Study on the Effect of Phillyrin on Streptococcus suis In Vivo and In Vitro
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture, Bacterial Strains, and Compounds
2.2. Susceptibility Testing and Growth Characteristic Analysis
2.3. Electron Microscope Observation of Bacterial Integrity
2.4. DNA Exosmosis Determination
2.5. Biofilm Formation Detection Assay
2.6. Determination of Hemolytic Activity
2.7. Calcein/PI Cell Activity Assay
2.8. Cytotoxicity Assay
2.9. Live/Dead Cell Staining Test
2.10. LDH Detection Assay
2.11. Adherence Assay
2.12. Real-Time PCR Analysis
2.13. Animal Experiment
2.14. Molecular Docking Assay
2.15. Statistical Analysis
3. Results
3.1. Phillyrin Inhibits the Growth of SS2 In Vitro
3.2. Phillyrin Increases DNA Exosmosis of SS2
3.3. Phillyrin Inhibits the Secretion of Hemolysin from SS2 Dose-Dependently
3.4. Phillyrin Has a Protective Effect and No Cytotoxicity on NPTr Cells
3.5. Phillyrin Reduces the Adherence Ability of SS2 to NPTr Cells
3.6. Phillyrin Reduces Damage of Cell Tight Junction Protein by SS2
3.7. Phillyrin Affected Gene Expression Levels of SS2
3.8. Effect of Phillyrin on Mice Infected by SS2
3.9. Binding Site of Phillyrin to SLY of SS2 Revealed by Molecular Docking
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gottschalk, M. Streptococcal diseases. In Diseases of Swine; Straw, B.E., Ed.; Blackwell Pub.: Ames, IA, USA, 2006; pp. 769–783. [Google Scholar]
- Lacouture, S.; Okura, M.; Takamatsu, D.; Corsaut, L.; Gottschalk, M. Developmentofa mismatchamplifica tion mutation assay to correctly serotype isolates of Streptococcus suis serotypes 1, 2, 1/2, and 14. J. Vet. DiagnInvest. 2020, 32, 490–494. [Google Scholar]
- Kerdsin, A.; Segura, M.; Fittipaldi, N.; Gottschalk, M. Sociocultural Factors Influencing Human Streptococcus suis Disease in Southeast Asia. Foods 2022, 11, 1190. [Google Scholar] [CrossRef]
- Lun, Z.R.; Wang, Q.P.; Chen, X.G.; Li, A.X.; Zhu, X.Q. Streptococcus suis: An emerging zoonotic pathogen. Lancet. Infect. Dis. 2007, 7, 201–209. [Google Scholar] [CrossRef] [PubMed]
- Gottschalk, M.; Xu, J.; Calzas, C.; Segura, M. Streptococcus suis: A new emerging or an old neglected zoonotic pathogen? Future. Microbiol. Mar. 2010, 5, 371–391. [Google Scholar] [CrossRef] [PubMed]
- Nutravong, T.; Angkititrakul, S.; Jiwakanon, N.; Wongchanthong, W.; Dejsirilerts, S.; Nawa, Y. Identification of major Streptococcus suis serotypes 2, 7, 8 and 9 isolated from pigs and humans in upper northeastern Thailand Southeast Asian. J. Trop. Med. Public Health 2014, 45, 173–1181. [Google Scholar]
- Goyette-Desjardins, G.; Auger, J.P.; Xu, J.; Segura, M.; Gottschalk, M. Streptococcus suis, an important pig pathogen andemerging zoonoticagent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg. Microbes Infect. 2014, 3, e45. [Google Scholar] [CrossRef] [PubMed]
