Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Gastric Cancer
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients and Datasets
2.2. Establishment and Validation of the PRlncRNAs Risk Model
2.3. Prediction of OS in GC Patients by Establishing A Prognostic Nomogram
2.4. Differences in Functional Enrichment and Immune Infiltration within the Two Risk Groups
2.5. Evaluation of Immunotherapy and Drug Therapy
2.6. Cell Culture and qRT-PCR
2.7. Statistical Analysis
3. Results
3.1. Identification of Significant Prognostic Values of PRlncRNAs in GC
3.2. Exploring the Value of Six Prlncrnas as Independent Risk Models in Terms of Predicting the Outcome of GC Patients
3.3. Assessing the Effect of Different Clinicopathological Variables on the Performance of Predictive Signatures in GC Patients
3.4. Verification of the Risk Model
3.5. Differences in Immune Cell Infiltration and Immune-Related Pathways between the Two Groups
3.6. Functional Enrichment Analysis Conducted via GSEA between Different Risk Patients
3.7. Relationships between the Predictive Signature and Treatment of GC
3.8. Differential Expression of the Six PRlncRNAs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA A Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Jin, R.U. Molecular pathogenesis, targeted therapies, and future perspectives for gastric cancer. Semin. Cancer Biol. 2022, 86, 566–582. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.X.; Liu, W.; Ai, B.; Sun, L.L.; Chen, Z.S.; Lin, L.Z. Current Advances and Outlook in Gastric Cancer Chemoresistance: A Review. Recent Pat. Anti-Cancer Drug Discov. 2022, 17, 26–41. [Google Scholar] [CrossRef]
- Li, G.Z.; Doherty, G.M.; Wang, J. Surgical Management of Gastric Cancer: A Review. JAMA Surg. 2022, 157, 446–454. [Google Scholar] [CrossRef] [PubMed]
- Nohria, A.; Kaslow, S.R.; Hani, L.; He, Y.; Sacks, G.D.; Berman, R.S.; Lee, A.Y.; Correa-Gallego, C. Outcomes After Surgical Palliation of Patients with Gastric Cancer. J. Surg. Res. 2022, 279, 304–311. [Google Scholar] [CrossRef]
- Wang, C.; Ruan, J. Mechanistic Insights into Gasdermin Pore Formation and Regulation in Pyroptosis. J. Mol. Biol. 2022, 434, 167297. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Kanneganti, T.D. From pyroptosis, apoptosis and necroptosis to PANoptosis: A mechanistic compendium of programmed cell death pathways. Comput. Struct. Biotechnol. J. 2021, 19, 4641–4657. [Google Scholar] [CrossRef] [PubMed]
- Loveless, R.; Bloomquist, R.; Teng, Y. Pyroptosis at the forefront of anticancer immunity. J. Exp. Clin. Cancer Res. CR 2021, 40, 264. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Wang, C.; Yang, J.; Chen, Y.; Zhou, B.; Abbott, D.W.; Xiao, T.S. Caspase-1 Engages Full-Length Gasdermin D through Two Distinct Interfaces That Mediate Caspase Recruitment and Substrate Cleavage. Immunity 2020, 53, 106–114.e5. [Google Scholar] [CrossRef] [PubMed]
- Al Mamun, A.; Mimi, A.A.; Aziz, M.A.; Zaeem, M.; Ahmed, T.; Munir, F.; Xiao, J. Role of pyroptosis in cancer and its therapeutic regulation. Eur. J. Pharmacol. 2021, 910, 174444. [Google Scholar] [CrossRef]
