Next Article in Journal
O-GlcNAcylation of Focal Adhesion Kinase Regulates Cell Adhesion, Migration, and Proliferation via the FAK/AKT Pathway
Previous Article in Journal
APOL1 Modulates Renin–Angiotensin System
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 14
Issue 12
10.3390/biom14121576
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Polymorphisms of KCNJ6 Gene and Their Correlation with Immune Indicators in Yaks (Bos grunniens)

by
Wenwen Ren
1,2,3,
Xiaoming Ma
1,2,
Daoning Yu
1,2,
Xiaoyun Wu
1,2,
Yongfu La
1,2,
Xian Guo
1,2,
Min Chu
1,2,
Ping Yan
1,2,
Xianyong Lan
3,* and
Chunnian Liang
1,2,*
1
Key Laboratory of Animal Genetics and Breeding on Tibetan Plateau, Ministry of Agriculture and Rural Affairs, Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou 730050, China
2
Key Laboratory of Yak Breeding Engineering of Gansu Province, Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou 730050, China
3
Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Xianyang 712100, China
*
Authors to whom correspondence should be addressed.
Biomolecules 2024, 14(12), 1576; https://doi.org/10.3390/biom14121576
Submission received: 6 November 2024 / Revised: 29 November 2024 / Accepted: 7 December 2024 / Published: 10 December 2024
(This article belongs to the Section Molecular Genetics)
Browse Figures
Versions Notes

Abstract

:
Yaks are crucial to local herders’ economy and agriculture. However, several diseases pose a significant threat to the health of yaks and cause substantial economic losses for herders. Therefore, studying the immune indicators and breeding of yaks has become an important task. This study aimed to investigate the association between single nucleotide polymorphisms (SNPs) of the G protein-activated inwardly rectifying K+ channel 2 (KCNJ6, GIRK2) gene and yak immune indicators, with the goal of identifying potential candidate molecular markers for yak breeding. In this study, we genotyped 192 healthy adult yaks and detected three SNPs (g163684421 C > T, g163688148 C > T, and g163690745 T > C) in the yak KCNJ6 gene. These SNPs were found to be distributed in the yak population. Subsequently, we performed a linkage disequilibrium analysis and found that the linkage disequilibrium levels of g163684421 C > T and g163690745 T > C were relatively high. Through a correlation analysis of yak KCNJ6 gene SNPs and immune indicators, we found that g163684421 C > T and g163690745 T > C were significantly associated with IgA, IgG, IgM, CRP, HP, IL-2, IL-4, IFN-γ, and TNF-α (p < 0.05), and the mutation of these SNPs leads to a decrease in yak immune indicators. On the other hand, g163688148 C > T was significantly associated with IgG, IL-4, IFN-γ, TNF-α, IgA, CRP, and HP (p < 0.05), and the mutation of this SNP leads to an increase in yak immune indicators. In conclusion, we identified SNPs associated with yak immune indicators and found that KCNJ6 gene polymorphisms can serve as candidate molecular markers for yak immune indicators. This study provides valuable genetic resources for marker-assisted selection in yak breeding. The results of this study are of great importance for the research on yak immune indicators and marker-assisted selection in yak breeding.

1. Introduction

G protein-activated inwardly rectifying K+ channels (GIRKs) belong to the KIR3 subfamily and are key regulators of neuronal excitability in the heart and neurons [1,2]. Upon activation of various G protein-coupled receptors, GIRK channels can hyperpolarize neurons, thereby modulating neuronal excitability through GIRK-mediated autoinhibition, slow synaptic potentiation, and fluid transmission. Consequently, GIRK channels may represent a valuable new therapeutic target [2]. There are four subunits of the GIRK channel in humans, designated as KIR3.1 (KCNJ3); KIR3.2 (KCNJ6, GIRK2); KIR3.3 (KCNJ9); and KIR3.4 (KCNJ5) [1,2]. KCNJ6 (GIRK2) is a subunit of GIRK that is widely enriched in the brain and is associated with various functions and pathologies, including learning and memory, motor coordination, and Down syndrome [3]. The KCNJ6 (GIRK2) gene encodes a G protein-controlled, ATP-sensitive inward-rectifying potassium channel, and the dominant mutations in the KCNJ6 (GIRK2) gene have been linked to Keppen–Lubinsky syndrome, a disorder characterized by lipodystrophy, severe developmental delay, intellectual disability, hypertension, hyperreflexia, and growth retardation [4]. Research has shown that a single nucleotide substitution in the KCNJ6 (GIRK2) gene can result in a change in the highly conserved Gly-Tyr-Gly sequence of the GIRK2 protein’s pore-forming region (H5) to Ser-Tyr-Gly, leading to the manifestation of Weaver-like symptoms [5,6].
The yak (Bos grunniens), known as the ‘boat of the plateau’, is a native mammal of high-altitude plateaus, primarily distributed in the Qinghai–Tibet Plateau and its adjacent high-altitude, low-oxygen areas. Through prolonged natural selection, yaks have developed the ability to adapt to harsh, high-altitude environments and possess remarkable resilience. Oxidative stress can cause damage in mammalian cells, leading to cell macromolecules and organ dysfunction; reduce production performance; and even infect various diseases [7]. Meanwhile, immune stress can also affect animal behavior, metabolism, and neurosecretion, ultimately leading to growth inhibition [8]. In the traditional livestock rearing system reliant on natural grazing, yak nutrition is heavily influenced by the seasonal fluctuations in forage yield and nutrient content. Insufficient forage supply or inadequate nutrient levels can lead to prolonged nutritional deficiencies in pregnant cows and newborn calves, ultimately resulting in stunted growth and development in yaks [9]. Furthermore, the challenging environmental conditions of high-altitude grasslands contribute to a higher incidence of disease in yak calves. Calves in sub-optimal health are particularly susceptible to growth and development delays.
Immune indicators provide valuable insights into an animal’s resistance to diseases. An animal’s ability to ward off illnesses is largely determined by the health and efficacy of its immune system. While blood components typically exhibit a stable profile under normal conditions, physiological or pathological changes in the animal’s body often lead to alterations in blood cell counts and morphology. Therefore, immunological parameters derived from blood components serve as crucial indicators for assessing and evaluating an animal’s immune status and overall health [10]. Therefore, immune indicators serve as a valuable reference point for assessing the disease resistance and overall health of yaks. By closely monitoring fluctuations in these indicators, potential immune system challenges can be identified promptly. This allows for the implementation of timely interventions to enhance their resistance to diseases, ultimately preventing and managing illnesses effectively. The aim of this study is to investigate whether genetic variations in the KCNJ6 gene contribute to the disease susceptibility of yaks in high-altitude environments and to explore the potential of immune indicators in assessing yak disease resistance and health status.