- Wei, Z.; Li, R.; Zhang, A.; He, H.; Hua, Y.; Xia, J.; Cai, X.; Chen, H.; Jin, M. Characterization of Streptococcus suis isolates from the diseased pigs in China between 2003 and 2007. Vet. Microbiol. 2009, 137, 196–201. [Google Scholar] [CrossRef]
- Lunha, K.; Chumpol, W.; Samngamnim, S.; Jiemsup, S.; Assavacheep, P.; Yongkiettrakul, S. Antimicrobial susceptibility of Streptococcus suis isolated from diseased pigs in Thailand, 2018–2020. Antibiotics 2022, 11, 410. [Google Scholar] [CrossRef]
- Chen, C.; Tang, J.; Dong, W.; Wang, C.; Feng, Y.; Wang, J.; Zheng, F.; Pan, X.; Liu, D.; Li, M.; et al. A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates. PLoS ONE 2007, 2, e315. [Google Scholar] [CrossRef]
- Taniyama, D.; Sakurai, M.; Sakai, T.; Kikuchi, T.; Takahashi, T. Human case of bacteremia due to Streptococcus suis serotype 5 in Japan: The first report and literature review. IDCases 2016, 6, 36–38. [Google Scholar] [CrossRef]
- Huong, V.T.; Ha, N.; Huy, N.T.; Horby, P.; Nghia, H.D.; Thiem, V.D.; Zhu, X.; Hoa, N.T.; Hien, T.T.; Zamora, J.; et al. Epidemiology, clinical manifestations, and outcomes of Streptococcus suis infection in humans. Emerg. Infect. Dis. 2014, 20, 1105–1114. [Google Scholar] [CrossRef] [PubMed]
- Ip, M.; Fung, K.S.C.; Chi, F.; Cheuk, E.S.C.; Chau, S.S.L.; Wong, B.W.H.; Lui, S.L.; Hui, M.; Lai, R.W.M.; Chan, P.K.S. Streptococcus suis in Hong Kong. Diagn. Microbiol. Infect. Dis. 2007, 57, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Mai, N.T.; Hoa, N.T.; Nga, T.V.; Linh le, D.; Chau, T.T.; Sinh, D.X.; Phu, N.H.; Chuong, L.V.; Diep, T.S.; Campbell, J.; et al. Streptococcus suis meningitis in adults in Vietnam. Clin. Infect. Dis. 2008, 46, 659–667. [Google Scholar] [PubMed]
- Suankratay, C.; Intalapaporn, P.; Nunthapisud, P.; Arunyingmongkol, K.; Wilde, H. Streptococcus suis meningitis in Thailand. Southeast Asian J. Trop. Med. Public Health 2004, 35, 868–876. [Google Scholar]
- Arai, S.; Tohya, M.; Yamada, R.; Osawa, R.; Nomoto, R.; Kawamura, Y.; Sekizaki, T. Development of loop-mediated isothermal amplification to detect Streptococcus suis and its application to retail pork meat in Japan. Int. J. Food. Microbiol. 2015, 208, 35–42. [Google Scholar] [CrossRef]
- Nghia, H.D.; Tu le, T.P.; Wolbers, M.; Thai, C.Q.; Hoang, N.V.; Nga, T.V.; Thao le, T.P.; Phu, N.H.; Chau, T.T.; Sinh, D.X.; et al. Risk factors of Streptococcus suis infection in Vietnam. A case–control study. PLoS ONE 2011, 3, e17604. [Google Scholar]
- Pachirat, O.; Taksinachanekit, S.; Mootsikapun, P.; Kerdsin, A. Human Streptococcus suis endocarditis: Echocardiographic features and clinical outcome. Clin. Med. Insights Cardiol. 2012, 6, 119–123. [Google Scholar] [CrossRef]
- Segura, M.; Aragon, V.; Brockmeier, S.L.; Gebhart, C.; Greeff, A.; Kerdsin, A.; O’Dea, M.A.; Okura, M.; Saléry, M.; Schultsz, C.; et al. Update on Streptococcus suis Research and Prevention in the Era of Antimicrobial Restriction: 4th International Workshop on S. suis. Pathogens 2020, 9, 374. [Google Scholar] [CrossRef]