- Wu, H.; Qian, D.; Bai, X.; Sun, S. Targeted Pyroptosis Is a Potential Therapeutic Strategy for Cancer. J. Oncol. 2022, 2022, 2515525. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.J.; Chen, D.; Jiang, M.Z.; Xu, B.; Li, X.W.; Chu, Y.; Zhang, Y.J.; Mao, R.; Liang, J.; Fan, D.M. Downregulation of gasdermin D promotes gastric cancer proliferation by regulating cell cycle-related proteins. J. Dig. Dis. 2018, 19, 74–83. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Yin, B.; Li, D.; Wang, G.; Han, X.; Sun, X. GSDME mediates caspase-3-dependent pyroptosis in gastric cancer. Biochem. Biophys. Res. Commun. 2018, 495, 1418–1425. [Google Scholar] [CrossRef]
- Xia, Y.; Jin, Y.; Cui, D.; Wu, X.; Song, C.; Jin, W.; Huang, H. Antitumor Effect of Simvastatin in Combination with DNA Methyltransferase Inhibitor on Gastric Cancer via GSDME-Mediated Pyroptosis. Front. Pharm. 2022, 13, 860546. [Google Scholar] [CrossRef]
- Deng, B.B.; Jiao, B.P.; Liu, Y.J.; Li, Y.R.; Wang, G.J. BIX-01294 enhanced chemotherapy effect in gastric cancer by inducing GSDME-mediated pyroptosis. Cell Biol. Int. 2020, 44, 1890–1899. [Google Scholar] [CrossRef] [PubMed]
- Park, E.G.; Pyo, S.J.; Cui, Y.; Yoon, S.H.; Nam, J.W. Tumor immune microenvironment lncRNAs. Brief. Bioinform. 2022, 23, bbab504. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, X. The functions of LncRNA in the heart. Diabetes Res. Clin. Pract. 2020, 168, 108249. [Google Scholar] [CrossRef] [PubMed]
- Jovčevska, I.; Videtič Paska, A. Neuroepigenetics of psychiatric disorders: Focus on lncRNA. Neurochem. Int. 2021, 149, 105140. [Google Scholar] [CrossRef]
- Ghafouri-Fard, S.; Abak, A.; Talebi, S.F.; Shoorei, H.; Branicki, W.; Taheri, M.; Akbari Dilmaghani, N. Role of miRNA and lncRNAs in organ fibrosis and aging. Biomed. Pharmacother. Biomed. Pharmacother. 2021, 143, 112132. [Google Scholar] [CrossRef]
- Ren, N.; Jiang, T.; Wang, C.; Xie, S.; Xing, Y.; Piao, D.; Zhang, T.; Zhu, Y. LncRNA ADAMTS9-AS2 inhibits gastric cancer (GC) development and sensitizes chemoresistant GC cells to cisplatin by regulating miR-223-3p/NLRP3 axis. Aging 2020, 12, 11025–11041. [Google Scholar] [CrossRef]
- Wu, Q.; Ma, J.; Wei, J.; Meng, W.; Wang, Y.; Shi, M. lncRNA SNHG11 Promotes Gastric Cancer Progression by Activating the Wnt/β-Catenin Pathway and Oncogenic Autophagy. Mol. Ther. J. Am. Soc. Gene Ther. 2021, 29, 1258–1278. [Google Scholar] [CrossRef]
- Zhang, F.; Wang, H.; Yu, J.; Yao, X.; Yang, S.; Li, W.; Xu, L.; Zhao, L. LncRNA CRNDE attenuates chemoresistance in gastric cancer via SRSF6-regulated alternative splicing of PICALM. Mol. Cancer 2021, 20, 6. [Google Scholar] [CrossRef]
- Hao, J.; Yuan, B.; Gou, Y.; Ma, J.; Huang, X. Prognostic Value of lncRNA PVT1 for Patients with Gastric Cancer: A Meta-Analysis. Dis. Mrk. 2021, 2021, 5595965. [Google Scholar] [CrossRef]