2. Materials and Methods

2.1. Ethics Approval

All the animal experiments were approved by the Lanzhou Institute of Animal Husbandry and Pharmaceutical Sciences of the Chinese Academy of Agricultural Sciences (CAAS), with grant number 1610322020018.

2.2. Sample Collection of Test Animals

Blood samples (5 mL each) were collected from 192 fasted 3–5-year-old Niangya female yaks at Tibet Niangya Yak Breeding Industry Development Limited Liability Company in Jiali County, Naqu City, Tibet Autonomous Region. These samples were collected into clean, clot-activation vacuum tubes and allowed to settle for 30 min before centrifugation at 3500 rpm for 10 min. The supernatant was carefully aspirated into PE tubes, sealed, and stored at −20 °C in a refrigerator.
Additionally, 5 mL of blood was collected from each yak into EDTA-K2 anticoagulant tubes. Upon completion of blood collection, the samples were thoroughly mixed, placed in a sampling box containing an ice pack, and transported promptly to a laboratory. Upon arrival, the samples were frozen at −20 °C for subsequent DNA extraction.

2.3. Detection of Immune Indicators

Immunoglobulin IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A); C-reaction protein (CRP) (MB-2161B); serum haptoglobin (HP) (MB-2158B); interleukin 2 (IL-2) (MB-4923B), interleukin 4 (IL-4) (MB-4904B), and interleukin 6 (IL-6) (MB-4905B); interferon-gamma (IFN-γ) (MB-4902B); and tumor necrosis factor-α (TNF-α) (MB-4838B) levels were measured using a double antibody one-step sandwich method, according to the detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., Yancheng, China.

2.4. Extraction of Blood Genomic DNA

Genomic DNA was extracted from the blood samples using a blood genomic DNA extraction kit from TianGen Biochemical Technology (Beijing) Co., Ltd., Beijing, China. The extracted DNA was then assessed for concentration and purity using a UV spectrophotometer. DNA with a concentration greater than 20 ng/µL and an OD260/OD280 ratio between 1.7 and 1.9 was considered suitable for the experiment. The extracted DNA was stored at −20 °C.

2.5. Primer Design

To specifically amplify the regions encompassing the g163684421 C > T, g163688148 C > T, and g163690745 T > C SNP loci on chromosome 1 (ensemble accession number: ENSBGRG00000003372) of the yak genome (LU_Bosgru_v3.0 version), primers were designed using the Primer5 software. The details of these forward and reverse primers, as listed in Table 1, were synthesized by Beijing Qingke Biotechnology Co., Ltd., Beijing, China.

2.6. PCR Amplification and Sequencing

A 25 µL PCR amplification system was assembled using the following components: the 2 × L-Exp Taq Master Mix (dye plus), 12.5 μL; RNase free water, 8.5 μL; an upstream primer, 1 μL; a downstream primer, 1 μL; and template DNA, 2 μL. The PCR amplification program consisted of the following steps: initial denaturation at 94 °C for 1 min, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 2 min. PCR products were subjected to electrophoresis on a 1% agarose gel. After confirmation of successful amplification via gel electrophoresis, the PCR products were sequenced using Sanger sequencing (JY-SPGT). Sequencing was performed by Beijing Qingsk Biotechnology Co., Ltd., Beijing, China. The bioanalysis software MEGA 11.0 was used to compare the sequencing results of PCR products and analyze the sequencing peak diagram, and the PARMS SNP genotyping technique was used to genotype the DNA of all samples.

2.7. Statistical Analysis

According to the genotyping results, the number of individuals with different genotypes at each locus was counted. Genotype and allele frequencies, the effective allele number (Ne), observed heterozygosity (He), polymorphism information content (PIC), and Hardy–Weinberg equilibrium were calculated using the Popgen32 software (V1.32). Associations between different genotypes and IgA, IgG, IgM, CRP, HP, IL-2, IL-4, IL-6, IFN-γ, and TNF-α levels were assessed using a general linear model analysis in the IBM SPSS Statistics 26 software (26.0.x). Results are expressed as “mean ± standard error”.

