Chromosome-Level Genome Assembly of Red Sea Bream (Pagrus major) Reveals Integration of Heterospecific Sperm-Derived Genetic Material in Artificial Gynogenesis
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Experimental Animals
2.2. Sample Collection, DNA and RNA Extraction
2.3. Whole Genome Sequencing, Library Construction, Sequencing, and Genome Survey
2.4. PacBio Library Construction, Sequencing, and De Novo Assembly
2.5. Hi-C Library Preparation, Sequencing, and Chromosome Anchoring
2.6. Gene Annotation
2.7. Genome Assembly and Annotation Evaluation
2.8. Comparative Genomic Analyses
2.9. WGS Quality Control and Alignment
2.10. Detection of Paternal-Specific Sequences in Gynogenetic Offspring
2.11. PCR Validation
2.12. Sanger Sequencing
3. Results
3.1. Genome Assembly
3.2. Genome Annotation
3.3. Phylogenetic Analysis and Gene Family Expansion
3.4. Whole Genome Sequencing and Alignment
3.5. Detection of Paternal-Specific Sequences in Offspring of Gynogenesis
3.6. PCR Detection of Paternal-Specific Sequences
3.7. Sanger Sequencing of EcoRI Centromeric Satellite DNA
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BUSCO | Benchmarking universal single-copy orthologs |
| LINE | Long interspersed nuclear elements |
| SINE | Short interspersed nuclear elements |
| LTR | Long terminal repeat |
| Bp | Base pairs |
| MYA | Millions of years ago |
| Gb | Gigabases |
| Mit_gd | Mitotic gynogenetic diploids |
| Mei_gd | Meiotic gynogenetic diploids |
| Nor_fd | Meiotic gynogenetic diploids |
| ad-Mit_gd | Additional mitotic gynogenetic diploids |
| ad-Mei_gd | Additional meiotic gynogenetic diploids |
| NCBI | National center for biotechnology information |
| KEGG | Kyoto encyclopedia of genes and genomes |
Appendix A
| Primer Names | Primer Sequences (5′→3′) | Amplification Product Size | |
|---|---|---|---|
| Forward | Reverse | ||
| G441-primers | TCATTAAAGGTGCAAACTGGC | GACCCGAATTCAACCAGTTCA | 150 |
| G608-primers | CGGCTAAGCTCCATCACCTA | CCCTCTGCTTCAAAGGTCCT | 234 |
| G462-primers | GCTACGTCACTTCCGGTTTC | AACACTTGGGCGGATTTCAC | 205 |
| Type | Repbase TEs | De Novo | Combined TEs | |||
|---|---|---|---|---|---|---|
| Length (bp) | % in Genome | Length (bp) | % in Genome | Length (bp) | % in Genome | |
| DNA | 21,097,913 | 2.65 | 52,107,479 | 6.55 | 73,205,392 | 9.20 |
| LINE | 16,163,963 | 2.03 | 19,942,205 | 2.51 | 36,106,168 | 4.54 |
| SINE | 1,443,154 | 0.18 | 1,080,688 | 0.14 | 2,523,842 | 0.32 |
| LTR | 9,182,293 | 1.15 | 10,169,888 | 1.28 | 19,352,181 | 2.43 |
| Other | 24,623,917 | 3.10 | 5,144,005 | 0.65 | 29,767,922 | 3.74 |
| Unknown | 336,642 | 0.04 | 84,933,826 | 10.68 | 85,270,468 | 10.72 |
| Total | 72,847,882 | 9.16 | 173,378,091 | 21.80 | 246,225,973 | 30.96 |
| Species | Predicted Protein-Coding Number | Average Gene Length (bp) | Average Exon Length (bp) | Average Exon Number | Average Intron Length (bp) | Average Intron Number |
|---|---|---|---|---|---|---|
