | FJ212200 FM179932 MT948189 FJ212207 | Oligomeris linifolia Ochradenus arabicus Reseda lutea Reseda crystallina | 99.61 99.61 100 100 | MH185895 KX015754 KF724303 FJ212212 | R. lutea subsp. lutea Ochradenus baccatus Caylusa hexagena | 99.69 90.99 87.21 | HE966773 MT948189 MT948187 | |
LT01 | Centaurea aspera Centaurea napifolia Centaurea involucrata Centaurea pullata | 99.53 98.11 95.74 95.27 | DQ319086 DQ319135 DQ319123 DQ319154 | Centaurea diffusa Centaurea nigra Centaurea calcitrapa Centaurea scabiosa | 99.76 99.75 99.75 99.75 | KJ690264 JN895178 MK925659 KT249946 | Carthamusoxyacantha Carthamus tinctorius Centaurea involucrata Centaurea melitensis | 99.67 99.67 99.67 99.67 | MG946886 KX822074 KC589820 KC589820 | Centaurea aspera subsp.pseudoaerocephala Centaurea jacea Centaurea bracteata Cirsium vulgare | 100 99.13 98.48 98.28 | DQ846283 HE966554 FR865076 KY562585 | |
LT3 | Centaurea aspera Centaurea napifolia Centaurea involucrata Centaurea pullata | 99.37 97.95 95.58 95.10 | DQ319086 DQ319135 DQ319123 DQ319154 | Centaurea diffusa Carthamus tinctorius Carthamus oxyacantha Centaurea nigra | 99.76 99.63 99.63 99.75 | KJ690264 MG946998 KX822074 JN895178 | C. oxyacantha Carthamus tinctorius Centaurea involucrata Centaurea melitensis | 99.70 99.70 99.70 99.70 | MG946886 KX822074 KC589820 KC589820 | Centaurea aspera subsp.pseudoaerocephala Centaurea jacea Centaurea bracteata Cirsium vulgare | 100 99.13 98.47 98.26 | DQ846283 HE966554 FR865076 MN275426 | |
Moretti | M1 | Reseda lutea R. lutea subsp. lutea Reseda crystallina Reseda lanceolata | 99.36 99.38 98.52 95.89 | KR936125 DQ987095 DQ987088 DQ987099 | Reseda crystallina Reseda lutea Ochradenus baccatus Caylusea hexagyna | 100 99.73 98.64 97.68 | FJ212200 FM179932 MT948189 FJ212207 | Oligomeris linifolia Ochradenus arabicus Reseda lutea Reseda crystallina | 99.42 99.42 99.80 99.80 | MH185895 KX015754 KF724303 FJ212212 | Reseda lutea subsp. lutea Ochradenus baccatus Caylusea hexagena | 100 91.28 87.46 | HE966773 MT948189 MT948187 |
M2 | Echium italicum E. italicum subsp. italicum. Echium glomeratum Echium asperrimum | 99.48 99.18 99.01 98.84 | LC426085 MK321757 MK311754 MK321749 | Echium italicum Echium vulgare Echium plantagineum Echium angustifolium | 99.72 99.44 99.44 99.15 | EU599699 MK520026 HM850866 EU599695 | E. vulgare subsp vulgare Echium italicum Echium plantagineum Moltkiopsis ciliata | 100 100 99.76 99.76 | HE963457 EU599874 MN157267 KX282888 | Echium italicum Echium plantagineum Echium vulgare | 98.58 98.53 98.28 | LC426222 MG598304 FJ8273162 | |
Old man | D4 | Sinapis alba Eruca vesicaria Rytidocarpus moricandioides | 99.53 92.72 93.49 | FJ609733 LC090005 MF192787 | SEQUENCING FAIL | SEQUENCING FAIL | Sinapis alba Sinapis arvensis Trachystoma ballii Erucastrum cardaminoides | 99.46 90.96 90.91 94.00 | NC045948 KU050690 AB669922 KJ685143 | ||||
Sculptures | F1 | Ascom. CCFEE 6623 Ascom. CCFEE 6662 Plectospherella sp. Acremonium nepalense Ascom. CCFEE 6624 | 99.29 98.10 98.10 97.87 97.87 | MT472274 MT472276 KY670795 HG008742 MT472275 | PCR FAIL | Brassica juncea Brassica nigra Brassica carinata Raphanus sativus Brassica oleracea | 99.67 99.67 99.67 99.35 99.35 | MG872827 AP012989 JF920287 MN056359 LR031888 | SEQUENCING FAIL | ||||
F3 | SEQUENCING FAIL | Verbascum thapsus Verbascum carmanicum Verbascum kermanense Verbascum gabrieliae | 99.29 99.19 99.19 99.19 | JN893995 MH885332 MH885331 MH885333 | Verbascum thapsus Verbascum thapsus Buddleja colvilei Phryma leptostachya | 99.82 100 99.08 99.08 | KT178130 KJ841648 NC_042766 NC_042727 | Verbascum sinuatum Verbascum virgatum Verbascum chinense Verbascum thapsus | 100 99.73 98.50 98.48 | HE699541 KR361652 MT610040 MF348529 | |||
Bartoccini | 02 | Echium italicum E. italicum subsp. italicum Echium glomeratum Echium asperrimum | 99.34 99.17 99.17 99.00 | MK321757 LC426085 MK321754 MK321749 | Echium italicum Echium vulgare Echium plantagineum Echium angustifolium | 99.63 99.45 99.45 99.26 | EU599699 MK520026 HM850866 EU599695 | Echium vulgare Echium plantagineum Lobostemon fruticosus Echiostachic incanus | 99.53 99.69 99.54 99.54 | KF158087 HM849964 AM234929 AM234927 | Echium italicum Echium plantagineum Echium vulgare | 98.58 98.53 98.28 | LC426222 MG598304 FJ8273162 |
5512 | 01 | Angelica cartilagino-marginata Peucedanum japonicum Seseli tortuosum Ledebouriella seseloides | 97.36 96.93 99.83 96.47 | AY548222 KX757777 MG697155 KX757775 | Saposhnikovia divaricata Ledebouriella seseloides Peucedanum japonicum Seseli montanum | 99.66 99.66 99.32 99.43 | MK435638 MN539269 KU866531 KM035851 | Ligusticum thomsonii Seseli montanum Peucedanum praeruptorum Saposhnikovia divaricata | 100 100 99.81 99.81 | MT409619 KM035851 MN016968 MN539269 | Paucedanum terebinthaceum Paucedanum praeruptorum Paucedanum ampliatum Angelica polumorpha | 94.35 93.95 95.19 93.38 | MT671397 MN016968 JN046213 NC041580 |
Locus | Primer Name | F/R | Sequences 5′-3′ | Annealing Temperature | References |
---|---|---|---|---|---|
matK | matK2.1a | F | ATCCATCTGGAAATCTTAGTTC | 50 °C | [69] |
matK-3FKIM-r | R | CGTACAGTACTTTTGTGTTTACGAG | |||
XF | F | TAATTTACGATCAATTCATTC | 50 °C | [70] | |
5R | R | GTTCTAGCACAAGAAAGTCG | |||
390F | F | CGATCTATTCATTCAATATTTC | 53 °C | [71] | |
1326r | R | TCTAGCACACGAAAGTCGAAGT | |||
rbcL | rbcLa-F | F | ATGTCACCACAAACAGAGACTAAAGC | 50 °C | [69] |
rbcLr590 | R | AGTCCACCGCGTAGACATTCAT | |||
1F | F | ATGTCACCACAAACAGAAAC | 50 °C | [72] | |
724R | R | TCGCATGTACCTGCAGTAGC | |||
psbA-trnH | psbA | F | GTTATGCATGAACGTAATGCTC | 53 °C | [73] |
trnH | R | CGCGCATGGTGGATTCACAATCC | |||
ITS | ITS5 | F | GGAAGTAAAAGTCGTAACAAGG | 55 °C | [74] |
ITS3 | F | GCATCGATGAAGAACGCAGC | |||
ITS4 | R | TCCTCCGCTTATTGATATGC | |||
ITS2 | R | GCTGCGTTCTTCATCGATGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Isola, D.; Bartoli, F.; Langone, S.; Ceschin, S.; Zucconi, L.; Caneva, G. Plant DNA Barcode as a Tool for Root Identification in Hypogea: The Case of the Etruscan Tombs of Tarquinia (Central Italy). Plants 2021, 10, 1138. https://doi.org/10.3390/plants10061138
Isola D, Bartoli F, Langone S, Ceschin S, Zucconi L, Caneva G. Plant DNA Barcode as a Tool for Root Identification in Hypogea: The Case of the Etruscan Tombs of Tarquinia (Central Italy). Plants. 2021; 10(6):1138. https://doi.org/10.3390/plants10061138
Chicago/Turabian StyleIsola, Daniela, Flavia Bartoli, Simone Langone, Simona Ceschin, Laura Zucconi, and Giulia Caneva. 2021. "Plant DNA Barcode as a Tool for Root Identification in Hypogea: The Case of the Etruscan Tombs of Tarquinia (Central Italy)" Plants 10, no. 6: 1138. https://doi.org/10.3390/plants10061138
APA StyleIsola, D., Bartoli, F., Langone, S., Ceschin, S., Zucconi, L., & Caneva, G. (2021). Plant DNA Barcode as a Tool for Root Identification in Hypogea: The Case of the Etruscan Tombs of Tarquinia (Central Italy). Plants, 10(6), 1138. https://doi.org/10.3390/plants10061138