3. Results

3.1. Analysis of KCNJ6 Genotyping Results and Genetic Parameters in Yaks

The amplification products of g163684421C > T, g163688148C > T, and g163690745T > C SNP loci on chromosome 1 of yaks were detected by a 1% agarose gel. Clear bands without evidence of mixed amplification were observed. The specificity of the amplification was deemed good. Fragment sizes of 496 bp, 519 bp, and 408 bp were detected, aligning with the expected sizes, thus validating the amplicons for subsequent analysis. Figure 1 displays the sequencing chromatogram and sequence data of the purified PCR product. A visual inspection of Figure 1 clearly demonstrates the presence of the T-C mutations at the g163684421C > T, g163688148C > T, and g163690745T > C SNP loci. An analysis of the chromatograms revealed three genotypes, CC, CT, and TT, for each SNP locus.
The descriptive statistics of immune traits of 192 yaks are shown in Table 2. The genotype and allele frequencies for three SNPs (g163684421C > T, g163688148C > T, and g163690745T > C) located on chromosome 1 of the yak (based on the LU_Bosgru_v3.0 genome assembly) were analyzed using population genetics principles (Table 3). All loci had calculated PIC values between 0.25 and 0.50, were moderately polymorphic in the population analyzed, and had an MAF above 5%. The genotype distribution of all loci was in Hardy–Weinberg equilibrium.

3.2. Linkage Disequilibrium Analysis of KCNJ6 Gene SNP in Yaks

A linkage disequilibrium (LD) analysis of the g163684421 C > T, g163688148 C > T, and g163690745 T > C loci in the yak KCNJ6 gene was conducted using online tools (https://www.bioinformatics.com.cn/ (the last visit date was 17 October 2024)). The results show that g163684421 C > T and g163688148 C > T, g163684421 C > T and g163690745 T > C, and g163688148 C > T and g163690745 T > C had linkage disequilibrium. Furthermore, a relatively strong degree of LD was observed between g163684421 C > T and g163690745 T > C (Figure 2).

3.3. Association Analysis Between Immune Indicators and SNP Genotypes in Yaks

Correlations between different yak genotypes and immunoglobulin levels (IgA, IgG, IgM, CRP, HP, IL-2, IL-4, IL-6, IFN-γ, and TNF-α) were investigated using a general linear model in the IBM SPSS Statistics 26 software. The results show that the g163684421 C > T SNP locus was significantly associated with IgA, IgG, IgM, CRP, HP, IL-4, IFN-γ, TNF-α in yaks (p < 0.01) and was significantly associated with IL-2 (p < 0.05). Specifically, the CC genotype demonstrated significantly higher expression levels compared to the TT genotype for these immune markers. A significant association between the g163688148 C > T SNP locus and IgG, IL-4, IFN-γ, and TNF-α was observed (p < 0.01). Additionally, IgA, CRP, and HP showed significant associations with this locus (p < 0.05). Notably, the TT genotype exhibited significantly higher expression levels relative to the CC genotype for these immune markers. Significant associations existed between the g163690745 T > C SNP locus and IgA, CRP, HP, IL-4, IFN-γ, and TNF-α (p < 0.01). IgG, IgM, and IL-2 also exhibited significant associations with this locus (p < 0.05). The TT genotype demonstrated significantly higher expression levels compared to the CC genotype. These findings suggest that the three SNPs within the yak KCNJ6 gene play roles in regulating immune response. The nature of the association (increased or decreased immune index) differed depending on the specific SNP and genotype. (Table 4).

4. Discussion

4.1. Genetic Polymorphism Analysis of KCNJ6 Gene in Yaks

Genes and the environment interact to shape an organism’s phenotypic traits, and genetic diversity underpins the fundamental basis of immune function. Understanding immune-related factors is crucial for investigating immune responses and pathological changes in cattle during infectious and non-infectious diseases. Single nucleotide polymorphisms (SNPs) represent a primary type of candidate gene polymorphism, and SNP analysis has emerged as a powerful tool for identifying associations between candidate genes and economically important traits in livestock populations [11]. A higher PIC value indicates a greater number of alleles and heterozygous genotypes, signifying higher genetic variation and selection potential within the experimental population [12,13]. An analysis of the polymorphic information content (PIC) of the three loci revealed moderate polymorphism (0.25 < PIC < 0.5) for g163684421 C > T, g163688148 C > T, and g163690745 T > C. This suggests a high degree of variation and selection potential at these loci within the yak population. Furthermore, all three loci were found to be in Hardy–Weinberg equilibrium, indicating that these SNPs within the KCNJ6 (GIRK2) gene possess certain genetic advantages. They appear to be relatively unaffected by mutations, selective pressures, and genetic drift during long-term evolution and natural selection [14]. It is noteworthy that all three SNPs are located within intronic regions of the KCNJ6 (GIRK2) gene. Although intronic SNPs do not directly alter the amino acid sequence of a protein, they may indirectly influence biological processes like splicing sites, mRNA stability, or translation efficiency, potentially leading to changes in amino acid coding [15,16,17,18]. Intronic mutations have been shown to affect economically important traits in livestock, such as growth characteristics [19], fat accumulation [20], and feed efficiency [21]. Therefore, these SNPs can be considered potential candidate loci for genetic improvement in yaks.