| Pagrus major | 29,083 | 13,821.71 | 183.32 | 8.79 | 1566.45 | 7.79 |
| Sparus aurata | 25,222 | 20,229.04 | 232.87 | 9.57 | 1814.80 | 8.57 |
| Acanthopagrus latus | 23,810 | 19,831.93 | 301.93 | 11.65 | 1553.45 | 10.60 |
| Paralichthys olivaceus | 23,126 | 14,847.16 | 262.87 | 10.33 | 1296.53 | 9.32 |
| Takifugu rubripes | 21,411 | 11,809.09 | 221.10 | 9.66 | 923.29 | 8.66 |
| Type | Number | Percent (%) | |
|---|---|---|---|
| Annotation | TrEMBL | 24,804 | 85.29 |
| Swiss-Prot | 19,904 | 68.44 | |
| EggNOG | 23,196 | 79.76 | |
| NR | 25,108 | 86.33 | |
| InterPro | 26,624 | 91.54 | |
| Total | Annotation | 27,474 | 94.47 |
| Gene | 29,083 | 100.00 | |
| Species | Average Diameter of the Longitudinal Section (μm) | Average Diameter of the Transverse Section (μm) | Reference |
|---|---|---|---|
| Danio rerio | 2.93 | 2.93 | [52] |
| Colossoma macropomum | 2.74 | 2.74 | [53] |
| Ictalurus punctatus | 2.30 | 2.30 | [55] |
| Pagrus major | 1.88 | 1.88 | [44] |
| Sparus aurata | 1.87 | 1.87 | [45] |
| Scophthalmus maximus | 1.74 | 1.74 | [48] |
| Paralichthys olivaceus | 1.49 | 1.49 | [47] |
| Salmo salar | 2.93 | 2.43 | [50] |
| Oncorhynchus kisutch | 2.39 | 1.86 | [51] |
| Siniperca chuatsi | 1.43 | 1.02 | [54] |
| Cynoglossus semilaevis | 1.36 | 0.87 | [49] |
| Takifugu rubripes | 1.35 | 0.65 | [46] |
| SOAPdenovo2 | SPAdes | MEGAHIT | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Contig N50 | Contig Number | Summary | Contig N50 | Contig Number | Summary | Contig N50 | Contig Number | Summary | |
| Mit_gd | 242.00 | 242.00 | 160,480.87 | 426.53 | 205.83 | 74,004.20 | 524.27 | 183.90 | 93,575.97 |
| Mei_gd | 258.70 | 287.53 | 59,974.43 | 436.63 | 74.40 | 31,751.87 | 456.97 | 111.70 | 47,468.63 |
| Nor_fd | 264.57 | 174.03 | 47,158.70 | 413.27 | 64.53 | 27,342.13 | 484.93 | 91.87 | 41,810.50 |


References
- de Meeûs, T.; Prugnolle, F.; Agnew, P. Asexual reproduction: Genetics and evolutionary aspects. Cell Mol. Life Sci. 2007, 64, 1355–1372. [Google Scholar] [CrossRef]
- Xiao, J.; Zou, T.M.; Chen, Y.B.; Chen, L.; Liu, S.J.; Tao, M.; Zhang, C.; Zhao, R.R.; Zhou, Y.; Long, Y.; et al. Coexistence of diploid, triploid and tetraploid crucian carp (Carassius auratus) in natural waters. BMC Genet. 2011, 12, 20. [Google Scholar] [CrossRef]
- Romashov, D.D.; Belyaeva, N.N.; Golovinskaya, K.A. Radiation Disease in Fish; 1961. [Google Scholar]
- Chen, S.L.; Tian, Y.S.; Yang, J.F.; Shao, C.W.; Ji, X.S.; Zhai, J.M.; Liao, X.L.; Zhuang, Z.M.; Su, P.Z.; Xu, J.Y.; et al. Artificial gynogenesis and sex determination in half-smooth tongue sole (Cynoglossus semilaevis). Mar. Biotechnol. 2009, 11, 243–251. [Google Scholar] [CrossRef]
- Miao, L.; Tang, X.N.; Li, M.Y.; Wang, T.; Wang, S.; Zhang, X.L.; Chen, J. Artificial gynogenesis in Pseudosciaena crocea (Perciformes, Sciaenidae) with heterologous sperm and its verification using microsatellite markers. Aquac. Res. 2014, 45, 1253–1259. [Google Scholar] [CrossRef]
