Pulmozyme Ameliorates LPS-Induced Lung Fibrosis but Provokes Residual Inflammation by Modulating Cell-Free DNA Composition and Controlling Neutrophil Phenotype
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Fibrosis Induction and Design of Animal Experiment
2.3. Collection and Analysis of the Bronchoalveolar Lavage Fluid (BALF)
2.4. Blood Serum Preparation
2.5. Isolation of Spleen Neutrophils
2.6. Isolation of Total RNA
2.7. cfDNA Isolation
2.8. Assessment of DNase Activity in Blood Serum and BALF
2.9. qPCR Analysis of Quantitative Content of Nuclear and Mitochondrial DNA in cfDNA
2.10. RT-qPCR Analysis of Expression of Genes Characterizing the Pro- and Anti-Inflammatory Phenotype of Neutrophils
2.11. Histology and Immunohistochemistry
2.12. Statistical Analysis
3. Results
3.1. The Effect of Pulmozyme on the Development of Inflammation and Fibrosis in LPS-Induced Mouse Model
3.2. The Effect of Pulmozyme on the Concentration and Composition of cfDNA and DNase Activity in Blood Serum and BALF of Mice with LPS-Induced Inflammation/Fibrosis
3.3. Effect of Pulmozyme on the Neutrophil Profile in the Spleen of Mice with LPS-Induced Inflammation/Fibrosis
4. Discussion
5. Conclusions
Limitations
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Savin, I.A.; Zenkova, M.A.; Sen’kova, A.V. Pulmonary Fibrosis as a Result of Acute Lung Inflammation: Molecular Mechanisms, Relevant In Vivo Models, Prognostic and Therapeutic Approaches. Int. J. Mol. Sci. 2022, 23, 14959. [Google Scholar] [CrossRef] [PubMed]
- Jannini-Sá, Y.A.P.; Creyns, B.; Hogaboam, C.M.; Parks, W.C.; Hohmann, M.S. Macrophages in Lung Repair and Fibrosis. Results Probl. Cell Differ. 2024, 74, 257–290. [Google Scholar] [CrossRef] [PubMed]
- Tomasek, J.J.; Gabbiani, G.; Hinz, B.; Chaponnier, C.; Brown, R.A. Myofibroblasts and mechano: Regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 2002, 3, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Kolahian, S.; Fernandez, I.E.; Eickelberg, O.; Hartl, D. Immune mechanisms in pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 2016, 55, 309–322. [Google Scholar] [CrossRef]
- Nathan, C. Neutrophils and immunity: Challenges and opportunities. Nat. Rev. Immunol. 2006, 6, 173–182. [Google Scholar] [CrossRef]
- Gregory, A.D.; Kliment, C.R.; Metz, H.E.; Kim, K.-H.; Kargl, J.; Agostini, B.A.; Crum, L.T.; Oczypok, E.A.; Oury, T.A.; Houghton, A.M. Neutrophil elastase promotes myofibroblast differentiation in lung fibrosis. J. Leukoc. Biol. 2015, 98, 143–152. [Google Scholar] [CrossRef]
- Brinkmann, V.; Reichard, U.; Goosmann, C.; Fauler, B.; Uhlemann, Y.; Weiss, D.S.; Weinrauch, Y.; Zychlinsky, A. Neutrophil extracellular traps kill bacteria. Science 2004, 303, 1532–1535. [Google Scholar] [CrossRef]
- Fuchs, T.A.; Abed, U.; Goosmann, C.; Hurwitz, R.; Schulze, I.; Wahn, V.; Weinrauch, Y.; Brinkmann, V.; Zychlinsky, A. Novel cell death program leads to neutrophil extracellular traps. J. Cell Biol. 2007, 176, 231–241. [Google Scholar] [CrossRef]
- Pruchniak, M.P.; Kotula, I.; Manda-Handzlik, A. Neutrophil extracellular traps (Nets) impact upon autoimmune disorders. Cent. Eur. J. Immunol. 2015, 40, 217–224. [Google Scholar] [CrossRef]