4.2. Correlation Analysis of KCNJ6 Gene Polymorphisms and Immune Indicators in Yaks

An animal’s overall defense capabilities against diseases can be represented by general immune resistance. Cytokine levels indicate the body’s immune response status, indirectly reflecting the animal’s resistance to diseases [22]. Therefore, measuring cytokine levels in serum can offer an indirect reflection of the animal’s general immune resistance. Several crucial cytokines, such as interleukin and tumor necrosis factor, can assess an animal’s general immune resistance. Immunoglobulins (Ig) are essential components of the body’s defense against diseases. They are secreted by B lymphocytes in jawed vertebrates during humoral immunity, enabling the effective identification and elimination of antigens [23]. Mammals possess five Ig heavy-chain genes (μ, δ, γ, ε, and α) and two light-chain genes (κ and λ). The complete Ig molecule is formed by a combination of different heavy and light chains, designated as IgM, IgG, IgA, IgD, and IgE, respectively [24]. Helper T cells (Th) are categorized into Th1 and Th2 subsets. Th1 cells contribute to cell-mediated immunity, primarily producing IL-2 and IFN-γ. IFN-γ stimulates macrophages to generate large amounts of nitric oxide, directly killing pathogens [25]. TNF-α mediates the activation of NF-κB, which acts as a rapidly responding transcription factor, regulating the activation and expression of genes encoding pro-inflammatory cytokines, chemokines, and adhesion molecules [26,27,28]. C-reactive protein (CRP) is a quintessential acute-phase reactant with a cyclic pentameric structure. It is an ancient and highly conserved member of the pentraxin family. CRP directly participates in various inflammatory processes and contributes to the innate host immune response [29]. Furthermore, CRP serves as a sensitive marker of systemic inflammation and tissue damage, exhibiting elevated levels in patients with infections, inflammatory diseases, or necrosis [30]. Studies indicate that during the acute phase of inflammation, serum concentrations of acute-phase reactant proteins can rapidly increase from 2 to 3 times to hundreds of times [31]. Haptoglobin (HP), another acute-phase reactant, plays a vital role in the body’s response to infection, tissue damage repair, and maintaining internal homeostasis [32]. HP expression is primarily regulated by interleukin-6 (IL-6). When cows experience ketoacidosis, which exerts stress on the body, endotoxins stimulate white blood cells to produce interleukin-1 (IL-1) and interleukin-6 (IL-6). Hepatocytes express abundant haptoglobin receptors, and IL-6 promotes haptoglobin synthesis [33]. Research has shown that interleukin-4 (IL-4) exhibits immunomodulatory effects in various immune cells, including macrophages, B cells, and T cells. Its role is particularly significant in allergic inflammation [34]. IL-2 promotes the proliferation and differentiation of T and B lymphocytes and NK cells, facilitating the secretion of interferon (IFN) and tumor necrosis factor (TNF) cytokines. This boosts both cellular and humoral immune responses in animals [35]. In this study, we report that three polymorphic loci within the KCNJ6 (GIRK2) gene contribute to variations in immune parameters in yaks, namely, g163684421 C > T, g163688148 C > T, and g163690745 T > C. Moreover, g163684421 C > T and g163690745 T > C mutations resulted in reduced immune parameters in yaks, suggesting that these mutations may contribute to a decreased immune capacity. Conversely, the g163688148 C > T mutation led to increased immune parameters, indicating a potential enhancement in immune function. At present, most studies have shown that variations in the KCNJ6 gene are associated with persistent breast pain after breast cancer surgery, post-operative analgesia, and pain sensitivity [36,37]. But there are no reports on other species. Collectively, these findings highlight that the three SNPs within the KCNJ6 gene exert diverse and significant effects on immune parameters in yaks.

5. Conclusions

This study preliminarily investigated the impact of three SNPs in the KCNJ6 gene of yaks on immune indicators. The results demonstrate a significant correlation between these three SNPs and yak immune parameters. Specifically, the g163684421 C > T and g163690745 T > C mutations were associated with decreased immune indices in yaks, while the g163688148 C > T mutation led to increased immune indices. These findings suggest that the KCNJ6 gene may serve as a potential candidate gene influencing immune parameters in yaks. This study lays a theoretical foundation for yak disease prevention and treatment, as well as the breeding of yak breeds with enhanced disease resistance.

Author Contributions

Conceptualization, W.R., P.Y., X.L., and C.L.; data curation, W.R., X.M., D.Y., and X.W.; funding acquisition, C.L.; investigation, W.R., Y.L., X.G., and M.C.; methodology, W.R.; project administration, C.L.; supervision, P.Y., X.L., and C.L.; writing—original draft, W.R.; writing—review and editing, W.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a project of the Tibet Autonomous Region, which focuses on the research and development of ‘Tibet Wild Blood Yak and Jila Yak, quality innovation and utilization’ (XZ202402ZY0012); the Tibet Autonomous Region Regional Science and Technology Collaborative Innovation Project (QYXTZX-NQ2022-04); the modern beef yak industry technology system, grant number MATS-Beef Cattle System (CARS-37); and the Yak resources and breeding innovation project of the Chinese Academy of Agricultural Sciences (25-LIHPS-01).