- Wang, Y.D.; Liu, W.X.; Li, Z.P.; Qiu, B.; Li, J.; Geng, G.; Hu, B.; Liao, A.M.; Cai, Y.P.; Men, M.; et al. Improvement and application of genetic resources of grass carp (Ctenopharyngodon idella). Reprod. Breed. 2024, 4, 126. [Google Scholar] [CrossRef]
- Liu, Q.Z.; Wang, S.; Tang, C.C.; Tao, M.; Zhang, C.; Zhou, Y.; Qin, Q.B.; Luo, K.K.; Wu, C.; Hu, F.Z.; et al. The Research Advances in Distant Hybridization and Gynogenesis in Fish. Rev. Aquac. 2025, 17, e12972. [Google Scholar] [CrossRef]
- Liu, Y.X.; Wang, G.X.; Liu, Y.; Hou, J.L.; Wang, Y.F.; Si, F.; Sun, Z.H.; Zhang, X.Y.; Liu, H.J. Genetic verification of doubled haploid Japanese flounder, Paralichthys olivaceus by genotyping telomeric microsatellite loci. Aquaculture 2012, 324–325, 60–63. [Google Scholar] [CrossRef]
- Cao, W.J.; Zhang, J.R.; Zhang, Q.F.; Zhao, Y.H.; Wang, W.M. Research on the Allogynogenetic Biological Effects in the Second Generation Gynogenetic of Carassius auratus var. pengsenensis Induced with Sperms from Elopichthys bambusa and Culter alburnus. J. Fish. China 2023, 47, 195–206. [Google Scholar]
- Chen, F.; Li, X.Y.; Zhou, L.; Yu, P.; Wang, Z.W.; Li, Z.; Zhang, X.J.; Wang, Y.; Gui, J.F. Stable Genome Incorporation of Sperm-derived DNA Fragments in Gynogenetic Clone of Gibel Carp. Mar. Biotechnol. 2020, 22, 54–66. [Google Scholar] [CrossRef]
- Zhao, X.; Li, Z.; Ding, M.; Wang, T.; Wang, M.T.; Miao, C.; Du, W.X.; Zhang, X.J.; Wang, Y.; Wang, Z.W.; et al. Genotypic Males Play an Important Role in the Creation of Genetic Diversity in Gynogenetic Gibel Carp. Front. Genet. 2021, 12, 691923. [Google Scholar] [CrossRef] [PubMed]
- Kitada, S.; Kishino, H. Lessons learned from Japanese marine finfish stock enhancement programmes. Fish. Res. 2006, 80, 101–112. [Google Scholar] [CrossRef]
- Shin, G.H.; Shin, Y.; Jung, M.; Hong, J.M.; Lee, S.; Subramaniyam, S.; Noh, E.S.; Shin, E.H.; Park, E.H.; Park, J.Y.; et al. First Draft Genome for Red Sea Bream of Family Sparidae. Front. Genet. 2018, 9, 643. [Google Scholar] [CrossRef] [PubMed]
- San, L.Z.; Wang, G.X.; Zhang, X.Y.; Zhang, Y.T.; Cao, W.; He, Z.W.; Liu, Y.F.; Yang, Y.C.; Liu, M.Y.; Ren, Y.Q.; et al. Genetic diversity study of self-fertilized and gynogenetic Japanese flounder (Paralichthys olivaceus) in whole genomic level. Aquaculture 2025, 598, 742019. [Google Scholar] [CrossRef]
- Chen, S.F.; Zhou, Y.Q.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Marçais, G.; Kingsford, C. A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics 2011, 27, 764–770. [Google Scholar] [CrossRef]
- Ranallo-Benavidez, T.R.; Jaron, K.S.; Schatz, M.C. GenomeScope 2.0 and Smudgeplot for reference-free profiling of polyploid genomes. Nat. Commun. 2020, 11, 1432. [Google Scholar] [CrossRef]
- Chin, C.S.; Alexande, D.H.; Marks, P.; Klammer, A.A.; Drake, J.; Heiner, C.; Clum, A.; Copeland, A.; Huddleston, J.; Eichler, E.E.; et al. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat. Methods 2013, 10, 563–569. [Google Scholar] [CrossRef]
- Cheng, H.Y.; Concepcion, G.T.; Feng, X.W.; Zhang, H.W.; Li, H. Haplotype-resolved de novo assembly using phased assembly graphs with hifiasm. Nat. Methods 2021, 18, 170–175. [Google Scholar] [CrossRef]
- Cheng, H.Y.; Asri, M.; Lucas, J.; Koren, S.; Li, H. Scalable telomere-to-telomere assembly for diploid and polyploid genomes with double graph. Nat. Methods 2024, 21, 967–970. [Google Scholar] [CrossRef]
- Dudchenko, O.; Batra, S.S.; Omer, A.D.; Nyquist, S.K.; Hoeger, M.; Durand, N.C.; Shamim, M.S.; Machol, I.; Lander, E.S.; Aiden, A.P.; et al. De novo assembly of the Aedes aegypti genome using Hi-C yields chromosome-length scaffolds. Science 2017, 356, 92–95. [Google Scholar] [CrossRef]
- Durand, N.C.; Shamim, M.S.; Machol, I.; Rao, S.S.; Huntley, M.H.; Lande, E.S.; Aiden, E.L. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell Syst. 2016, 3, 95–98. [Google Scholar] [CrossRef]
- Flynn, J.M.; Hubley, R.; Goubert, C.; Rosen, J.; Clark, A.G.; Feschotte, C.; Smit, A.F. RepeatModeler2 for automated genomic discovery of transposable element families. Proc. Natl. Acad. Sci. USA 2020, 117, 9451–9457. [Google Scholar] [CrossRef]
- Xu, Z.; Wang, H. LTR_FINDER: An efficient tool for the prediction of full-length LTR retrotransposons. Nucleic Acids Res. 2007, 35, W265–W268. [Google Scholar] [CrossRef]
- Tarailo-Graovac, M.; Chen, N.S. Using RepeatMasker to identify repetitive elements in genomic sequences. Curr. Protoc. Bioinform. 2009, 25, 4.10.1–4.10.14. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat. Biotechnol. 2015, 33, 290–295. [Google Scholar] [CrossRef] [PubMed]
- Haas, B.J.; Delcher, A.L.; Mount, S.M.; Wortman, J.R.; Smith, R.K., Jr.; Hannick, L.I.; Maiti, R.; Ronning, C.M.; Rusch, D.B.; Town, C.D.; et al. Improving the Arabidopsis genome annotation using maximal transcript alignment assemblies. Nucleic Acids Res. 2003, 31, 5654–5666. [Google Scholar] [CrossRef] [PubMed]
- Li, H. Protein-to-genome alignment with miniprot. Bioinformatics 2023, 39, btad014. [Google Scholar] [CrossRef]
- Hoff, K.J.; Stanke, M. Predicting Genes in Single Genomes with AUGUSTUS. Curr. Protoc. Bioinform. 2019, 65, e57. [Google Scholar] [CrossRef]
- Haas, B.J.; Salzberg, S.L.; Zhu, W.; Pertea, M.; Allen, J.E.; Orvis, J.; White, O.; Buell, C.R.; Wortman, J.R. Automated eukaryotic gene structure annotation using EVidenceModeler and the Program to Assemble Spliced Alignments. Genome Biol. 2008, 9, R7. [Google Scholar] [CrossRef]
- Bairoch, A.; Apweiler, R. The SWISS-PROT protein sequence database and its supplement TrEMBL in 2000. Nucleic Acids Res. 2000, 28, 45–48. [Google Scholar] [CrossRef]
- Kanehisa, M.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44, D457–D462. [Google Scholar] [CrossRef] [PubMed]
- Finn, R.D.; Attwood, T.K.; Babbitt, P.C.; Bateman, A.; Bork, P.; Bridge, A.J.; Chang, H.Y.; Dosztányi, Z.; El-Gebali, S.; Fraser, M.; et al. InterPro in 2017-beyond protein family and domain annotations. Nucleic Acids Res. 2017, 45, D190–D199. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, R.M.; Seppey, M.; Simão, F.A.; Manni, M.; Ioannidis, P.; Klioutchnikov, G.; Kriventseva, E.V.; Zdobnov, E.M. BUSCO Applications from Quality Assessments to Gene Prediction and Phylogenomics. Mol. Biol. Evol. 2018, 35, 543–548. [Google Scholar] [CrossRef]
- Gurevich, A.; Saveliev, V.; Vyahhi, N.; Tesler, G. QUAST: Quality assessment tool for genome assemblies. Bioinformatics 2013, 29, 1072–1075. [Google Scholar] [CrossRef]
- Lopez, F.; Charbonnier, G.; Kermezli, Y.; Belhocine, M.; Ferré, Q.; Zweig, N.; Aribi, M.; Gonzalez, A.; Spicuglia, S.; Puthier, D. Explore, edit and leverage genomic annotations using Python GTF toolkit. Bioinformatics 2019, 35, 3487–3488. [Google Scholar] [CrossRef]
- Emms, D.M.; Kelly, S. OrthoFinder: Phylogenetic orthology inference for comparative genomics. Genome Biol. 2019, 20, 238. [Google Scholar] [CrossRef]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Yang, Z.H. PAML 4: Phylogenetic analysis by maximum likelihood. Mol. Biol. Evol. 2007, 24, 1586–1591. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Suleski, M.; Hedges, S.B. TimeTree: A Resource for Timelines, Timetrees, and Divergence Times. Mol. Biol. Evol. 2017, 34, 1812–1819. [Google Scholar] [CrossRef] [PubMed]
- De Bie, T.; Cristianini, N.; Demuth, J.P.; Hahn, M.W. CAFE: A computational tool for the study of gene family evolution. Bioinformatics 2006, 22, 1269–1271. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Gwo, J.C.; Kuo, M.C.; Chiu, J.Y.; Cheng, H.Y. Ultrastructure of Pagrus major and Rhabdosargus sarba spermatozoa (Perciformes: Sparidae: Sparinae). Tissue Cell 2004, 36, 141–147. [Google Scholar] [CrossRef]
- Maricchiolo, G.; Genovese, L.; Laurà, R.; Micale, V.; Muglia, U. Fine structure of spermatozoa in the gilthead sea bream (Sparus aurata Linnaeus, 1758) (Perciformes, Sparidae). Histol Histopathol. 2007, 22, 79–83. [Google Scholar]
- Jeong, Y.C.; Jin, Y.C. Physico-chemical Properties of Milt and Fine Structure of Cryopreserved Spermatozoa in Tiger Puffer (Takifugu rubripes). Korean J. Fish. Aquat. Sci. 1998, 31, 353–358. [Google Scholar]
- Zhang, L.Z.; Yan, W.G.; Zhuang, P.; Huang, X.R.; Jiang, Q. Ultrastructural observation of sperm in Paralichthys olivaceus. Mar. Fish. 2010, 32, 35–41. [Google Scholar]
- Suquet, M.; Dorange, G.; Omnes, M.H.; Normant, Y.; Fauvel, C. Composition of the seminal Fluid and ultrastructure of the spermatozoon of turbot (Scophthalmus maximus). J. Fish. Biol. 1993, 42, 509–516. [Google Scholar] [CrossRef]
- Wu, Y.Y.; Liu, X.Z.; Wang, Q.Y.; Xu, Y.J.; Bao, Z.M. Studies on the ultrastructure of spermiogenesis and spermatozoon of tongue fish, Cynoglossus semilaevis gconther. Aquac. Res. 2008, 39, 1467–1474. [Google Scholar] [CrossRef]
- Díaz, R.; Lee-Estevez, M.; Quiñones, J.; Dumorné, K.; Short, S.; Ulloa-Rodríguez, P.; Valdebenito, I.; Sepúlveda, N.; Farías, J.G. Changes in Atlantic salmon (Salmo salar) sperm morphology and membrane lipid composition related to cold storage and cryopreservation. Anim. Reprod. Sci. 2019, 204, 50–59. [Google Scholar] [CrossRef] [PubMed]