- Segura, M. Streptococcus suis vaccines: Candidate antigens and progress. Expert. Rev. Vaccines 2015, 14, 1587–1608. [Google Scholar] [CrossRef]
- Weisse, C.; Dittmar, D.; Jakobczak, B.; Florian, V.; Schutze, N.; Alber, G.; Klose, K.; Michalik, S.; Valentin-Weigand, P.; Völker, U.; et al. Immunogenicity and protective efficacy of a Streptococcus suis vaccine composed of six conserved immunogens. Vet. Res. 2021, 52, 112. [Google Scholar] [CrossRef]
- Dolbec, D.; Lehoux, M.; de Beauville, A.A.; Zahn, A.; Di Noia, J.M.; Segura, M. Unmutated but T cell dependent IgM antibodies targeting Streptococcus suis play an essential role in bacterial clearance. PLoS Pathog. 2024, 20, e1011957. [Google Scholar] [CrossRef] [PubMed]
- Mascellino, M.T. Multi-Drug-Resistant Gram-Negative Microorganisms: Epidemiology, Treatment and Alternative Approach. Antibiotics 2022, 11, 678. [Google Scholar] [CrossRef] [PubMed]
- Uruén, C.; García, C.; Fraile, L.; Tommassen, J.; Arenas, J. How Streptococcus suis escapes antibiotic treatments. Vet. Res. 2022, 53, 91. [Google Scholar] [CrossRef] [PubMed]
- Grenier, D.; Grignon, L.; Gottschalk, M. Characterisation of biofilm formation by a Streptococcus suis meningitis isolate. Vet. J. 2009, 179, 292–295. [Google Scholar] [CrossRef] [PubMed]
- Mateo, E.M.; Jiménez, M. Silver Nanoparticle-Based Therapy: Can It Be Useful to Combat Multi-Drug Resistant Bacteria? Antibiotics 2022, 11, 1205. [Google Scholar] [CrossRef]
- de Jong, A.; Morrissey, I.; Rose, M.; Temmerman, R.; Klein, U.; Simjee, S.; El Garch, F. Antimicrobial susceptibility among respiratory tract pathogens isolated from diseased cattle and pigs from different parts of Europe. J. Appl. Microbiol. 2023, 134, lxad132. [Google Scholar] [CrossRef]
- Dechene-Tempier, M.; Jouy, E.; Bayon-Auboyer, M.H.; Bougeard, S.; Chauvin, C.; Libante, V.; Payot, S.; Marois-Crehan, C. Antimicrobial resistance profiles of Streptococcus suis isolated from pigs, wild boars, and humans in France between 1994 and 2020. J. Clin. Microbiol. 2023, 61, e0016423. [Google Scholar] [CrossRef]
- Tan, M.F.; Tan, J.; Zeng, Y.B.; Li, H.Q.; Yang, Q.; Zhou, R. Antimicrobial resistance phenotypes and genotypes of Streptococcus suis isolated from clinically healthy pigs from 2017 to 2019 in Jiangxi Province, China. J. Appl. Microbiol. 2021, 130, 797–806. [Google Scholar] [CrossRef]
- Jiang, Q.; Chen, J.; Long, X.; Yao, X.; Zou, X.; Yang, Y.; Huang, G.; Zhang, H. Phillyrin protects mice from traumatic brain injury by inhibiting the inflammation of microglia via PPAR gamma signaling pathway. Int. Immunopharmacol. 2020, 79, 106083. [Google Scholar] [CrossRef]