Institutional Review Board Statement

All the animal experiments were approved by the Lanzhou Institute of Animal Husbandry and Pharmaceutical Sciences of the Chinese Academy of Agricultural Sciences (CAAS) (Approval No. 1610322020018, 26 November 2023).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, and further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hibino, H.; Inanobe, A.; Furutani, K.; Murakami, S.; Findlay, I.; Kurachi, Y. Inwardly rectifying potassium channels: Their structure, function, and physiological roles. Physiol. Rev. 2010, 90, 291–366. [Google Scholar] [CrossRef] [PubMed]
  2. Luescher, C.; Slesinger, P.A. Emerging roles for G protein-gated inwardly rectifying potassium (GIRK) channels in health and disease. Nat. Rev. Neurosci. 2010, 11, 301–315. [Google Scholar] [CrossRef] [PubMed]
  3. Cooper, A.; Grigoryan, G.; Guy-David, L.; Tsoory, M.M.; Chen, A.; Reuveny, E. Trisomy of the G protein-coupled K+ channel gene, Kcnj6, affects reward mechanisms, cognitive functions, and synaptic plasticity in mice. Proc. Natl. Acad. Sci. USA 2012, 109, 2642–2647. [Google Scholar] [CrossRef] [PubMed]
  4. Horvath, G.A.; Zhao, Y.; Tarailo-Graovac, M.; Boelman, C.; Gill, H.; Shyr, C.; Lee, J.; Blydt-Hansen, I.; Drogemoller, B.I.; Moreland, J.; et al. Gain-of-function KCNJ6 Mutation in a Severe Hyperkinetic Movement Disorder Phenotype. Neuroscience 2018, 384, 152–164. [Google Scholar] [CrossRef]
  5. Doupnik, C.A.; Davidson, N.; Lester, H.A. The inward rectifier potassium channel family. Curr. Opin. Neurobiol. 1995, 5, 268–277. [Google Scholar] [CrossRef]
  6. Patil, N.; Cox, D.R.; Bhat, D.; Faham, M.; Myers, R.M.; Peterson, A.S. A potassium channel mutation in weaver mice implicates membrane excitability in granule cell differentiation. Nat. Genet. 1995, 11, 126–129. [Google Scholar] [CrossRef]
  7. Askew, E.W. Environmental and physical stress and nutrient requirements. Am. J. Clin. Nutr. 1995, 61, 631S–637S. [Google Scholar] [CrossRef]
  8. Wang, Y.J.; Wang, Z.S.; Hu, R.; Peng, Q.H.; Xia, K.; Zhao, S.N.; Zhou, Y.Q. Effects of Different Nutritional Regulations on Growth and Development, Blood Routine, and Plasma Antioxidant and Immune Indexes of Yaks with Growth Retardation. Chin. J. Anim. Nutr. 2018, 30, 1344–1352. [Google Scholar]
  9. Wang, Y.X.; Hu, R.; Wang, H.Z.; Wei, X.Q.; Jing, X.P.; Xue, B.; Cao, B.H.; Wang, Z.S.; Bao, S.K.; Zhao, S.N.; et al. Effects of Different Nutritional Regulations on Body Measurements and Gastrointestinal Tract Development of Yaks with Growth Retardation. Chin. J. Anim. Nutr. 2015, 27, 1690–1697. [Google Scholar]
  10. Xu, J.G.; Wang, C.L.; Che, C.Y.; Cai, Z.H.; Li, S.H.; Zhang, Q. Expression Profile and Polymorphism of CD8B Gene and Its Association with Blood Immune Traits in Pigs (Sus scrofa). J. Agric. Biotechnol. 2016, 24, 357–365. [Google Scholar]
  11. Gui, L.; Raza, S.; Sun, Y.; Sabek, A.; Abbas, S.Q.; Shah, M.A.; Khan, R.; Abdelnour, S.A. Molecular characterization and analysis of the association of growth hormone 1 gene with growth traits in Chinese indigenous yak (Bos grunniens). Trop. Anim. Health Prod. 2021, 53, 221. [Google Scholar] [CrossRef] [PubMed]
  12. Lefevre, F.; Gallais, A. Partitioning heterozygosity in subdivided populations: Some misuses of Nei’s decomposition and an alternative probabilistic approach. Mol. Ecol. 2020, 29, 2957–2962. [Google Scholar] [CrossRef] [PubMed]
  13. Serrote, C.; Reiniger, L.; Silva, K.B.; Rabaiolli, S.; Stefanel, C.M. Determining the Polymorphism Information Content of a molecular marker. Gene 2020, 726, 144175. [Google Scholar] [CrossRef] [PubMed]
  14. Zintzaras, E. Impact of Hardy-Weinberg equilibrium deviation on allele-based risk effect of genetic association studies and meta-analysis. Eur. J. Epidemiol. 2010, 25, 553–560. [Google Scholar] [CrossRef] [PubMed]