- Sandoval-Vargas, L.; Jennie, R.; Dumorne, K.; Jorge, F.; Elías, F.; Iván, V. Spermatology and sperm ultrastructure in farmed coho salmon (Oncorhynchus kisutch). Aquaculture 2022, 547, 737471. [Google Scholar] [CrossRef]
- Zhang, L.L.; Wang, S.; Chen, W.; Hu, B.; Ullah, S.; Zhang, Q.; Le, Y.; Chen, B.; Yang, P.; Bian, X.G.; et al. Fine Structure of Zebrafish (Danio rerio) Spermatozoa. Pak. Vet. J. 2014, 34, 518–521. [Google Scholar]
- Maria, A.N.; Azevedo, H.C.; Santos, J.P.; Silva, C.A.; Carneiro, P.C.F. Semen characterization and sperm structure of the Amazon tambaqui Colossoma macropomum. J. Appl. Ichthyol. 2010, 26, 779–783. [Google Scholar] [CrossRef]
- Luo, D.; Sun, J.J.; Lu, X.; Liu, L.Z.; Chen, S.J.; Li, G.F. Comparative sperm ultrastructure of three species in Siniperca (Teleostei: Perciformes: Sinipercidae). Micron 2011, 42, 884–891. [Google Scholar] [CrossRef]
- Jaspers, E.J.; Avault, J.W.; Roussel, J.D. Spermatozoal Morphology and Ultrastructure of Channel Catfish, Ictalurus punctatus. Trans. Am. Fish. Soc. 1976, 5, 475–480. [Google Scholar] [CrossRef]
- Xu, X.W.; Zheng, W.W.; Yang, Y.M.; Hou, J.L.; Chen, S.L. High-quality Japanese flounder genome aids in identifying stress-related genes using gene coexpression network. Sci. Data. 2022, 9, 705. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed]
- Luo, R.B.; Liu, B.H.; Xie, Y.L.; Li, Z.Y.; Huang, W.H.; Yuan, J.Y.; He, G.Z.; Chen, Y.X.; Pan, Q.; Liu, Y.J.; et al. SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience 2012, 1, 18. [Google Scholar] [CrossRef]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef]
- Li, D.H.; Liu, C.M.; Luo, R.B.; Sadakane, K.; Lam, T. MEGAHIT: An ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 2015, 31, 1674–1676. [Google Scholar] [CrossRef]
- Shen, W.; Le, S.; Li, Y.; Hu, F.Q. SeqKit: A Cross-Platform and Ultrafast Toolkit for FASTA/Q File Manipulation. PLoS ONE 2016, 11, e0163962. [Google Scholar] [CrossRef]
- Fu, L.M.; Niu, B.F.; Zhu, Z.W.; Wu, S.T.; Li, W.D. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [PubMed]
- Garrido-Ramos, M.A.; Jamilena, M.; Lozano, R.; Rejón, C.R.; Rejón, M.R. The EcoRI centromeric satellite DNA of the Sparidae family (Pisces, Perciformes) contains a sequence motive common to other vertebrate centromeric satellite DNAs. Cytogenet. Cell Genet. 1995, 71, 345–351. [Google Scholar] [CrossRef]
- Allendorf, F.W.; Hohenlohe, P.A.; Luikart, G. Genomics and the future of conservation genetics. Nat. Rev. Genet. 2010, 11, 697–709. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Kim, Y.; Shin, J.; Kim, Y.K.; Lee, D.H.; Park, J.W.; Lee, D.; Kim, H.C.; Lee, J.H.; Lee, S.H.; et al. Fully phased genome assemblies and graph-based genetic variants of the olive flounder, Paralichthys olivaceus. Sci. Data. 2024, 4, 1193. [Google Scholar] [CrossRef] [PubMed]
