High Antioxidant Ability Confer Resistance to Atrazine in Commelina communis L.
Abstract
:1. Introduction
2. Results
2.1. Responses of Commelina communis L. to Atrazine
2.2. PsbA Gene Sequencing
2.3. Effect of Atrazine Stress on Lipid Peroxidation
2.4. Antioxidant Enzyme Activity under Atrazine Stress
3. Discussion
4. Materials and Methods
4.1. Chemical Reagents
4.2. Plant Materials and Growth Condition
4.3. The Responses of Commelina communis L. to Atrazine
4.4. psbA Gene Clone
4.5. psbA Gene Sequencing
4.6. Malondialdehyde Content Assay
4.7. The Assay of Antioxidant Enzyme Activities
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yang, J.; Yu, H.Y.; Li, X.J.; Dong, J.G. Genetic diversity and population structure of Commelina communis in China based on simple sequence repeat markers. J. Integr. Agric. 2018, 17, 2292–2301. [Google Scholar] [CrossRef]
- Yang, J.; Yu, H.Y.; Li, X.J.; Dong, J.G. Tolerance of different geographical populations of Commelina communis L. to atrazine. Plant Prot. 2019, 45, 174–180. [Google Scholar]
- Solomon, K.P.; Baker, D.B.; Richards, P.; Dixon, K.P.; Klaine, S.J.; La Point, T.W.; Kendall, R.J.; Giddings, J.M.; Giesy, J.P.; Hall, L.W.J. Ecological risk assessment of atrazine in North American surface waters. Environ. Toxicol. Chem. 1996, 15, 31–76. [Google Scholar] [CrossRef]
- Albright, V.C., III; Murphy, I.J.; Anderson, J.A.; Coats, J.R. Fate of atrazine in switchgrass-soil column system. Chemosphere 2013, 90, 1847–1853. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fuerst, E.P.; Norman, M.A. Interactions of herbicides with photosynthetic electron transport. Weed Sci. 1991, 39, 458–464. [Google Scholar] [CrossRef]
- Hess, F.D. Light-dependent herbicides: An overview. Weed Sci. 2000, 48, 160–170. [Google Scholar] [CrossRef]
- Ramel, F.; Sulmon, C.; Cabello-Hurtado, F.; Taconnat, L.; Martin-Magniette, M.L.; Renou, J.P.; Amrani, A.E.; Couée, I.; Gouesbet, G. Genome-wide interacting effects of sucrose and herbicide-mediated stress in Arabidopsis thaliana: Novel insights into atrazine toxicity and sucrose-induced tolerance. BMC Genom. 2007, 8, 450. [Google Scholar] [CrossRef] [Green Version]
- Si, Y.B.; Meng, X.M. Advance in environmental fate and ecological remediation of the herbicide atrazine. J. Anhui Agric. Univ. 2007, 34, 451–455. [Google Scholar]
- Ryan, G.F. Resistance of common groundsel to simazine and atrazine. Weed Sci. 1970, 18, 614–616. [Google Scholar] [CrossRef]
- Heap, I.M. International Survey of Herbicide-Resistant Weeds. Available online: http://www.weedscience.org (accessed on 1 July 2021).
- Svyantek, A.W.; Aldahir, P.; Chen, S.; Flessner, M.L.; McCullough, P.E.; Sidhu, S.S.; McElroy, J.S. Target and nontarget resistance mechanisms induce annual Bluegrass (Poa annua) resistance to atrazine, amicarbazone, and diuron. Weed Technol. 2016, 30, 773–782. [Google Scholar] [CrossRef]
- Hirschberg, J.; Mcintosh, L. Molecular basis of herbicide resistance in Amaranthus hybridus. Science 1983, 222, 1346–1349. [Google Scholar] [CrossRef]
- Foes, M.J.; Vigue, G.; Stoller, E.W.; Wax, L.M.; Tranel, P.J. A kochia (Kochia scoparia) biotype resistant to triazine and ALS-inhibiting herbicides. Weed Sci. 1999, 47, 20–27. [Google Scholar] [CrossRef]
- Powles, S.B.; Yu, Q. Evolution in action: Plants resistant to herbicides. Annu. Rev. Plant Biol. 2010, 61, 317–347. [Google Scholar] [CrossRef] [Green Version]
- Mengistu, L.W.; Mueller-Warrant, G.W.; Liston, A.; Barker, R.E. psbA Mutation (valine219 to isoleucine) in Poa annua resistant to metribuzin and diuron. Pest Manag. Sci. 2000, 56, 209–217. [Google Scholar] [CrossRef]
- Gronwald, J.W.; Andersen, R.N.; Yee, C. Atrazine resistance in velvetleaf (Abutilon theophrasti) due to enhanced atrazine detoxification. Pestic. Biochem. Physiol. 1989, 34, 149–163. [Google Scholar] [CrossRef]
- Ma, R.; Kaundun, S.S.; Tranel, P.J.; Riggins, C.W.; McGinness, D.L.; Hager, A.G.; Hawkes, T.; McIndoe, E.; Riechers, D.E. Distinct detoxification mechanisms confer resistance to mesotrione and atrazine in a population of waterhemp. Plant Physiol. 2013, 163, 363–377. [Google Scholar] [CrossRef] [Green Version]
- Foyer, C.H.; Lelandais, M.; Kunert, K.H. Photooxidative stress in plants. Physiol. Plant. 1994, 92, 696–717. [Google Scholar] [CrossRef]
- Nemat Alla, M.M.; Hassan, N.M. Changes of antioxidants levels in two maize lines following atrazine treatments. Plant Physiol. Biochem. 2006, 44, 202–210. [Google Scholar] [CrossRef]
- Wang, M.; Zhou, Q. Effects of herbicide chlorimuron-ethyl on physiological mechanisms in wheat (Triticum aestivum). Ecotoxicol. Environ. Saf. 2006, 64, 190–197. [Google Scholar] [CrossRef] [PubMed]
- Alscher, R.G.; Erturk, N.; Heath, L.S. Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J. Exp. Bot. 2002, 53, 1331–1341. [Google Scholar] [CrossRef] [PubMed]
- Mi, L.; Niu, X.; Lu, M.; Ma, J.; Wu, J.; Zhou, X. Phosphine-induced physiological and biochemical responses in rice seedlings. Chemosphere 2014, 100, 77–82. [Google Scholar] [CrossRef]
- Song, N.H.; Yin, X.L.; Chen, G.F.; Yang, H. Biological responses of wheat (Triticum aestivum) plants to the herbicide chlorotoluron in soils. Chemosphere 2007, 68, 1779–1787. [Google Scholar] [CrossRef]
- Tarchoune, I.; Sgherri, C.; Izzo, R.; Lachaal, M.; Ouerghi, Z.; Navari-Izzo, F. Antioxidative responses of Ocimum basilicum to sodium chloride or sodium sulphate salinization. Plant Physiol. Biochem. 2010, 48, 772–777. [Google Scholar] [CrossRef]
- Xue, Y.J.; Tao, L.; Yang, Z.M. Aluminum-induced cell wall peroxidase activity and lignin synthesis are differentially regulated by jasmonate and nitric oxide. J. Agric. Food Chem. 2008, 56, 9676–9684. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Yang, H. Prometryne-induced oxidative stress and impact on antioxidant enzymes in wheat. Ecotoxicol. Environ. Saf. 2009, 72, 1687–1693. [Google Scholar] [CrossRef] [PubMed]
- Erinle, K.O.; Jiang, Z.; Li, M.Y.; Su, G.X.; Ma, B.B.; Ma, Y.H.; Zhang, Y. Oxidative stress response induced in an atrazine phytoremediating plant: Physiological responses of Pennisetum glaucum to high atrazine concentrations. Int. J. Phytorem. 2016, 18, 1187–1194. [Google Scholar] [CrossRef]
- Zhao, N.; Yan, Y.; Luo, Y.; Zou, N.; Liu, W.; Wang, J. Unravelling mesosulfuron-methyl phytotoxicity and metabolism-based herbicide resistance in Alopecurus aequalis: Insight into regulatory mechanisms using proteomics. Sci. Total Environ. 2019, 670, 486–497. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.; Ma, B.B.; Erinle, K.O.; Cao, B.; Liu, X.X.; Ye, S.Y.; Zhang, Y. Enzymatic antioxidant defense in resistant plant: Pennisetum americanum (L.) K. Schum during long-term atrazine exposure. Pestic. Biochem. Physiol. 2016, 133, 59–66. [Google Scholar] [CrossRef] [PubMed]
- Shaaltiel, Y.; Gressel, J. Multienzyme oxygen radical detoxifying system correlated with paraquat resistance in Conyza bonariensis. Pestic. Biochem. Physiol. 1986, 26, 22–28. [Google Scholar] [CrossRef]
- Ulloa, S.M.; Owen, M.D.K. Response of Asiatic dayflower (Commelina communis) to glyphosate and alternatives in Soybean. Weed Sci. 2009, 57, 74–80. [Google Scholar] [CrossRef]
- Su, S. Problems with herbicide use in northeast China. Chin. J. Pestic. 2004, 2, 53–55. [Google Scholar]
- Bettini, P.; McNally, S.; Sevignac, M.; Darmency, H.; Gasquez, J.; Dron, M. Atrazine resistance in Chenopodium album. Plant Physiol. 1987, 84, 1442–1446. [Google Scholar] [CrossRef] [Green Version]
- Dang, H.T.; Malone, J.M.; Boutsalis, P.; Gill, G.; Preston, C. Identification of a target-site mutation conferring resistance to triazine herbicides in oriental mustard (Sisymbrium orientale L.) from Australia. Weed Biol. Manag. 2017, 17, 153–160. [Google Scholar] [CrossRef]
- Diebold, R.S.; McNaughton, K.E.; Lee, E.A.; Tardif, F.J. Multiple resistance to imazethapyr and atrazine in Powell amaranth (Amaranthus powellii). Weed Sci. 2003, 51, 312–318. [Google Scholar] [CrossRef]
- Chen, J.; Shiyab, S.; Han, F.X.; Monts, D.L.; Waggoner, C.A.; Yang, Z.M.; Su, Y. Bioaccumulation and physiological effects of mercury in Pteris vittata and Nephrolepis exaltata. Ecotoxicology 2009, 18, 110–121. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.L.; Cui, J.; Tao, L.; Yang, H. Fluroxypyr triggers oxidative damage by producing superoxide and hydrogen peroxide in rice (Oryza sativa). Ecotoxicology 2010, 19, 124–132. [Google Scholar] [CrossRef] [PubMed]
- Akbulut, G.B.; Yigit, E. The changes in some biochemical parameters in Zea mays cv. “Martha F1” treated with atrazine. Ecotoxicol. Environ. Saf. 2010, 73, 1429–1432. [Google Scholar] [CrossRef]
- Mishra, S.; Srivastava, S.; Tripathi, R.D.; Kumar, R.; Seth, C.S.; Gupta, D.K. Lead detoxification by coontail (Ceratophyllum demersum L.) involves induction of phytochelatins and antioxidant system in response to its accumulation. Chemosphere 2006, 65, 1027–1039. [Google Scholar] [CrossRef] [PubMed]
- Salin, M.L. Toxic oxygen spcies and protective systems of the chloroplast. Physiol. Plant. 1987, 72, 681–689. [Google Scholar] [CrossRef]
- Zhang, J.J.; Lu, Y.C.; Zhang, J.J.; Tan, L.R.; Yang, H. Accumulation and toxicological response of atrazine in rice crops. Ecotoxicol. Environ. Saf. 2014, 102, 105–112. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Zhu, L.S.; Wang, J.H.; Wang, J.; Xie, H. The genotoxic and cytotoxic effects of 1-butyl-3-methylimidazolium chloride in soil on Vicia faba seedlings. J. Hazard. Mater. 2015, 285, 27–36. [Google Scholar] [CrossRef] [PubMed]
- Seefeldt, S.S.; Jensen, J.E.; Fuerst, E.P. Log-logistic analysis of herbicide dose-response relationship. Weed Technol. 1995, 9, 218–227. [Google Scholar] [CrossRef]





| Primer Name | Sequence (5′-3′) |
|---|---|
| 1F | ATCGGATGGTTCGGTGTT |
| 1R | GAGGGAAGTTGTGAGCATTACG |
| 2F | CTATTGAGATTGGTTGACATT |
| 2R | TGGTTTATTCCGCAGCAGCA |
| 5′SP1 | GCTAAGTTCCCACTCACGACCCAT |
| 3′SP1 | ACAGAAAACGAGTCCGCAAATGA |
| 5′SP2 | ACCGCCGTTGTATAACCACTCATC |
| 3′SP2 | GTTTCAACAACTCTCGTTCTTTACAC |
| 5′SP3 | AGGAATAATGGCACCAGAGATAA |
| 3′SP3 | CCAATCTGTAGTTGATAGTCAGGGGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, J.; Yu, H.; Cui, H.; Chen, J.; Li, X. High Antioxidant Ability Confer Resistance to Atrazine in Commelina communis L. Plants 2021, 10, 2685. https://doi.org/10.3390/plants10122685
Yang J, Yu H, Cui H, Chen J, Li X. High Antioxidant Ability Confer Resistance to Atrazine in Commelina communis L. Plants. 2021; 10(12):2685. https://doi.org/10.3390/plants10122685
Chicago/Turabian StyleYang, Juan, Haiyan Yu, Hailan Cui, Jingchao Chen, and Xiangju Li. 2021. "High Antioxidant Ability Confer Resistance to Atrazine in Commelina communis L." Plants 10, no. 12: 2685. https://doi.org/10.3390/plants10122685
APA StyleYang, J., Yu, H., Cui, H., Chen, J., & Li, X. (2021). High Antioxidant Ability Confer Resistance to Atrazine in Commelina communis L. Plants, 10(12), 2685. https://doi.org/10.3390/plants10122685