  15. Bionaz, M.; Loor, J.J. ACSL1, AGPAT6, FABP3, LPIN1, and SLC27A6 are the most abundant isoforms in bovine mammary tissue and their expression is affected by stage of lactation. J. Nutr. 2008, 138, 1019–1024. [Google Scholar] [CrossRef]
  16. Gupta, S.K.; Carmi, S.; Waldman, B.H.; Tkacz, I.D.; Naboishchikov, I.; Michaeli, S. Basal splicing factors regulate the stability of mature mRNAs in trypanosomes. J. Biol. Chem. 2013, 288, 4991–5006. [Google Scholar] [CrossRef] [PubMed]
  17. Sharma, Y.; Miladi, M.; Dukare, S.; Boulay, K.; Caudron-Herger, M.; Gross, M.; Backofen, R.; Diederichs, S. A pan-cancer analysis of synonymous mutations. Nat. Commun. 2019, 10, 2569. [Google Scholar] [CrossRef]
  18. Zhang, Z.; Liu, C.; Hao, W.; Yin, W.; Ai, S.; Zhao, Y.; Duan, Z. Novel Single Nucleotide Polymorphisms and Haplotype of MYF5 Gene Are Associated with Body Measurements and Ultrasound Traits in Grassland Short-Tailed Sheep. Genes 2022, 13, 483. [Google Scholar] [CrossRef]
  19. Ma, X.; Guan, L.; Xuan, J.; Wang, H.; Yuan, Z.; Wu, M.; Liu, R.; Zhu, C.; Wei, C.; Zhao, F.; et al. Effect of polymorphisms in the CAMKMT gene on growth traits in Ujumqin sheep. Anim. Genet. 2016, 47, 618–622. [Google Scholar] [CrossRef]
  20. Cui, P.; Wang, W.; Zhang, D.; Li, C.; Huang, Y.; Ma, Z.; Wang, X.; Zhao, L.; Zhang, Y.; Yang, X.; et al. Identification of TRAPPC9 and BAIAP2 Gene Polymorphisms and Their Association With Fat Deposition-Related Traits in Hu Sheep. Front. Vet. Sci. 2022, 9, 928375. [Google Scholar] [CrossRef]
  21. Ma, Z.; Wang, W.; Zhang, D.; Zhang, Y.; Zhao, Y.; Li, X.; Zhao, L.; Cheng, J.; Xu, D.; Yang, X.; et al. Polymorphisms of PLIN1 and MOGAT1 genes and their association with feed efficiency in Hu sheep. Gene 2024, 897, 148072. [Google Scholar] [CrossRef] [PubMed]
  22. Xia, R.W.; Sun, L.; Yin, X.M.; Cheng, H.Q.; Wu, S.L.; Bao, W.B. Assessment Model of General Disease Resistance in Yorkshire Based on Principal Component Analysis. China Anim. Husb. Vet. Med. 2015, 42, 986–990. [Google Scholar] [CrossRef]
  23. Lei, Y.C.; Wang, Z.T.; Jiang, J.Y.; Wang, S.H.; Sun, X.Z. Advances on Expression Profile and Diversity Mechanisms of Immunoglobulins in Herbivore. China Anim. Husb. Vet. Med. 2023, 50, 3313–3324. [Google Scholar] [CrossRef]
  24. Woof, J.M. Immunoglobulins and their receptors, and subversion of their protective roles by bacterial pathogens. Biochem. Soc. Trans. 2016, 44, 1651–1658. [Google Scholar] [CrossRef] [PubMed]
  25. Zhu, W.H. Poylmorphisms of Porcine TLR4 Gene and Their Associations with Immune Indexes in Weaned Piglets. Master’s Thesis, Anhui Agricultural University, Hefei, China, 2014. [Google Scholar]
  26. Baeuerle, P.A.; Henkel, T. Function and activation of NF-kappa B in the immune system. Annu. Rev. Immunol. 1994, 12, 141–179. [Google Scholar] [CrossRef] [PubMed]
  27. Campbell, K.J.; Perkins, N.D. Regulation of NF-kappaB function. Biochem. Soc. Symp. 2006, 73, 165–180. [Google Scholar] [CrossRef]
  28. Lv, Q.X.; Zhang, S.X.; Zhao, R.Q. Effects of transportation stress on transcription of IL-2, IL-6 and IL-10 and the relative receptors mRNA of lymph nodes in pig. J. Nanjing Agric. Univ. 2011, 34, 95–100. [Google Scholar]
  29. Stein, M.P.; Edberg, J.C.; Kimberly, R.P.; Mangan, E.K.; Bharadwaj, D.; Mold, C.; Du Clos, T.W. C-reactive protein binding to FcgammaRIIa on human monocytes and neutrophils is allele-specific. J. Clin. Investig. 2000, 105, 369–376. [Google Scholar] [CrossRef]
  30. Pepys, M.B. C-reactive protein: The role of an ancient protein in modern rheumatology. Clin. Exp. Rheumatol. 1983, 1, 3–7. [Google Scholar]
  31. Heegaard, P.M.; Godson, D.L.; Toussaint, M.J.; Tjornehoj, K.; Larsen, L.E.; Viuff, B.; Ronsholt, L. The acute phase response of haptoglobin and serum amyloid A (SAA) in cattle undergoing experimental infection with bovine respiratory syncytial virus. Vet. Immunol. Immunopathol. 2000, 77, 151–159. [Google Scholar] [CrossRef]