- Castaño-Sánchez, C.; Fuji, K.; Ozaki, A.; Hasegawa, O.; Sakamoto, T.; Morishima, K.; Nakayama, I.; Fujiwara, A.; Masaoka, T.; Okamoto, H.; et al. A second generation genetic linkage map of Japanese flounder (Paralichthys olivaceus). BMC Genom. 2010, 11, 554. [Google Scholar] [CrossRef]
- Xu, K.; Duan, W.; Xiao, J.; Tao, M.; Zhang, C.; Liu, Y.; Liu, S.J. Development and application of biological technologies in fish genetic breeding. Sci. China Life. Sci. 2015, 58, 187–201. [Google Scholar] [CrossRef]
- Mao, Z.W.; Fu, Y.Q.; Wang, Y.D.; Wang, S.; Zhang, M.H.; Gao, X.; Luo, K.K.; Qin, Q.B.; Zhang, C.; Tao, M.; et al. Evidence for paternal DNA transmission to gynogenetic grass carp. BMC Genet. 2019, 20, 3. [Google Scholar] [CrossRef]
- Mao, Z.W.; Fu, Y.Q.; Wang, S.; Wang, Y.D.; Luo, K.K.; Zhang, C.; Tao, M.; Liu, S.J. Further evidence for paternal DNA transmission in gynogenetic grass carp. Sci. China Life Sci. 2020, 63, 1287–1296. [Google Scholar] [CrossRef]
- Zhou, L.; Gui, J.F. Natural and artificial polyploids in aquaculture. Aquacult. Fish. 2017, 2, 103–111. [Google Scholar] [CrossRef]
- Wu, C.; Chen, Q.; Huang, X.; Hu, F.Z.; Zhu, S.R.; Luo, L.L.; Gong, D.B.; Gong, K.J.; Zhao, R.R.; Zhang, C.; et al. Genomic and epigenetic alterations in diploid gynogenetic hybrid fish. Aquaculture 2019, 512, 734383. [Google Scholar] [CrossRef]
- Liu, S.J.; Sun, Y.D.; Zhang, C.; Luo, K.K.; Liu, Y. Production of gynogenetic progeny from allotetraploid hybrids red crucian carp×common carp. Aquaculture 2004, 236, 193–200. [Google Scholar] [CrossRef]
- Qin, Q.B.; Huo, Y.Y.; Liu, Q.W.; Wang, C.Q.; Zhou, Y.W.; Liu, S.J. Induced gynogenesis in autotetraploids derived from Carassius auratus red var. (♀)×Megalobrama amblycephala(♂). Aquaculture 2018, 495, 710–714. [Google Scholar] [CrossRef]
- Feng, C.; Liu, Y.L.; Su, H.D.; Wang, H.F.; Birchler, J.; Han, F.P. Recent advances in plant centromere biology. Sci. China Life Sci. 2015, 58, 240–245. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Plohl, M.; Meštrović, N.; Mravinac, B. Satellite DNA evolution. Genome Dyn. 2012, 7, 126–152. [Google Scholar]
- Melters, D.P.; Bradnam, K.R.; Young, H.A.; Telis, N.; May, M.R.; Ruby, J.G.; Sebra, R.; Peluso, P.; Eid, J.; Rank, D.; et al. Comparative analysis of tandem repeats from hundreds of species reveals unique insights into centromere evolution. Genome Biol. 2013, 14, R10. [Google Scholar] [CrossRef]
- Garrido-Ramos, M.A.; de la Herrán, R.; Jamilena, M.; Lozano, R.; Rejón, C.R.; Rejón, M.R. Evolution of centromeric satellite DNA and its use in phylogenetic studies of the Sparidae family (Pisces, Perciformes). Mol. Phylogenet Evol. 1999, 12, 200–204. [Google Scholar] [CrossRef]
- Wlodzimierz, P.; Rabanal, F.A.; Burns, R.; Naish, M.; Primetis, E.; Scott, A.; Mandáková, T.; Gorringe, N.; Tock, A.J.; Holland, D.; et al. Cycles of satellite and transposon evolution in Arabidopsis centromeres. Nature 2023, 618, 557–565. [Google Scholar] [CrossRef]
- Miga, K.H.; Alexandrov, I.A. Variation and Evolution of Human Centromeres: A Field Guide and Perspective. Annu. Rev. Genet. 2023, 55, 583–602. [Google Scholar] [CrossRef]
- Hou, J.L.; Sun, Z.H.; Si, F.; Liu, H.J. Cytological studies on induced meiogynogenesis in Japanese flounder Paralichthys olivaceus (Temminck et Schlegel). Aquac. Res. 2009, 40, 681–686. [Google Scholar] [CrossRef]
- Hou, J.L.; Wang, G.X.; Zhang, X.Y.; Liu, H.J. Cytological studies on induced mitogynogenesis in Japanese flounder Paralichthys olivaceus (Temminck et Schlegel). Zygote 2016, 24, 700–706. [Google Scholar] [CrossRef]






| Item | Category | Number |
|---|---|---|
| Sequencing Data | Pacbio HiFi (Gb) | 22.72 |
| Illumina WGS (Gb) | 43.09 | |
| Hi-C (Gb) | 89.32 | |
| Survey | Estimated genome size (Mb) | 772.32 |
| Heterozygosity | 0.65% | |
| Assembly | Assembled genome size (Mb) | 795.23 |
| Contig number | 362 | |
| Contig N50 (Mb) | 11.22 | |
| Contig N90 (Mb) | 3.67 | |
| Largest contig (Mb) | 28.56 | |
| Scaffold number | 479 | |
| Scaffold N50 (Mb) | 32.03 | |
| Scaffold N90 (Mb) | 23.69 | |
| Largest scaffold (Mb) | 39.52 | |
| Anchoring rate | 95.44% |
| Raw Data (G) | Clean Data (G) | Depth (×) | Mapping Rate (P. olivaceus) (%) | Mapping Rate (P. major) (%) | p-Value (vs. Nor_fd) | |
|---|---|---|---|---|---|---|
| Mit_gd | 6.97 ± 0.65 | 6.91 ± 0.65 | 11.75 ± 1.11 | 99.57 ± 0.22 | 20.48 ± 12.65 | 0.000010 |
| Mei_gd | 6.58 ± 0.28 | 6.53 ± 0.28 | 11.10 ± 0.48 | 99.69 ± 0.04 | 18.60 ± 3.00 | 0.072492 |
| Nor_fd | 6.60 ± 0.23 | 6.54 ± 0.23 | 11.12 ± 0.39 | 99.63 ± 0.07 | 12.12 ± 2.03 | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, M.; Wang, G.; Ren, Y.; Zhang, X.; Li, B.; Zhang, Y.; Yang, Y.; San, L.; Hou, J. Chromosome-Level Genome Assembly of Red Sea Bream (Pagrus major) Reveals Integration of Heterospecific Sperm-Derived Genetic Material in Artificial Gynogenesis. Biomolecules 2025, 15, 1648. https://doi.org/10.3390/biom15121648
Liu M, Wang G, Ren Y, Zhang X, Li B, Zhang Y, Yang Y, San L, Hou J. Chromosome-Level Genome Assembly of Red Sea Bream (Pagrus major) Reveals Integration of Heterospecific Sperm-Derived Genetic Material in Artificial Gynogenesis. Biomolecules. 2025; 15(12):1648. https://doi.org/10.3390/biom15121648
Chicago/Turabian StyleLiu, Mingyang, Guixing Wang, Yuqin Ren, Xiaoyan Zhang, Bingbu Li, Yitong Zhang, Yucong Yang, Lize San, and Jilun Hou. 2025. "Chromosome-Level Genome Assembly of Red Sea Bream (Pagrus major) Reveals Integration of Heterospecific Sperm-Derived Genetic Material in Artificial Gynogenesis" Biomolecules 15, no. 12: 1648. https://doi.org/10.3390/biom15121648
APA StyleLiu, M., Wang, G., Ren, Y., Zhang, X., Li, B., Zhang, Y., Yang, Y., San, L., & Hou, J. (2025). Chromosome-Level Genome Assembly of Red Sea Bream (Pagrus major) Reveals Integration of Heterospecific Sperm-Derived Genetic Material in Artificial Gynogenesis. Biomolecules, 15(12), 1648. https://doi.org/10.3390/biom15121648