- Bosmann, M.; Ward, P.A. Protein-based therapies for acute lung injury: Targeting neutrophil extracellular traps. Expert Opin. Ther. Targets 2014, 18, 703–714. [Google Scholar] [CrossRef]
- Keir, H.R.; Chalmers, J.D. Neutrophil extracellular traps in chronic lung disease: Implications for pathogenesis and therapy. Eur. Respir. Rev. 2022, 31, 210241. [Google Scholar] [CrossRef] [PubMed]
- Chrysanthopoulou, A.; Mitroulis, I.; Apostolidou, E.; Arelaki, S.; Mikroulis, D.; Konstantinidis, T.; Sivridis, E.; Koffa, M.; Giatromanolaki, A.; Boumpas, D.T.; et al. Neutrophil extracellular traps promote differentiation and function of fibroblasts. J. Pathol. 2014, 233, 294–307. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Shu, X.; Tian, X.; Chen, F.; Lu, X.; Wang, G. Enhanced formation and impaired degradation of neutrophil extracellular traps in dermatomyositis and polymyositis: A potential contributor to interstitial lung disease complications. Clin. Exp. Immunol. 2014, 177, 134–141. [Google Scholar] [CrossRef] [PubMed]
- Roesch, E.A.; Rahmaoui, A.; Lazarus, R.A.; Konstan, M.W. The continuing need for dornase alfa for extracellular airway DNA hydrolysis in the era of CFTR modulators. Expert Rev. Respir. Med. 2024, 18, 677–691. [Google Scholar] [CrossRef]
- Herranz, R.; Oto, J.; Hueso, M.; Plana, E.; Cana, F.; Castaño, M.; Cordón, L.; Ramos-Soler, D.; Bonanad, S.; Vera-Donoso, C.D.; et al. Bladder cancer patients have increased NETosis and impaired DNaseI-mediated NET degradation that can be therapeutically restored in vitro. Front. Immunol. 2023, 14, 1171065. [Google Scholar] [CrossRef]
- Weber, A.G.; Chau, A.S.; Egeblad, M.; Barnes, B.J.; Janowitz, T. Nebulized in-line endotracheal dornase alfa and albuterol administered to mechanically ventilated COVID-19 patients: A case series. Mol. Med. 2020, 26, 91. [Google Scholar] [CrossRef]
- Wagener, J.S.; Kupfer, O. Dornase alfa (Pulmozyme). Curr. Opin. Pulm. Med. 2012, 18, 609–614. [Google Scholar] [CrossRef]
- Sounbuli, K.; Alekseeva, L.A.; Markov, O.V.; Mironova, N.L. A Comparative Study of Different Protocols for Isolation of Murine Neutrophils from Bone Marrow and Spleen. Int. J. Mol. Sci. 2023, 24, 17273. [Google Scholar] [CrossRef]
- Filatova, A.A.; Alekseeva, L.A.; Sen’kova, A.V.; Savin, I.A.; Sounbuli, K.; Zenkova, M.A.; Mironova, N.L. Tumor- and Fibroblast-Derived Cell-Free DNAs Differently Affect the Progression of B16 Melanoma In Vitro and In Vivo. Int. J. Mol. Sci. 2024, 25, 5304. [Google Scholar] [CrossRef]
- Lawrence, S.M.; Corriden, R.; Nizet, V. How Neutrophils Meet Their End. Trends Immunol. 2020, 41, 531–544. [Google Scholar] [CrossRef]
- Lewis, S.M.; Williams, A.; Eisenbarth, S.C. Structure and function of the immune system in the spleen. Sci. Immunol. 2019, 4, eaau6085. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Kim, S.J.; Lei, Y.; Wang, S.; Wang, H.; Huang, H.; Zhang, H.; Tsung, A. Neutrophil extracellular traps in homeostasis and disease. Signal Transduct. Target. Ther. 2024, 9, 235. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.-R.; Liu, S.-S.; Min, J.-L.; Yin, M.; Zhang, Y.; Zhang, Y.; Tang, X.-N.; Li, X.; Liu, S.-S. CCL17 drives fibroblast activation in the progression of pulmonary fibrosis by enhancing the TGF-β/Smad signaling. Biochem. Pharmacol. 2023, 210, 115475. [Google Scholar] [CrossRef] [PubMed]
- Sounbuli, K.; Mironova, N.; Alekseeva, L. Diverse Neutrophil Functions in Cancer and Promising Neutrophil-Based Cancer Therapies. Int. J. Mol. Sci. 2022, 23, 15827. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Antoine, D.J.; Andersson, U.; Tracey, K.J. The many faces of HMGB1: Molecular structure-functional activity in inflammation, apoptosis, and chemotaxis. J. Leukoc. Biol. 2013, 93, 865. [Google Scholar] [CrossRef] [PubMed]
- Hung, C. Origin of Myofibroblasts in Lung Fibrosis. Curr. Tissue Microenviron. Rep. 2020, 1, 155–162. [Google Scholar] [CrossRef]
- Ishikawa, G.; Liu, A.; Herzog, E.L. Evolving Perspectives on Innate Immune Mechanisms of IPF. Front. Mol. Biosci. 2021, 8, 676569. [Google Scholar] [CrossRef]
- Ocuin, L.M.; Bamboat, Z.M.; Balachandran, V.P.; Cavnar, M.J.; Obaid, H.; Plitas, G.; DeMatteo, R.P. Neutrophil IL-10 suppresses peritoneal inflammatory monocytes during polymicrobial sepsis. J. Leukoc. Biol. 2011, 89, 423–432. [Google Scholar] [CrossRef]
- Boari, J.T.; Vesely, M.C.A.; Bermejo, D.A.; Ramello, M.C.; Montes, C.L.; Cejas, H.; Gruppi, A.; Rodríguez, E.V.A. IL-17RA Signaling Reduces Inflammation and Mortality during Trypanosoma cruzi Infection by Recruiting Suppressive IL-10-Producing Neutrophils. PLOS Pathog. 2012, 8, e1002658. [Google Scholar] [CrossRef]
- Woodfin, A.; Beyrau, M.; Voisin, M.B.; Ma, B.; Whiteford, J.R.; Hordijk, P.L.; Hogg, N.; Nourshargh, S. ICAM-1–expressing neutrophils exhibit enhanced effector functions in murine models of endotoxemia. Blood 2015, 127, 898. [Google Scholar] [CrossRef]
- Ardi, V.C.; Van den Steen, P.E.; Opdenakker, G.; Schweighofer, B.; Deryugina, E.I.; Quigley, J.P. Neutrophil MMP-9 Proenzyme, Unencumbered by TIMP-1, Undergoes Efficient Activation in Vivo and Catalytically Induces Angiogenesis via a Basic Fibroblast Growth Factor (FGF-2)/FGFR-2 Pathway. J. Biol. Chem. 2009, 284, 25854. [Google Scholar] [CrossRef] [PubMed]
- Ardi, V.C.; Kupriyanova, T.A.; Deryugina, E.I.; Quigley, J.P. Human neutrophils uniquely release TIMP-free MMP-9 to provide a potent catalytic stimulator of angiogenesis. Proc. Natl. Acad. Sci. USA 2007, 104, 20262. [Google Scholar] [CrossRef] [PubMed]
- Chakrabarti, S.; Patel, K.D. Matrix Metalloproteinase-2 (MMP-2) and MMP-9 in Pulmonary Pathology. Exp. Lung Res. 2005, 31, 599–621. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Gauthier, A.; Daley, L.A.; Dial, K.; Wu, J.; Woo, J.; Lin, M.; Ashby, C.; Mantell, L.L. The Role of HMGB1, a Nuclear Damage-Associated Molecular Pattern Molecule, in the Pathogenesis of Lung Diseases. Antioxid. Redox Signal. 2019, 31, 954. [Google Scholar] [CrossRef]
- Scapini, P.; Calzetti, F.; Cassatella, M.A. On the detection of neutrophil-derived vascular endothelial growth factor (VEGF). J. Immunol. Methods 1999, 232, 121–129. [Google Scholar] [CrossRef]
- Catherine, J.; Roufosse, F. What does elevated TARC/CCL17 expression tell us about eosinophilic disorders? Semin. Immunopathol. 2021, 43, 439. [Google Scholar] [CrossRef]
- Chernikov, I.V.; Staroseletz, Y.Y.; Tatarnikova, I.S.; Sen’kova, A.V.; Savin, I.A.; Markov, A.V.; Logashenko, E.B.; Chernolovskaya, E.L.; Zenkova, M.A.; Vlassov, V.V. siRNA-Mediated Timp1 Silencing Inhibited the Inflammatory Phenotype during Acute Lung Injury. Int. J. Mol. Sci. 2023, 24, 1641. [Google Scholar] [CrossRef]
- Sen’kova, A.V.; Savin, I.A.; Odarenko, K.V.; Salomatina, O.V.; Salakhutdinov, N.F.; Zenkova, M.A.; Markov, A.V. Protective effect of soloxolone derivatives in carrageenan- and LPS-driven acute inflammation: Pharmacological profiling and their effects on key inflammation-related processes. Biomed. Pharmacother. 2023, 159, 114231. [Google Scholar] [CrossRef]
- Sen’kova, A.V.; Bishani, A.; Savin, I.A.; Zenkova, M.A.; Chernolovskaya, E.L. Effect of immunostimulatory RNA on the fibrosis development in Bleomycin- or LPS-induced mouse models. Biochimie 2024, 229, 9–18. [Google Scholar] [CrossRef]
- Yan, S.; Li, M.; Liu, B.; Ma, Z.; Yang, Q. Neutrophil extracellular traps and pulmonary fibrosis: An update. J. Inflamm. 2023, 20, 2. [Google Scholar] [CrossRef]
- Zhang, S.; Jia, X.; Zhang, Q.; Zhang, L.; Yang, J.; Hu, C.; Shi, J.; Jiang, X.; Lu, J.; Shen, H. Neutrophil extracellular traps activate lung fibroblast to induce polymyositis-related interstitial lung diseases via TLR9-miR-7-Smad2 pathway. J. Cell. Mol. Med. 2020, 24, 1658–1669. [Google Scholar] [CrossRef] [PubMed]
- Lachowicz-Scroggins, M.E.; Dunican, E.M.; Charbit, A.R.; Raymond, W.; Looney, M.R.; Peters, M.C.; Gordon, E.D.; Woodruff, P.G.; Lefrançais, E.; Phillips, B.R.; et al. Extracellular DNA, neutrophil extracellular traps, and inflammasome activation in severe asthma. Am. J. Respir. Crit. Care Med. 2019, 199, 1076–1085. [Google Scholar] [CrossRef]
- Saffarzadeh, M.; Juenemann, C.; Queisser, M.A.; Lochnit, G.; Barreto, G.; Galuska, S.P.; Lohmeyer, J.; Preissner, K.T. Neutrophil Extracellular Traps Directly Induce Epithelial and Endothelial Cell Death: A Predominant Role of Histones. PLoS ONE 2012, 7, e32366. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Zhang, X.; Pelayo, R.; Monestier, M.; Ammollo, C.T.; Semeraro, F.; Taylor, F.B.; Esmon, N.L.; Lupu, F.; Esmon, C.T. Extracellular histones are major mediators of death in sepsis. Nat. Med. 2009, 15, 1318–1321. [Google Scholar] [CrossRef]
- Andersson, U.; Tracey, K.J. HMGB1 is a therapeutic target for sterile inflammation and infection. Annu. Rev. Immunol. 2011, 29, 139–162. [Google Scholar] [CrossRef]
- Suzuki, M.; Ikari, J.; Anazawa, R.; Tanaka, N.; Katsumata, Y.; Shimada, A.; Suzuki, E.; Tatsumi, K. PAD4 Deficiency improves bleomycin-induced neutrophil extracellular traps and fibrosis in mouse lung. Am. J. Respir. Cell Mol. Biol. 2020, 63, 806–818. [Google Scholar] [CrossRef]
- Robinson, C. Dornase Alfa. Drugs Future 1994, 19, 542. [Google Scholar] [CrossRef]
- Bushra; Ahmed, S.I.; Begum, S.; Maaria; Habeeb, M.S.; Jameel, T.; Khan, A.A. Molecular basis of sepsis: A New insight into the role of mitochondrial DNA as a damage-associated molecular pattern. Mitochondrion 2024, 79, 101967. [Google Scholar] [CrossRef] [PubMed]
- Varela Martins, T.; Silva de Melo, B.M.; Toller-Kawahisa, J.E.; Silva, G.V.L.; Anibal-Silva, C.E.; Paiva, I.M.; Publio, G.A.; Rosa, M.H.; da Silva Souza, C.; Zamboni, D.S.; et al. The DNA sensor AIM2 mediates psoriasiform inflammation by inducing type 3 immunity. JCI Insight 2024, 9, e171894. [Google Scholar] [CrossRef]
- Krishnan, P.; Branco, R.C.S.; Weaver, S.A.; Chang, G.; Lee, C.-C.; Syed, F.; Evans-Molina, C. miR-146a-5p mediates inflammation-induced β cell mitochondrial dysfunction and apoptosis. J. Biol. Chem. 2024, 300, 107827. [Google Scholar] [CrossRef]
- Sun, S.; Sursal, T.; Adibnia, Y.; Zhao, C.; Zheng, Y.; Li, H.; Otterbein, L.E.; Hauser, C.J.; Itagaki, K. Mitochondrial DAMPs Increase Endothelial Permeability through Neutrophil Dependent and Independent Pathways. PLoS ONE 2013, 8, e59989. [Google Scholar] [CrossRef] [PubMed]
- Denning, N.L.; Aziz, M.; Gurien, S.D.; Wang, P. Damps and nets in sepsis. Front. Immunol. 2019, 10, 2536. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Mei, E.; Nan, S.; Chen, X.; Zhang, P.; Zhu, Q.; Lan, D.; Qi, S.; Wang, Y. Fibrin aggravates periodontitis through inducing NETs formation from mitochondrial DNA. Oral Dis. 2024. Online ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Grommes, J.; Soehnlein, O. Contribution of neutrophils to acute lung injury. Mol. Med. 2011, 17, 293–307. [Google Scholar] [CrossRef]
- Liang, Y.; Hou, C.; Kong, J.; Wen, H.; Zheng, X.; Wu, L.; Huang, H.; Chen, Y. HMGB1 binding to receptor for advanced glycation end products enhances inflammatory responses of human bronchial epithelial cells by activating p38 MAPK and ERK1/2. Mol. Cell. Biochem. 2015, 405, 63–71. [Google Scholar] [CrossRef]
- Nolan, E.; Malanchi, I. Connecting the dots: Neutrophils at the interface of tissue regeneration and cancer. Semin. Immunol. 2021, 57, 101598. [Google Scholar] [CrossRef]
- Moore, K.W.; O’Garra, A.; Malefyt, R.W.; Vieira, P.; Mosmann, T.R. Interleukin-10. Annu. Rev. Immunol. 1993, 11, 165–190. [Google Scholar] [CrossRef]
- Reitamo, S.; Remitz, A.; Tamai, K.; Uitto, J. Interleukin-10 modulates type I collagen and matrix metalloprotease gene expression in cultured human skin fibroblasts. J. Clin. Investig. 1994, 94, 2489–2492. [Google Scholar] [CrossRef]
- Nakagome, K.; Dohi, M.; Okunishi, K.; Tanaka, R.; Miyazaki, J.; Yamamoto, K. In vivo IL-10 gene delivery attenuates bleomycin induced pulmonary fibrosis by inhibiting the production and activation of TGF-β in the lung. Thorax 2006, 61, 886–894. [Google Scholar] [CrossRef]
- Sziksz, E.; Pap, D.; Lippai, R.; Béres, N.J.; Fekete, A.; Szabó, A.J.; Vannay, Á. Fibrosis Related Inflammatory Mediators: Role of the IL-10 Cytokine Family. Mediators Inflamm. 2015, 2015, 764641. [Google Scholar] [CrossRef]
- Shamskhou, E.A.; Kratochvil, M.J.; Orcholski, M.E.; Nagy, N.; Kaber, G.; Steen, E.; Balaji, S.; Yuan, K.; Keswani, S.; Danielson, B.; et al. Hydrogel-based delivery of Il-10 improves treatment of bleomycin-induced lung fibrosis in mice. Biomaterials 2019, 203, 52–62. [Google Scholar] [CrossRef] [PubMed]
- Shi, C.; Lin, T.H.; Qu, C. The role of pattern recognition receptors in the innate immune system of Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 2024, 154, 109946. [Google Scholar] [CrossRef] [PubMed]
- Vadillo, E.; Mantilla, A.; Aguilar-Flores, C.; De León-Rodríguez, S.G.; Vela-Patiño, S.; Badillo, J.; Taniguchi-Ponciano, K.; Marrero-Rodríguez, D.; Ramírez, L.; León-Vega, I.I.; et al. The invasive margin of early-stage human colon tumors is infiltrated with neutrophils of an antitumoral phenotype. J. Leukoc. Biol. 2023, 114, 672–683. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.H.; Sexton, D.M.; Redmond, H.P.; Watson, R.W.G.; Croke, D.T.; Bouchier-Hayes, D. Intercellular adhesion molecule-1 (ICAM-1) is expressed on human neutrophils and is essential for neutrophil adherence and aggregation. Shock 1997, 8, 357–361. [Google Scholar] [CrossRef] [PubMed]
- Chong, D.L.W.; Rebeyrol, C.; José, R.J.; Williams, A.E.; Brown, J.S.; Scotton, C.J.; Porter, J.C. ICAM-1 and ICAM-2 Are Differentially Expressed and Up-Regulated on Inflamed Pulmonary Epithelium, but Neither ICAM-2 nor LFA-1: ICAM-1 Are Required for Neutrophil Migration into the Airways In Vivo. Front. Immunol. 2021, 12, 691957. [Google Scholar] [CrossRef]
- Vignarajah, M.; Wood, A.J.T.; Nelmes, E.; Subburayalu, J.; Herre, J.; Nourshargh, S.; Summers, C.; Chilvers, E.R.; Farahi, N. Regulation of ICAM-1 in human neutrophils. J. Leukoc. Biol. 2024, 116, 901–908. [Google Scholar] [CrossRef]
- Sengupta, S.; Caldwell, C.C.; Nomellini, V. Distinct Neutrophil Populations in the Spleen During PICS. Front. Immunol. 2020, 11, 534199. [Google Scholar] [CrossRef]
- Steppan, J.; Ryoo, S.; Schuleri, K.H.; Gregg, C.; Hasan, R.K.; White, A.R.; Bugaj, L.J.; Khan, M.; Santhanam, L.; Nyhan, D.; et al. Arginase modulates myocardial contractility by a nitric oxide synthase 1-dependent mechanism. Proc. Natl. Acad. Sci. USA 2006, 103, 4759–4764. [Google Scholar] [CrossRef]
- Savelieva, O.N.; Karunas, A.S.; Fedorova, Y.Y.; Murzina, R.R.; Savelieva, A.N.; Gatiyatullin, R.F.; Etkina, E.I.; Khusnutdinova, E.K. The role of polymorphic variants of arginase genes (ARG1, ARG2) involved in beta-2-agonist metabolism in the development and course of asthma. Vavilov J. Genet. Breed. 2020, 24, 391–398. [Google Scholar] [CrossRef]
Gene | Primer Sequence, 5′→3′ | |
---|---|---|
Forward | Reverse | |
Actb | GAGGTATCCTGACCCTGAAGTA | TCTACAATGAGCTGCGTGTG |
Gapdh | CGCCCTGATCTGAGGTTAAAT | TACACACATCTGTTGCTCCG |
mt-Co3 | CAGGATTCTTCTGAGCGTTCTAT | ACTTAACCCTCTAGAAGTCCCA |
mt-Nd3 | AATGCGGATTCGACCCTAC | CTTCTACTTCCACTACCATGAGC |
L1_mus1 | GCCAGGTATCTGTGCATCTT | ACTCTAGCTCTCTCCTGAGTTT |
Gene | Sequences, 5′→3′ | ||
---|---|---|---|
Forward | Reverse | Probe | |
Arg1 | AAGAATGGAAGAGTCAGTGTGG | GGGAGTGTTGATGTCAGTGTG | FAM-TCTGGCAGTTGGAAGCATCTCTGG-BHQ1 |
Ccl17 | CAGACCCCAAAGACAAACATG | GTCACAGGCCGTTTTATGTTG | FAM-TGACCTTCCCGCTGAGGCATT-BHQ1 |
Nos2 | TGGAGCGAGTTGTGGATTG | CGTAATGTCCAGGAAGTAGGTG | FAM-CAGCCTCTTGTCTTTGACCCAGTAGC-BHQ1 |
Il10 | AACATACTGCTAACCGACTCC | CAAATGCTCCTTGATTTCTGGG | FAM-ATCATTTCCGATAAGGCTTGGCAACC-BHQ1 |
Tnfa | TGGAGTCATTGCTCTGTGAAG | CCTGAGCCATAATCCCCTTTC | FAM-TCTGACCCCTTTACTCTGACCCCTT-BHQ1 |
Icam | GCAGAGGACCTTAACAGTCTAC | TACTTGGCTCCCTTCCGAGACCT | FAM-TACTTGGCTCCCTTCCGAGACCT-BHQ1 |
Mmp9 | GACATAGACGGCATCCAGTATC | GTGGGAGGTATAGTGGGACA | FAM-TCGGCTGTGGTTCAGTTGTGGT-BHQ1 |
Vegfa | CCGAAACCATGAACTTTCTGC | CTTCATGGGACTTCTGCTCTC | FAM-CACTGGACCCTGGCTTTACTGCT-BHQ1 |
Hmgb1 | GTACCGCCCCAAAATCAAAG | CCTTCTCATACTTCTCCTTCAGC | FAM-TCACCAATGGATAAGCCAGGATGCTC-BHQ1 |
Col1a1 | AGCCGCAAAGAGTCTACATG | CTTAGGCCATTGTGTATGCAG | FAM-CCGGAGGTCCACAAAGCTGAACAT-BHQ1 |
Hprt1 | CCCCAAAATGGTTAAGGTTGC | AACAAAGTCTGGCCTGTATCC | ROX-CTTGCTGGTGAAAAGGACCTCTCGAA-BHQ2 |
Days | Concentration of cfDNA, ng/mL | DNase Activity, keff, s−1 | ||
---|---|---|---|---|
Control | Pulmozyme | Control | Pulmozyme | |
Blood serum | ||||
0 (healthy) | 50.0 ± 0.5 | 5.97 ± 0.11 | ||
14 | 50.0 ± 0.5 | 50.0 ± 0.5 | 5.97 ± 0.08 | 5.97 ± 0.08 |
21 | 50.0 ± 0.5 | 140.5 ± 56.0 | 5.97 ± 0.05 | 6.05 ± 0.07 |
28 | 85.2 ± 25.0 | 145.4 ± 42.8 | 6.03 ± 0.07 | 6.08 ± 0.08 |
35 | 50.0 ± 0.5 | 887.1 ± 254.1 *** | 6.03 ± 0.11 | 6.93 ± 0.34 |
BALF | ||||
0 (healthy) | (17.2 ± 5.3) × 103 | 3.83 ± 0.13 | ||
14 | (48.4 ± 1.7) × 103 | (48.4 ± 1.7) × 103 | 3.87 ± 0.03 | 3.87 ± 0.03 |
21 | (60.7 ± 1.5) × 103 | (44.3 ± 2.2) × 103 * | 3.87 ± 0.03 | 5.43 ± 0.18 ** |
28 | (59.1 ± 2.) × 103 | (51.1 ± 2.8) × 103 | 3.90 ± 0.18 | 5.53 ± 0.08 ** |
35 | (28.5 ± 3.4) × 103 | (27.8 ± 4.9) × 103 | 3.83 ± 0.06 | 5.9 ± 0.05 ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alekseeva, L.A.; Sen’kova, A.V.; Sounbuli, K.; Savin, I.A.; Zenkova, M.A.; Mironova, N.L. Pulmozyme Ameliorates LPS-Induced Lung Fibrosis but Provokes Residual Inflammation by Modulating Cell-Free DNA Composition and Controlling Neutrophil Phenotype. Biomolecules 2025, 15, 298. https://doi.org/10.3390/biom15020298
Alekseeva LA, Sen’kova AV, Sounbuli K, Savin IA, Zenkova MA, Mironova NL. Pulmozyme Ameliorates LPS-Induced Lung Fibrosis but Provokes Residual Inflammation by Modulating Cell-Free DNA Composition and Controlling Neutrophil Phenotype. Biomolecules. 2025; 15(2):298. https://doi.org/10.3390/biom15020298
Chicago/Turabian StyleAlekseeva, Ludmila A., Aleksandra V. Sen’kova, Khetam Sounbuli, Innokenty A. Savin, Marina A. Zenkova, and Nadezhda L. Mironova. 2025. "Pulmozyme Ameliorates LPS-Induced Lung Fibrosis but Provokes Residual Inflammation by Modulating Cell-Free DNA Composition and Controlling Neutrophil Phenotype" Biomolecules 15, no. 2: 298. https://doi.org/10.3390/biom15020298
APA StyleAlekseeva, L. A., Sen’kova, A. V., Sounbuli, K., Savin, I. A., Zenkova, M. A., & Mironova, N. L. (2025). Pulmozyme Ameliorates LPS-Induced Lung Fibrosis but Provokes Residual Inflammation by Modulating Cell-Free DNA Composition and Controlling Neutrophil Phenotype. Biomolecules, 15(2), 298. https://doi.org/10.3390/biom15020298