  32. Tan, L.N.; Huang, J.H. Recent advances in the investigation of haptoglobin. J. Clin. Pathol. Res. 2006, 26, 43–47. [Google Scholar]
  33. Hao, J.F.; Wang, J.G.; Zhu, X.Y.; Yang, W.T.; Ding, H.Y.; Shi, X.X.; Song, Y.X.; Deng, Q.H.; Liu, Z.X.; Wang, L.; et al. Comparative study of haptoglobin and serum amyloid A protein in the serum of healthy dairy cows and cows with ketosis. Chin. J. Vet. Med. 2013, 49, 9–11. [Google Scholar]
  34. Du, X.M.; Sheng, S.S.; Qiao, S.W.; Chen, X.L.; Dong, L.Y.; Wu, Z.C. Detection of new mutation sites of TLR5 gene in Large White pigs and its association with some immune indexes. Swine Ind. Sci. 2022, 39, 103–105. [Google Scholar]
  35. Malek, T.R. The main function of IL-2 is to promote the development of T regulatory cells. J. Leukoc. Biol. 2003, 74, 961–965. [Google Scholar] [CrossRef]
  36. Nishizawa, D.; Fukuda, K.; Kasai, S.; Ogai, Y.; Hasegawa, J.; Sato, N.; Yamada, H.; Tanioka, F.; Sugimura, H.; Hayashida, M.; et al. Association between KCNJ6 (GIRK2) gene polymorphism rs2835859 and post-operative analgesia, pain sensitivity, and nicotine dependence. J. Pharmacol. Sci. 2014, 126, 253–263. [Google Scholar] [CrossRef]
  37. Kober, K.M.; Dodd, M.J.; Miaskowski, C.; Aouizerat, B.E. Variations in potassium channel genes are associated with distinct trajectories of persistent breast pain after breast cancer surgery. Pain 2015, 156, 371–380. [Google Scholar] [CrossRef]
Biomolecules 14 01576 g001
Figure 1. PCR amplification products and peak maps of three SNPs of KCNJ6 gene. Note: (a) electrophoresis image for the g163684421 C > T SNP locus. (b) Fragment analysis showing the three genotypes for the g163684421 C > T SNP. (c) Electrophoresis image for the g163688148 C > T SNP locus. (d) Fragment analysis showing the three genotypes for the g163688148 C > T SNP. (e) Electrophoresis image for the g163690745 T > C SNP locus. (f) Fragment analysis showing the three genotypes for the g163690745 T > C SNP.
Figure 1. PCR amplification products and peak maps of three SNPs of KCNJ6 gene. Note: (a) electrophoresis image for the g163684421 C > T SNP locus. (b) Fragment analysis showing the three genotypes for the g163684421 C > T SNP. (c) Electrophoresis image for the g163688148 C > T SNP locus. (d) Fragment analysis showing the three genotypes for the g163688148 C > T SNP. (e) Electrophoresis image for the g163690745 T > C SNP locus. (f) Fragment analysis showing the three genotypes for the g163690745 T > C SNP.
Biomolecules 14 01576 g001
Biomolecules 14 01576 g002
Figure 2. Linkage disequilibrium analysis among three SNPs of KCNJ6 gene.
Figure 2. Linkage disequilibrium analysis among three SNPs of KCNJ6 gene.
Biomolecules 14 01576 g002
Table 1. Primer information.
Table 1. Primer information.
SNPsPrimer Pair Sequences 1 (5′-3′)Amplicon Length (bp)Tm (°C)
g163684421 C > TF: GCAGCAGGTCCGTCCACAT49661.2
R: GTAGCCCATCCAGGCCACA
g163688148 C > TF: ACTAAGATCCCATGAGCCA51952.4
R: ATTGAATGAGACACCACCAG
g163690745 T > CF: GCGACCTCCTCATTCTCCT40854.3
R: TGTACCTTCTTCCACCCAC
Table 2. Descriptive statistics of yak immune traits.
Table 2. Descriptive statistics of yak immune traits.
TraitMeanStandard ErrorMaximumMinimum
IgA (μg/mL)1155.2213.982163.35538.09
IgG (mg/mL)2.380.055.130.19
IgM (μg/mL)2112.4220.913247.17929.93
CRP (mg/L)13.500.1621.043.67
HP (ng/mL)399.704.37641.62167.36
IL-2 (pg/mL)310.374.06542.28132.27
IL-4 (pg/mL)67.321.11100.1013.27
IL-6 (pg/mL)433.275.23706.11162.48
IFN-γ (pg/mL)1742.2218.372664.85567.67
TNF-α (pg/mL)80.730.90117.1029.43
Table 3. Three SNP markers of yak KCNJ6 gene and description of related population parameters.
Table 3. Three SNP markers of yak KCNJ6 gene and description of related population parameters.