- Zhang, H.; Wu, Z.; Wang, S.; Cao, M.; Hu, D.; Wang, C. Streptococcus suis infection: An emerging/reemerging challenge of bacterial infectious diseases? Virulence 2014, 5, 477–497. [Google Scholar]
- Zhou, S.; Zhang, A.; Chu, W. Phillyrin is an effective inhibitor of quorum sensing with potential as an anti-Pseudomonas aeruginosa infection therapy. J. Vet. Med. Sci. Mar. 2019, 81, 473–479. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Bao, L.; Shi, Z.; Xv, X.; Jiang, D.; You, L. Phillyrin alleviates high glucose-induced oxidative stress and inflammation in HBZY-1 cells through inhibition of the PI3K/Akt signaling pathway. J. Pharm. Pharmacol. 2024, 76, 776–787. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Sun, F.; Zhu, J.; Qi, J.; Wang, W.; Liu, Z.; Li, W.; Liu, C.; Liu, X.; Wang, N.; et al. Phillyrin ameliorates influenza a virus-induced pulmonary inflammation by antagonizing CXCR2 and inhibiting NLRP3 inflammasome activation. Virol. J. 2023, 20, 262. [Google Scholar] [CrossRef] [PubMed]
- Tenenbaum, T.; Asmat, T.M.; Seitz, M.; Schroten, H.; Schwerk, C. Biological activities of suilysin: Role in Streptococcus suis pathogenesis, Future. Microbiol. 2016, 11, 1493. [Google Scholar] [CrossRef] [PubMed]
- Xie, S.; Zhang, Y.; Xu, L.; Li, S.; Shen, X.; Li, L.; Deng, X.; Zhou, Y. Acacetin attenuates Streptococcus suis virulence by simultaneously targeting suilysin and inflammation. Microb. Pathog. 2022, 162, 105354. [Google Scholar] [CrossRef]
- Yin, H.; Deng, Y.; Wang, H.; Liu, W.; Zhuang, X.; Chu, W. Tea polyphenols as an antivirulence compound Disrupt Quorum-Sensing Regulated Pathogenicity of Pseudomonas aeruginosa. Sci. Rep. 2015, 5, 16158. [Google Scholar] [CrossRef]
- Zheng, C.; Xu, J.; Shi, G.; Zhao, X.; Ren, S.; Li, J.; Chen, H.; Bei, W. ormate-tetrahydrofolate ligase is involved in the virulence of Streptococcus suis serotype 2. Microb. Pathog. 2016, 98, 149–154. [Google Scholar] [CrossRef]
- Seitz, M.; Baums, C.G.; Neis, C.; Benga, L.; Fulde, M.; Rohde, M.; Goethe, R.; Valentin-Weigand, P. Subcytolytic effects of suilysin on interaction of Streptococcus suis with epithelial cells. Vet. Microbiol. 2013, 167, 584–591. [Google Scholar] [CrossRef]
- Yi, L.; Li, J.; Fan, Q.; Mao, C.; Jin, M.; Liu, Y.; Sun, L.; Grenier, D.; Wang, Y. The otc gene of Streptococcus suis plays an important role in biofilm formation, adhesion, and virulence in a murine model. Vet. Microbiol. 2020, 251, 108925. [Google Scholar] [CrossRef]
- Norton, P.M.; Rolph, C.; Ward, P.N.; Bentley, R.W.; Leigh, J.A. Epithelial invasion and cell lysis by virulent strains of Streptococcus suis is enhanced by the presence of suilysin. FEMS. Immunol. Med. Microbiol. 1999, 26, 25–35. [Google Scholar] [CrossRef]
- Cheung, P.Y.; Lo, K.L.; Cheung, T.T.; Yeung, W.H.; Leung, P.H.; Kam, K.M. Streptococcus suis in retail markets: How prevalent is it in raw pork. Int. J. Food Microbiol. 2008, 127, 316–320. [Google Scholar] [CrossRef] [PubMed]
- Shen, B. A New Golden Age of Natural Products Drug Discovery. Cell 2015, 163, 1297–1300. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Ding, S.; Shen, J.; Zhu, K. Nonribosomal antibacterial peptides that target multidrug-resistant bacteria. Nat. Prod. Rep. 2019, 36, 573–592. [Google Scholar] [CrossRef] [PubMed]
- Lewis, K. The Science of Antibiotic Discovery. Cell 2020, 181, 29–45. [Google Scholar] [CrossRef] [PubMed]
- Song, M.; Liu, Y.; Li, T.; Liu, X.; Hao, Z.; Ding, S.; Panichayupakaranant, P.; Zhu, K.; Shen, J. Plant Natural Flavonoids Against Multidrug Resistant Pathogens. Adv. Sci. 2021, 8, e2100749. [Google Scholar] [CrossRef]
- Wang, Z.; Xia, Q.; Liu, X.; Liu, W.; Huang, W.; Mei, X.; Luo, J.; Shan, M.; Lin, R.; Zou, D.; et al. Phytochemistry, pharmacology, quality control and future research of Forsythia suspensa (Thunb.) Vahl: A review. J. Ethnopharmacol. 2018, 210, 318–339. [Google Scholar] [CrossRef]
- Jiao, J.; Fu, Y.J.; Zu, Y.G.; Luo, M.; Wang, W.; Zhang, L.; Li, J. Enzyme-assisted microwave hydro-distillation essential oil from Fructus Forsythia, chemical constituents, and its antimicrobial and antioxidant activities. Food Chem. 2012, 134, 235–243. [Google Scholar] [CrossRef]
- Han, X.; Piao, X.S.; Zhang, H.Y.; Li, P.F.; Yi, J.Q.; Zhang, Q.; Li, P. Forsythia suspensa extract has the potential to substitute antibiotic in broiler chicken. Asian Austral. J. Anim. 2012, 25, 569–576. [Google Scholar] [CrossRef]
- Jiang, Q.; Wei, D.; He, X.; Gan, C.; Long, X.; Zhang, H. Phillyrin Prevents Neuroinflammation-Induced Blood-Brain Barrier Damage Following Traumatic Brain Injury via Altering Microglial Polarization. Front. Pharmacol. 2021, 12, 719823. [Google Scholar] [CrossRef]
- Guo, L.; Guo, J.; Liu, H.; Zhang, J.; Chen, X.; Qiu, Y.; Fu, S. Tea polyphenols suppress growth and virulence-related factors of Haemophilus parasuis. J. Vet. Med. Sci. 2018, 80, 1047–1053. [Google Scholar] [CrossRef]
- Li, X.; Liu, Z.; Gao, T.; Liu, W.; Yang, K.; Guo, R.; Li, C.; Tian, Y.; Wang, N.; Zhou, D.; et al. Tea Polyphenols Protects Tracheal Epithelial Tight Junctions in Lung during Actinobacillus pleuropneumoniae Infection via Suppressing TLR-4/MAPK/PKC-MLCK Signaling. Int. J. Mol. Sci. 2023, 24, 11842. [Google Scholar] [CrossRef] [PubMed]
- Gao, T.; Tan, Y.; Wang, Y.; Yuan, F.; Liu, Z.; Yang, K.; Liu, W.; Guo, R.; Li, C.; Tian, Y.; et al. Theaflavin Ameliorates Streptococcus suis-Induced Infection In Vitro and In Vivo. Int. J. Mol. Sci. 2023, 24, 7442. [Google Scholar] [CrossRef] [PubMed]
- Taylor, P.K.; Yeung, A.T.; Hancock, R.E. Antibiotic resistance in Pseudomonas aeruginosa biofilms: Towards the development of novel anti-biofilm therapies. J. Biotechnol. 2014, 191, 121–130. [Google Scholar] [CrossRef] [PubMed]
- Waack, U.; Nicholson, T.L. Subinhibitory concentrations of amoxicillin, lincomycin, and oxytetracycline commonly used to treat swine increase Streptococcus suis biofilm formation. Front. Microbiol. 2018, 9, 2707. [Google Scholar] [CrossRef]
Primers | Primers Sequence | Target Gene | Reference or Source |
---|---|---|---|
16s RNA-F | GTTGCGAACGGGTGAGTAA | 16s RNA | [40] |
16s RNA-R | TCTCAGGTCGGCTATGTATCG | ||
ccpA-F | CGGTGTCAGTGATATGGG | ccpa | [40] |
ccpA-R | GTCAGGTTTGGACGGGTA | ||
fbps-F | AACCATCTTGCCAGGCTCCAC | fbps | [40] |
fbps-R | CAGTTCAGAAGCCGTATCCCGAC | ||
gor-F | GTTCACGCGCATCCTACG | gor | [40] |
gor-R | TACCAGGAATAGCAGGGAC | ||
stk-F | ATGATTCAAATCGGTAAGATCTTTGC | stk | This work |
stk-R | GCCATTGACATATTCCATAGCC | ||
epf-F | ACAGATCCAGATAGCGACATTCAAA | epf | This work |
epf-R | TATTACCAGTGGCATCCGTCAC | ||
mrp-F | CAGATGTGGACCGTAGACC | mrp | This work |
mrp-R | CCTTGCCTTCAAAAGTGATGGA | ||
sly-F | GCTTGACTTACGAGCCACAA | suilysin | [41] |
sly-R | CCGCGCAATACTGATAAGC |
Compound | Bacterial Strain | MIC (μg/mL) | MBC (μg/mL) |
---|---|---|---|
phillyrin | SC19 | 64 | 512 |
Site | Size | PLB | Hyd | Side | Residues |
---|---|---|---|---|---|
1 | 69 | 3.38 | 16 | 40 | 1:(ANS50 GLU51 GLY52 ASN82 ASN83 SER84 ASP86 ILE87 GLN107 LEU109 LEU110 ASP111 ASN112 SER187 LYS190 THR191 LYS192 PHE193 GLY194 THR195 ILE372 LEU373 SER374 ASN375 SER376) |
2 | 36 | 2.21 | 20 | 30 | 1:(TYR54 ILE55 TYR184 SER185 MET186 SER187 PHE208 APS209 VAL211 ASN212 GLU377 TYR378 ILE379 THR381) |
3 | 55 | 1.41 | 14 | 38 | 1:(MET182 PYR184 VAL211 GLU214 GLU215 LYS216 GLN217 SER281 SER282 ARG283 SER284 THR285 GLN286 VAL287 GLN288 ALA289 GLU380 THR381 THR382 SER383) |
4 | 21 | 1.18 | 10 | 17 | 1:(THR62 GLU63 LEU65 PHE70 GLU409 VEL410 SER411 TYR412 VEL419 GLU421 ASN445) |
5 | 57 | 0.97 | 25 | 36 | 1:(ILE97 TYR98 PRO99 ARG147 VAL150 ARG151 VAL154 ASN155 LEU158 TYR228 TYR270 GLY325 GLY354 VAL355 PRO356) |
6 | 11 | 0.84 | 8 | 27 | 1:(PHE70 VAL72 ARG74 THR384 HIS36 TYR412 GLU418 ARG447) |
7 | 43 | 0.77 | 16 | 36 | 1:(ASN82 SER84 ASP86 ILE87 ALA88 ILE90 ASN112 GLM177 ASP179 LYS192 PHE193 6LY194 THR195 SER196 ASN22 L′S24 PHE275) |
8 | 27 | 0.60 | 13 | 23 | 1:(ARG272 MET274 ILE319 GLY322 ASP323 LYS340 ILE341 GLU344 GLY345 ALA346 TYR348 GLY349) |
9 | 51 | 0.39 | 21 | 37 | 1:(VAL89 ILE90 ASP91 ALA94 ALA95 ILE97 ASP111 ASN112 ASN113 LYS190 THR195 SER196 GLU198 LYS199 TYR359) |
10 | 22 | 0.22 | 10 | 14 | 1:(LEU128 ASN129 LEU130 PRO131 GLY132 LEU133 ALA134 ASN135GLY136 ASP137 TRP161) |
11 | 32 | 0.19 | 11 | 32 | 1:(ILE80 GLU180 THR181 MET182 TYR184 GLN188 LYS192 GLN288 TYR378 GLU380) |
12 | 29 | −0.09 | 6 | 15 | 1:(HIS386 ASN387 SER388 SER389 ILE442 PRO443 GLY444 ASN445 ALA446 ARG447 LEU474 VAL475 GLY476) |
13 | 19 | −0.11 | 9 | 23 | 1:(GLU66 ASN67 ARG69 VAL71 GLY214 GLU215 LYS216 SER281 ARG283 VAL385) |
14 | 11 | −0.13 | 6 | 18 | 1:(GLU66 ASN67 ARG69 VAL71 GLY214 GL0215 LYS216 SER281 ARG283 VAL385) |
15 | 56 | −0.15 | 19 | 32 | 1:(TYR98 LEU102 LEU116 ILE117 SER118 ILE119 ARG121 PRO145 THR146 ARG147) |
16 | 24 | −0.17 | 18 | 21 | 1:(THR285 GLN286 ALA289 ALA290 ILE300 ALA304 GLU305 TYR306 GLN307 ILE309 LEU310) |
17 | 15 | −0.20 | 1 | 7 | 1:(GLY122 ASP123 SER239 LYS240 LEU241 PHE242 ALA243 GLU244 GLY245) |
18 | 18 | −0.25 | 9 | 12 | 1:(ARG447 ASN448 LEU449 ASP471 LEU472 PRO473 LEU474) |
19 | 28 | −0.42 | 19 | 23 | 1:(ACE31 ASP32 ILE33 TYR36 VAL248 GLU249 LEU251 LYS252) |
20 | 26 | −0.51 | 6 | 19 | 1:(ASN67 GLY68 ARG69 ASN387 SER388 SER389 ALA390 GLN441 GLY476 GLN477 LEU498) |
21 | 9 | −0.62 | 5 | 9 | 1:(GLU46 ILE47 LEU48 THR49 ASP106 GLN107 LEU110) |
22 | 17 | −0.62 | 10 | 20 | 1:(GLU175 LEU176 GLN177 LYS224 ILE226 THR229 SER269 SER358) |
23 | 10 | −0.64 | 9 | 14 | 1:(ALA293 ALA294 ILE295 GLY297 ASP299 ILE300 SER301 LYS339 ILE342 GLU343) |
24 | 10 | −0.66 | 7 | 17 | 1:(ASP205 ILE206 ASN207 VAL218 LYS277 GLU279) |
25 | 12 | −0.86 | 7 | 14 | 1:(GLU66 VAL71 LEU73 SER213 GLY214 GLU215 ARG283 SER383) |
26 | 10 | −0.88 | 5 | 11 | 1:(GLU51 GLY52 GLU53 ASN375) |
27 | 9 | −0.89 | 3 | 7 | 1:(PRO235 GLU236 SER237 PRO238 VAL364LYS365 ASN367) |
28 | 9 | −0.99 | 8 | 14 | 1:(GLY136 SER138 LYS160 TRP161 TYR165) |
29 | 10 | −0.99 | 3 | 7 | 1:(THR49 ASN50 GLU51) |
30 | 7 | −0.99 | 1 | 9 | 1:(LYS93 ALA94 ALA95 ASN96 ASN113 ARG147) |
31 | 8 | −0.99 | 2 | 2 | 1:(ALA60 THR61 ALA415 GLY416) |
32 | 8 | −0.99 | 3 | 9 | 1:(ASN448 LEU449 HIS450 ASP471) |
Mol | rseq | mseq | S | E_Score1 | E_Refine | E_Score2 | |
---|---|---|---|---|---|---|---|
1 | 101712 | 1 | 1 | −6.1901 | −10.8269 | 6.6277 | −6.1901 |
2 | 101712 | 1 | 1 | −5.7576 | −10.3733 | 15.3135 | −5.7576 |
3 | 101712 | 1 | 1 | −5.2715 | −10.2766 | 7.9008 | −5.2715 |
4 | 101712 | 1 | 1 | −5.1763 | −11.7010 | 2.0349 | −5.1763 |
5 | 101712 | 1 | 1 | −5.1015 | −11.1251 | 11.8131 | −5.1015 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, F.; Zheng, L.; Wang, M.; Liu, W.; Li, X.; Gao, T.; Guo, R.; Liu, Z.; Yang, K.; Li, C.; et al. Study on the Effect of Phillyrin on Streptococcus suis In Vivo and In Vitro. Biomolecules 2024, 14, 1542. https://doi.org/10.3390/biom14121542
Yuan F, Zheng L, Wang M, Liu W, Li X, Gao T, Guo R, Liu Z, Yang K, Li C, et al. Study on the Effect of Phillyrin on Streptococcus suis In Vivo and In Vitro. Biomolecules. 2024; 14(12):1542. https://doi.org/10.3390/biom14121542
Chicago/Turabian StyleYuan, Fangyan, Lihan Zheng, Mengzhe Wang, Wei Liu, Xiaoyue Li, Ting Gao, Rui Guo, Zewen Liu, Keli Yang, Chang Li, and et al. 2024. "Study on the Effect of Phillyrin on Streptococcus suis In Vivo and In Vitro" Biomolecules 14, no. 12: 1542. https://doi.org/10.3390/biom14121542
APA StyleYuan, F., Zheng, L., Wang, M., Liu, W., Li, X., Gao, T., Guo, R., Liu, Z., Yang, K., Li, C., Wu, Q., Zhu, J., Tian, Y., & Zhou, D. (2024). Study on the Effect of Phillyrin on Streptococcus suis In Vivo and In Vitro. Biomolecules, 14(12), 1542. https://doi.org/10.3390/biom14121542