- Guo, X.; Lv, X.; Ru, Y.; Zhou, F.; Wang, N.; Xi, H.; Zhang, K.; Li, J.; Chang, R.; Xie, T.; et al. Circulating Exosomal Gastric Cancer-Associated Long Noncoding RNA1 as a Biomarker for Early Detection and Monitoring Progression of Gastric Cancer: A Multiphase Study. JAMA Surg. 2020, 155, 572–579. [Google Scholar] [CrossRef]
- Jin, T. LncRNA DRAIR is a novel prognostic and diagnostic biomarker for gastric cancer. Mamm. Genome Off. J. Int. Mamm. Genome Soc. 2021, 32, 503–507. [Google Scholar] [CrossRef]
- Tan, C.; Liu, W.; Zheng, Z.H.; Wan, X.G. LncRNA HOTTIP inhibits cell pyroptosis by targeting miR-148a-3p/AKT2 axis in ovarian cancer. Cell Biol. Int. 2021, 45, 1487–1497. [Google Scholar] [CrossRef]
- Su, F.; Duan, J.; Zhu, J.; Fu, H.; Zheng, X.; Ge, C. Long non-coding RNA nuclear paraspeckle assembly transcript 1 regulates ionizing radiation-induced pyroptosis via microRNA-448/gasdermin E in colorectal cancer cells. Int. J. Oncol. 2021, 59, 79. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Zheng, S.; Wu, Q.; Wu, J.; Zhou, R.; Wang, C.; Wu, Z.; Rong, X.; Huang, N.; Sun, L.; et al. Long noncoding RNA (lncRNA) EIF3J-DT induces chemoresistance of gastric cancer via autophagy activation. Autophagy 2021, 17, 4083–4101. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Zhou, B.; Hu, X.; Ying, S.; Zhou, Q.; Xu, W.; Feng, L.; Hou, T.; Wang, X.; Zhu, L.; et al. LncRNA LINC00942 promotes chemoresistance in gastric cancer by suppressing MSI2 degradation to enhance c-Myc mRNA stability. Clin. Transl. Med. 2022, 12, e703. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Sun, J.; Zhang, N.; Zheng, Y.; Wang, X.; Lv, L.; Liu, J.; Xu, Y.; Shen, Y.; Yang, M. Noncoding RNAs in gastric cancer: Implications for drug resistance. Mol. Cancer 2020, 19, 62. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Cao, L.; Zhou, S.; Lyu, J.; Gao, Y.; Yang, R. Construction and Validation of a Novel Pyroptosis-Related Four-lncRNA Prognostic Signature Related to Gastric Cancer and Immune Infiltration. Front Immunol 2022, 13, 854785. [Google Scholar] [CrossRef]
- Guo, C.; Liu, Z.; Yu, Y.; Liu, S.; Ma, K.; Ge, X.; Xing, Z.; Lu, T.; Weng, S.; Wang, L.; et al. Integrated Analysis of Multi-Omics Alteration, Immune Profile, and Pharmacological Landscape of Pyroptosis-Derived lncRNA Pairs in Gastric Cancer. Front. Cell Dev. Biol. 2022, 10, 816153. [Google Scholar] [CrossRef] [PubMed]
- Rooney, M.S.; Shukla, S.A.; Wu, C.J.; Getz, G.; Hacohen, N. Molecular and genetic properties of tumors associated with local immune cytolytic activity. Cell 2015, 160, 48–61. [Google Scholar] [CrossRef] [PubMed]
- Smyth, E.C.; Nilsson, M.; Grabsch, H.I.; van Grieken, N.C.; Lordick, F. Gastric cancer. Lancet 2020, 396, 635–648. [Google Scholar] [CrossRef] [PubMed]
- Lordick, F.; Lorenzen, S.; Yamada, Y.; Ilson, D. Optimal chemotherapy for advanced gastric cancer: Is there a global consensus? Gastric Cancer Off. J. Int. Gastric Cancer Assoc. Jpn. Gastric Cancer Assoc. 2014, 17, 213–225. [Google Scholar] [CrossRef]
- Zhou, C.B.; Fang, J.Y. The role of pyroptosis in gastrointestinal cancer and immune responses to intestinal microbial infection. Biochim. Biophys. Acta Rev. Cancer 2019, 1872, 1–10. [Google Scholar] [CrossRef]
- Hou, J.; Zhao, R.; Xia, W.; Chang, C.W.; You, Y.; Hsu, J.M.; Nie, L.; Chen, Y.; Wang, Y.C.; Liu, C.; et al. PD-L1-mediated gasdermin C expression switches apoptosis to pyroptosis in cancer cells and facilitates tumour necrosis. Nat. Cell Biol. 2020, 22, 1264–1275. [Google Scholar] [CrossRef]
- Peng, W.X.; Koirala, P.; Mo, Y.Y. LncRNA-mediated regulation of cell signaling in cancer. Oncogene 2017, 36, 5661–5667. [Google Scholar] [CrossRef]
- Yang, M.; Lu, H.; Liu, J.; Wu, S.; Kim, P.; Zhou, X. lncRNAfunc: A knowledgebase of lncRNA function in human cancer. Nucleic Acids Res 2022, 50, D1295–D1306. [Google Scholar] [CrossRef]
- Hu, K.; Zhang, Y.; Rong, J.; Deng, W.; Xiao, B. Overexpression of lncRNA TCLlnc1 in gastric cancer predicts postoperative distant recurrence and poor survival. Anti-Cancer Drugs 2022, 33, 999–1003–1003. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, Y.; You, Q.; Fu, H.; Zhao, X.; Lu, K.; Yan, R.; Yang, D. LncRNA PTCSC3 Alleviates the Postoperative Distant Recurrence of Gastric Cancer by Suppression of lncRNA HOXA11-AS. Cancer Manag. Res. 2020, 12, 2623–2629. [Google Scholar] [CrossRef] [PubMed]
- Lu, H.; Wu, J.; Liang, L.; Wang, X.; Cai, H. Identifying a Novel Defined Pyroptosis-Associated Long Noncoding RNA Signature Contributes to Predicting Prognosis and Tumor Microenvironment of Bladder Cancer. Front. Immunol. 2022, 13, 803355. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Tang, F.; Li, Z.; Lai, Y.; Lu, Z.; Zhang, J.; Tang, Z.; Cai, W.; He, Z. Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Bladder Cancer. Dis. Mrk. 2022, 2022, 7931393. [Google Scholar] [CrossRef]
- Wei, J.; Zeng, Y.; Gao, X.; Liu, T. A novel ferroptosis-related lncRNA signature for prognosis prediction in gastric cancer. BMC Cancer 2021, 21, 1221. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Guo, J.; Jiang, R.; Wang, C.; Pan, C.; Nie, Z.; Jiang, X. Long Non-Coding RNA AP000695.2 Acts as a Novel Prognostic Biomarker and Regulates the Cell Growth and Migration of Lung Adenocarcinoma. Front. Mol. Biosci. 2022, 9, 895927. [Google Scholar] [CrossRef]
- Hu, J.; Huang, L.; Ding, Q.; Lv, J.; Chen, Z. Long noncoding RNA HAGLR sponges miR-338-3p to promote 5-Fu resistance in gastric cancer through targeting the LDHA-glycolysis pathway. Cell Biol. Int. 2022, 46, 173–184. [Google Scholar] [CrossRef]
- Xiu, Y.; Cao, S.; Jiang, R.; Zhou, Y. lncRNA LINC01315 promotes malignancy of triple-negative breast cancer and predicts poor outcomes by modulating microRNA-876-5p/GRK5. Bioengineered 2022, 13, 10001–10009. [Google Scholar] [CrossRef]
- Liao, T.; Lu, Y.; Li, W.; Wang, K.; Zhang, Y.; Luo, Z.; Ju, Y.; Ouyang, M. Construction and validation of a glycolysis-related lncRNA signature for prognosis prediction in Stomach Adenocarcinoma. Front. Genet. 2022, 13, 794621. [Google Scholar] [CrossRef]
- Taabazuing, C.Y.; Griswold, A.R.; Bachovchin, D.A. The NLRP1 and CARD8 inflammasomes. Immunol. Rev. 2020, 297, 13–25. [Google Scholar] [CrossRef]
- Johnson, D.C.; Okondo, M.C.; Orth, E.L.; Rao, S.D.; Huang, H.C.; Ball, D.P.; Bachovchin, D.A. DPP8/9 inhibitors activate the CARD8 inflammasome in resting lymphocytes. Cell Death Dis. 2020, 11, 628. [Google Scholar] [CrossRef]
- Mao, L.; Yuan, W.; Cai, K.; Lai, C.; Huang, C.; Xu, Y.; Zhong, S.; Yang, C.; Wang, R.; Zeng, P.; et al. EphA2-YES1-ANXA2 pathway promotes gastric cancer progression and metastasis. Oncogene 2021, 40, 3610–3623. [Google Scholar] [CrossRef]
- Zhao, K.; An, R.; Xiang, Q.; Li, G.; Wang, K.; Song, Y.; Liao, Z.; Li, S.; Hua, W.; Feng, X.; et al. Acid-sensing ion channels regulate nucleus pulposus cell inflammation and pyroptosis via the NLRP3 inflammasome in intervertebral disc degeneration. Cell Prolif. 2021, 54, e12941. [Google Scholar] [CrossRef] [PubMed]
- Frühbeck, G.; Catalán, V.; Valentí, V.; Moncada, R.; Gómez-Ambrosi, J.; Becerril, S.; Silva, C.; Portincasa, P.; Escalada, J.; Rodríguez, A. FNDC4 and FNDC5 reduce SARS-CoV-2 entry points and spike glycoprotein S1-induced pyroptosis, apoptosis, and necroptosis in human adipocytes. Cell. Mol. Immunol. 2021, 18, 2457–2459. [Google Scholar] [CrossRef]
- Liu, X.; Xia, S.; Zhang, Z.; Wu, H.; Lieberman, J. Channelling inflammation: Gasdermins in physiology and disease. Nat. Rev. Drug Discov. 2021, 20, 384–405. [Google Scholar] [CrossRef]
- Lian, P.L.; Liu, Z.; Yang, G.Y.; Zhao, R.; Zhang, Z.Y.; Chen, Y.G.; Zhuang, Z.N.; Xu, K.S. Integrin αvβ6 and matrix metalloproteinase 9 correlate with survival in gastric cancer. World J. Gastroenterol. 2016, 22, 3852–3859. [Google Scholar] [CrossRef]
- Adams, O.J.; Stanczak, M.A.; von Gunten, S.; Läubli, H. Targeting sialic acid-Siglec interactions to reverse immune suppression in cancer. Glycobiology 2018, 28, 640–647. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, J.G.; Balmaña, M.; Macedo, J.A.; Poças, J.; Fernandes, Â.; de-Freitas-Junior, J.C.M.; Pinho, S.S.; Gomes, J.; Magalhães, A.; Gomes, C.; et al. Glycosylation in cancer: Selected roles in tumour progression, immune modulation and metastasis. Cell. Immunol. 2018, 333, 46–57. [Google Scholar] [CrossRef]
- Lv, Y.; Zhao, Y.; Wang, X.; Chen, N.; Mao, F.; Teng, Y.; Wang, T.; Peng, L.; Zhang, J.; Cheng, P.; et al. Increased intratumoral mast cells foster immune suppression and gastric cancer progression through TNF-α-PD-L1 pathway. J. Immunother. Cancer 2019, 7, 54. [Google Scholar] [CrossRef] [PubMed]
- Lainé, A.; Labiad, O.; Hernandez-Vargas, H.; This, S.; Sanlaville, A.; Léon, S.; Dalle, S.; Sheppard, D.; Travis, M.A.; Paidassi, H.; et al. Regulatory T cells promote cancer immune-escape through integrin αvβ8-mediated TGF-β activation. Nat. Commun. 2021, 12, 6228. [Google Scholar] [CrossRef]
- Khan, M.; Arooj, S.; Wang, H. Soluble B7-CD28 Family Inhibitory Immune Checkpoint Proteins and Anti-Cancer Immunotherapy. Front Immunol 2021, 12, 651634. [Google Scholar] [CrossRef]
- Starzer, A.M.; Berghoff, A.S. New emerging targets in cancer immunotherapy: CD27 (TNFRSF7). ESMO Open 2020, 4, e000629. [Google Scholar] [CrossRef] [PubMed]
- Bullock, T.N.J. CD40 stimulation as a molecular adjuvant for cancer vaccines and other immunotherapies. Cell. Mol. Immunol. 2022, 19, 14–22. [Google Scholar] [CrossRef] [PubMed]
- Digklia, A.; Wagner, A.D. Advanced gastric cancer: Current treatment landscape and future perspectives. World J. Gastroenterol. 2016, 22, 2403–2414. [Google Scholar] [CrossRef] [PubMed]











| Primers Gene | Sequence (5′–3′)Forward Primer | Reverse Primer | 
|---|---|---|
| LINC01315 | TCCGCGCTCTGAAGGATCTC | CTTGACCACCCCCGGATTC | 
| HAGLR | TCCCCACCTTCCCCAAAGTA | GGAGGGTCTACCTCGTTTGC | 
| AP000695.2 | GGACACTCTGAAGGAACTC | GATGACCATTAGCCAACAAG | 
| AP003392.1 | GAATTCACCCACCTCAGCC | GTGTGCGTTTTCCCACTGTC | 
| GAPDH | GGAGTCCACTGGCGTCTTCA | GTCATGAGTCCTTCCACGATACC | 
| LncRNA | Coef | HR | HR.95L | HR.95H | p-Value | Risk | 
|---|---|---|---|---|---|---|
| LINC01315 | −0.44778677 | 0.639040932 | 0.397446603 | 1.027492273 | 0.064597435 | Low | 
| AL161785.1 | 0.581346496 | 1.788444945 | 1.078224415 | 2.966483855 | 0.024342675 | High | 
| AP003392.1 | −0.673152024 | 0.5100982 | 0.303220602 | 0.858121684 | 0.011195944 | Low | 
| AP000695.2 | 0.564391358 | 1.758377234 | 1.065509457 | 2.901795454 | 0.027228282 | High | 
| HAGLR | 0.449545667 | 1.567599812 | 1.163590693 | 2.111884517 | 0.003113121 | High | 
| AL590666.2 | −0.216868363 | 0.805035935 | 0.669152194 | 0.968513385 | 0.021497057 | Low | 
| Feature | N (294) | % | 
|---|---|---|
| Age (years) | ||
| ≤65 | 135 | 45.9 | 
| >65 | 159 | 54.1 | 
| Vital status | ||
| Alive | 188 | 63.9 | 
| Dead | 106 | 36.1 | 
| Gender | ||
| Female | 109 | 37.1 | 
| Male | 185 | 62.9 | 
| Grade | ||
| G1 | 7 | 2.4 | 
| G2 | 101 | 34.4 | 
| G3 | 186 | 63.2 | 
| TNM stage | ||
| Stage I | 37 | 12.6 | 
| Stage II | 97 | 33 | 
| Stage III | 130 | 44.2 | 
| Stage IV | 30 | 10.2 | 
| T stage | ||
| T1 | 13 | 4.4 | 
| T2 | 60 | 20.4 | 
| T3 | 144 | 49 | 
| T4 | 77 | 26.2 | 
| M stage | ||
| M0 | 276 | 93.9 | 
| M1 | 18 | 6.1 | 
| N stage | ||
| N0 | 89 | 30.3 | 
| N1 | 80 | 27.2 | 
| N2 | 63 | 21.4 | 
| N3 | 62 | 21.1 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, M.; Fang, C.; Ma, Y. Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Gastric Cancer. Biomolecules 2023, 13, 469. https://doi.org/10.3390/biom13030469
Jiang M, Fang C, Ma Y. Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Gastric Cancer. Biomolecules. 2023; 13(3):469. https://doi.org/10.3390/biom13030469
Chicago/Turabian StyleJiang, Min, Changyin Fang, and Yongping Ma. 2023. "Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Gastric Cancer" Biomolecules 13, no. 3: 469. https://doi.org/10.3390/biom13030469
APA StyleJiang, M., Fang, C., & Ma, Y. (2023). Prognosis Risk Model Based on Pyroptosis-Related lncRNAs for Gastric Cancer. Biomolecules, 13(3), 469. https://doi.org/10.3390/biom13030469
 
        




 
       