SNPsPositionGenotypic FrequenciesAllelic Frequenciesχ2pPICHeNe
CCCTTTCT
g163684421 C > TIntron0.2390.4260.3350.4520.5483.7410.0530.3730.4951.982
g163688148 C > TIntron0.4480.4220.1300.6590.3410.7270.3940.3480.4491.816
g163690745 T > CIntron0.3110.4420.2470.5320.4682.3940.1220.3740.4981.992
Table 4. Correlation analysis between three SNPs of KCNJ6 gene and immune traits of yaks.
Table 4. Correlation analysis between three SNPs of KCNJ6 gene and immune traits of yaks.
TraitGenotypep-Value
CCCTTT
g163684421 C > T
IgA (μg/mL)1232.96 ± 34.57 a1155.69 ± 18.71 b1096.92 ± 22.46 b0.001 **
IgG (mg/mL)2.67 ± 0.10 a2.29 ± 0.07 b2.26 ± 0.08 b0.002 **
IgM (μg/mL)2207.93 ± 42.35 a2112.79 ± 28.10 ab2041.07 ± 40.25 b0.013 **
CRP (mg/L)14.32 ± 0.32 a13.60 ± 0.20 a12.76 ± 0.29 b0.001 **
HP (ng/mL)426.39 ± 9.26 a399.08 ± 5.37 b379.95 ± 8.62 b<0.001 **
IL-2 (pg/mL)320.35 ± 10.18 a315.57 ± 5.52 a294.49 ± 6.24 b0.025 *
IL-4 (pg/mL)70.51 ± 2.32 a70.47 ± 1.46 a61.25 ± 2.06 b<0.001 **
IL-6 (pg/mL)446.14 ± 12.58434.21 ± 7.31421.68 ± 8.870.218
IFN-γ (pg/mL)1894.67 ± 38.02 a1732.04 ± 21.35 b1648.00 ± 35.62 b<0.001 **
TNF-α (pg/mL)83.28 ± 1.83 a82.94 ± 1.22 a75.98 ± 1.66 b0.001 **
g163688148 C > T
IgA (μg/mL)1119.21 ± 19.01 b1169.21 ± 22.05 ab1233.76 ± 42.62 a0.023 *
IgG (mg/mL)2.28 ± 0.07 b2.35 ± 0.06 b2.78 ± 0.16 a0.003 **
IgM (μg/mL)2069.59 ± 32.822129.82 ± 30.652203.38 ± 52.870.098
CRP(mg/L)13.05 ± 0.22 b13.70 ± 0.24 ab14.38 ± 0.43 a0.013 *
HP (ng/mL)389.72 ± 6.51 b401.84 ± 6.86 b426.72 ± 9.89 a0.024 *
IL-2 (pg/mL)300.68 ± 4.98320.81 ± 6.86309.85 ± 13.040.069
IL-4 (pg/mL)63.57 ± 1.61 b70.47 ± 1.65 a69.99 ± 3.25 a0.009 **
IL-6 (pg/mL)429.15 ± 7.32432.87 ± 8.39448.56 ± 15.630.500
IFN-γ (pg/mL)1671.79 ± 27.44 b1763.28 ± 26.55 b1916.24 ± 42.43 a<0.001 **
TNF-α (pg/mL)77.71 ± 1.33 b83.42 ± 1.34 ab82.42 ± 2.44 a0.009 **
g163690745 T > C
IgA (μg/mL)1225.55 ± 32.19 a1153.40 ± 20.09 b1100.64 ± 22.19 b0.004 **
IgG (mg/mL)2.61 ± 0.10 a2.30 ± 0.07 b2.30 ± 0.08 b0.018 *
IgM (μg/mL)2197.82 ± 39.71 a2103.37 ± 30.74 ab2051.51 ± 39.65 b0.034 *
CRP (mg/L)14.36 ± 0.30 a13.49 ± 0.23 b12.82 ± 0.28 b0.001 **
HP (ng/mL)423.74 ± 7.70 a396.82 ± 6.47 b385.48 ± 8.36 b0.004 **
IL-2 (pg/mL)324.88 ± 10.04 a312.49 ± 5.88 ab295.09 ± 5.96 b0.023 *
IL-4 (pg/mL)69.93 ± 2.15 a69.40 ± 1.67 a61.74 ± 1.94 b0.004 **
IL-6 (pg/mL)449.09 ± 11.40430.54 ± 7.76425.15 ± 9.050.215
IFN-γ(pg/mL)1890.97 ± 33.34 a1721.55 ± 24.24 b1658.28 ± 35.59 b<0.001 **
TNF-α(pg/mL)84.49 ± 1.68 a81.65 ± 1.34 a76.20 ± 1.58 b0.002 **
Note: a,b denote significance at p < 0.05. * denotes significance at p < 0.05, ** denotes significance at p < 0.01.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ren, W.; Ma, X.; Yu, D.; Wu, X.; La, Y.; Guo, X.; Chu, M.; Yan, P.; Lan, X.; Liang, C. Polymorphisms of KCNJ6 Gene and Their Correlation with Immune Indicators in Yaks (Bos grunniens). Biomolecules 2024, 14, 1576. https://doi.org/10.3390/biom14121576

AMA Style

Ren W, Ma X, Yu D, Wu X, La Y, Guo X, Chu M, Yan P, Lan X, Liang C. Polymorphisms of KCNJ6 Gene and Their Correlation with Immune Indicators in Yaks (Bos grunniens). Biomolecules. 2024; 14(12):1576. https://doi.org/10.3390/biom14121576

Chicago/Turabian Style

Ren, Wenwen, Xiaoming Ma, Daoning Yu, Xiaoyun Wu, Yongfu La, Xian Guo, Min Chu, Ping Yan, Xianyong Lan, and Chunnian Liang. 2024. "Polymorphisms of KCNJ6 Gene and Their Correlation with Immune Indicators in Yaks (Bos grunniens)" Biomolecules 14, no. 12: 1576. https://doi.org/10.3390/biom14121576

APA Style

Ren, W., Ma, X., Yu, D., Wu, X., La, Y., Guo, X., Chu, M., Yan, P., Lan, X., & Liang, C. (2024). Polymorphisms of KCNJ6 Gene and Their Correlation with Immune Indicators in Yaks (Bos grunniens). Biomolecules, 14(12), 1576. https://doi.org/10.3390/biom14121576

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop