CRISPR/Cas9-Induced Knockout of Sting Increases Susceptibility of Zebrafish to Bacterial Infection
Abstract
1. Introduction
2. Methodology
2.1. Animals
2.2. CRISPR/Cas9-Mediated Generation of Sting(−/−) Zebrafish
2.3. Sample Collection for RNA Extraction
2.3.1. Tissue Collection from Adult Zebrafish
2.3.2. Embryo Sample Collection
2.4. LPS Stimulation of Sting(−/−) and WT Zebrafish Larvae
2.5. Bacterial Challenge against Sting(−/−) and WT Zebrafish
2.6. RNA Extraction and Complementary DNA Synthesis
2.7. Transcriptional Analysis Using qPCR
2.8. Statistical Analyses
3. Results and Discussion
3.1. Expression Analysis of Sting
3.2. Generation of Sting(−/−) Zebrafish by CRISPR/Cas9 Gene Editing
3.3. Downstream Gene Expression Analysis in Sting(−/−) Zebrafish
3.4. LPS-Induced Expression Modulation in Sting(−/−) and WT Larvae
3.5. Effects of Sting Deficiency on Susceptibility to E. piscicida Infection in Zebrafish
3.6. Temporal Expression Analysis in Zebrafish upon E. piscicida Infection
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen Recognition and Innate Immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Li, Y.; Cao, X.; Jin, X.; Jin, T. Pattern Recognition Receptors in Zebrafish Provide Functional and Evolutionary Insight into Innate Immune Signaling Pathways. Cell Mol. Immunol. 2017, 14, 80–89. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Akira, S. Pattern Recognition Receptors and Inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed]
- Eisenächer, K.; Krug, A. Regulation of RLR-Mediated Innate Immune Signaling—It Is All about Keeping the Balance. Eur. J. Cell Biol. 2012, 91, 36–47. [Google Scholar] [CrossRef] [PubMed]
- Mojzesz, M.; Rakus, K.; Chadzinska, M.; Nakagami, K.; Biswas, G.; Sakai, M.; Hikima, J.I. Cytosolic Sensors for Pathogenic Viral and Bacterial Nucleic Acids in Fish. Int. J. Mol. Sci. 2020, 21, 7289. [Google Scholar] [CrossRef]
- Liu, N.; Pang, X.; Zhang, H.; Ji, P. The CGAS-STING Pathway in Bacterial Infection and Bacterial Immunity. Front. Immunol. 2022, 12, 5860. [Google Scholar] [CrossRef]
- Ishikawa, H.; Ma, Z.; Barber, G.N. STING Regulates Intracellular DNA-Mediated, Type I Interferon-Dependent Innate Immunity. Nature 2009, 461, 788–792. [Google Scholar] [CrossRef]
- Ishikawa, H.; Barber, G.N. STING Is an Endoplasmic Reticulum Adaptor That Facilitates Innate Immune Signalling. Nature 2008, 455, 674–678. [Google Scholar] [CrossRef]
- Balka, K.R.; Louis, C.; Saunders, T.L.; Smith, A.M.; Calleja, D.J.; D’Silva, D.B.; Moghaddas, F.; Tailler, M.; Lawlor, K.E.; Zhan, Y.; et al. TBK1 and IKKε Act Redundantly to Mediate STING-Induced NF-ΚB Responses in Myeloid Cells. Cell Rep. 2020, 31, 107492. [Google Scholar] [CrossRef]
- Zhang, X.; Shi, H.; Wu, J.; Zhang, X.; Sun, L.; Chen, C.; Chen, Z.J. Cyclic GMP-AMP Containing Mixed Phosphodiester Linkages Is An Endogenous High-Affinity Ligand for STING. Mol. Cell 2013, 51, 226–235. [Google Scholar] [CrossRef]
- Ergun, S.L.; Li, L. Structural Insights into STING Signaling. Trends Cell. Biol. 2020, 30, 399–407. [Google Scholar] [CrossRef]
- Dalskov, L.; Narita, R.; Andersen, L.L.; Jensen, N.; Assil, S.; Kristensen, K.H.; Mikkelsen, J.G.; Fujita, T.; Mogensen, T.H.; Paludan, S.R.; et al. Characterization of Distinct Molecular Interactions Responsible for IRF3 and IRF7 Phosphorylation and Subsequent Dimerization. Nucleic Acids Res. 2020, 48, 11421–11433. [Google Scholar] [CrossRef]
- Liu, K.; Lan, Y.; Li, X.; Li, M.; Cui, L.; Luo, H.; Luo, L. Development of Small Molecule Inhibitors/Agonists Targeting STING for Disease. Biomed. Pharmacother. 2020, 132, 110945. [Google Scholar] [CrossRef]
- Affolter, A.; Kern, J.; Bieback, K.; Scherl, C.; Rotter, N.; Lammert, A. Biomarkers and 3D Models Predicting Response to Immune Checkpoint Blockade in Head and Neck Cancer (Review). Int. J. Oncol. 2022, 61. [Google Scholar] [CrossRef]
- Ge, R.; Zhou, Y.; Peng, R.; Wang, R.; Li, M.; Zhang, Y.; Zheng, C.; Wang, C. Conservation of the STING-Mediated Cytosolic DNA Sensing Pathway in Zebrafish. J. Virol. 2015, 89, 7696–7706. [Google Scholar] [CrossRef]
- Biacchesi, S.; Mérour, E.; Lamoureux, A.; Bernard, J.; Brémont, M. Both STING and MAVS Fish Orthologs Contribute to the Induction of Interferon Mediated by RIG-I. PLoS ONE 2012, 7, e47737. [Google Scholar] [CrossRef]
- Liu, Z.F.; Ji, J.F.; Jiang, X.F.; Shao, T.; Fan, D.; Jiang, X.H.; Lin, A.F.; Xiang, L.X.; Shao, J.Z. Characterization of CGAS Homologs in Innate and Adaptive Mucosal Immunities in Zebrafish Gives Evolutionary Insights into CGAS-STING Pathway. FASEB J. 2020, 34, 7786–7809. [Google Scholar] [CrossRef]
- Gomes, M.T.R.; Guimarães, E.S.; Marinho, F.V.; Macedo, I.; Aguiar, E.R.G.R.; Barber, G.N.; Moraes-Vieira, P.M.M.; AlvesFilho, J.C.; Oliveira, S.C. STING Regulates Metabolic Reprogramming in Macrophages via HIF-1α during Brucella Infection. PLoS Pathog. 2021, 17, e1009597. [Google Scholar] [CrossRef]
- Guimarães, E.S.; Gomes, M.T.R.; Campos, P.C.; Mansur, D.S.; dos Santos, A.A.; Harms, J.; Splitter, G.; Smith, J.A.; Barber, G.N.; Oliveira, S.C. Brucella Abortus Cyclic Dinucleotides Trigger STING-Dependent Unfolded Protein Response That Favors Bacterial Replication. J. Immunol. 2019, 202, 2671–2681. [Google Scholar] [CrossRef]
- Marinho, F.V.; Benmerzoug, S.; Oliveira, S.C.; Ryffel, B.; Quesniaux, V.F.J. The Emerging Roles of STING in Bacterial Infections. Trends Microbiol. 2017, 25, 906–918. [Google Scholar] [CrossRef]
- Guimarães, E.S.; Marinho, F.V.; de Queiroz, N.M.G.P.; Antunes, M.M.; Oliveira, S.C. Impact of STING Inflammatory Signaling during Intracellular Bacterial Infections. Cells 2021, 11, 74. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.; Barber, G.N. STING Signaling and Host Defense against Microbial Infection. Exp. Mol. Med. 2019, 51, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Zon, L.I. The Zebrafish as a Model for Human Disease. Fish Physiol. 2010, 29, 345–365. [Google Scholar] [CrossRef]
- Trede, N.S.; Langenau, D.M.; Traver, D.; Look, A.T.; Zon, L.I. The Use of Zebrafish to Understand Immunity. Immunity 2004, 20, 367–379. [Google Scholar] [CrossRef]
- Avdesh, A.; Chen, M.; Martin-Iverson, M.T.; Mondal, A.; Ong, D.; Rainey-Smith, S.; Taddei, K.; Lardelli, M.; Groth, D.M.; Verdile, G.; et al. Regular Care and Maintenance of a Zebrafish (Danio rerio) Laboratory: An Introduction. J. Vis. Exp. 2012, 69, e4196. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of Embryonic Development of the Zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Pressley, M.E.; Phelan, P.E.; Eckhard Witten, P.; Mellon, M.T.; Kim, C.H. Pathogenesis and Inflammatory Response to Edwardsiella tarda Infection in the Zebrafish. Dev. Comp. Immunol. 2005, 29, 501–513. [Google Scholar] [CrossRef]
- Krishnan, R.; Qadiri, S.S.N.; Kim, J.O.; Kim, J.O.; Oh, M.J. Validation of Housekeeping Genes as Candidate Internal References for Quantitative Expression Studies in Healthy and Nervous Necrosis Virus-Infected Seven-Band Grouper (Hyporthodus septemfasciatus). Fish Aquat. Sci. 2019, 22, 4196. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Masuda, Y.; Oku, H.; Okumura, T.; Nomura, K.; Kurokawa, T. Feeding Restriction Alters Expression of Some ATP Related Genes More Sensitively than the RNA/DNA Ratio in Zebrafish, Danio Rerio. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2009, 152, 287–291. [Google Scholar] [CrossRef]
- Croisetière, S.; Bernatchez, L.; Belhumeur, P. Temperature and Length-Dependent Modulation of the MH Class II Beta Gene Expression in Brook Charr (Salvelinus fontinalis) by a Cis-Acting Minisatellite. Mol. Immunol. 2010, 47, 1817–1829. [Google Scholar] [CrossRef] [PubMed]
- Tine, M. Evidence of the Complexity of Gene Expression Analysis in Fish Wild Populations. Int. J. Genom. 2017, 2017, 1258396. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Liu, C.; Li, H.; Jiao, J. Deficiency of STING Signaling in Embryonic Cerebral Cortex Leads to Neurogenic Abnormalities and Autistic-Like Behaviors. Adv. Sci. 2020, 7, 2002117. [Google Scholar] [CrossRef] [PubMed]
- Qin, X.W.; He, J.; Yu, Y.; Liu, C.; Luo, Z.Y.; Li, Z.M.; Weng, S.P.; Guo, C.J.; He, J.G. The Roles of Mandarin Fish STING in Innate Immune Defense against Infectious Spleen and Kidney Necrosis Virus Infections. Fish Shellfish Immunol. 2020, 100, 80–89. [Google Scholar] [CrossRef] [PubMed]
- 025805—MPYS[-], STING[-] Strain Details. Available online: https://www.jax.org/strain/025805 (accessed on 29 August 2022).
- Ranoa, D.R.E.; Widau, R.C.; Mallon, S.; Parekh, A.D.; Nicolae, C.M.; Huang, X.; Bolt, M.J.; Arina, A.; Parry, R.; Kron, S.J.; et al. STING Promotes Homeostasis via Regulation of Cell Proliferation and Chromosomal Stability. Cancer Res. 2019, 79, 1465–1479. [Google Scholar] [CrossRef]
- Decout, A.; Katz, J.D.; Venkatraman, S.; Ablasser, A. The CGAS–STING Pathway as a Therapeutic Target in Inflammatory Diseases. Nat. Rev. Immunol. 2021, 21, 548–569. [Google Scholar] [CrossRef]
- Basit, A.; Cho, M.G.; Kim, E.Y.; Kwon, D.; Kang, S.J.; Lee, J.H. The CGAS/STING/TBK1/IRF3 Innate Immunity Pathway Maintains Chromosomal Stability through Regulation of P21 Levels. Exp. Mol. Med. 2020, 52, 643–657. [Google Scholar] [CrossRef]
- De Oliveira Mann, C.C.; Orzalli, M.H.; King, D.S.; Kagan, J.C.; Lee, A.S.Y.; Kranzusch, P.J. Modular Architecture of the STING C-Terminal Tail Allows Interferon and NF-ΚB Signaling Adaptation. Cell Rep. 2019, 27, 1165–1175.e5. [Google Scholar] [CrossRef]
- Chen, B.; Li, C.; Yao, J.; Shi, L.; Liu, W.; Wang, F.; Huo, S.; Zhang, Y.; Lu, Y.; Ashraf, U.; et al. Zebrafish NIK Mediates IFN Induction by Regulating Activation of IRF3 and NF-ΚB. J. Immunol. 2020, 204, 1881–1891. [Google Scholar] [CrossRef]
- Park, B.S.; Lee, J.O. Recognition of Lipopolysaccharide Pattern by TLR4 Complexes. Exp. Mol. Med. 2013, 45, e66. [Google Scholar] [CrossRef]
- Sepulcre, M.P.; Alcaraz-Pérez, F.; López-Muñoz, A.; Roca, F.J.; Meseguer, J.; Cayuela, M.L.; Mulero, V. Evolution of Lipopolysaccharide (LPS) Recognition and Signaling: Fish TLR4 Does Not Recognize LPS and Negatively Regulates NF-ΚB Activation. J. Immunol. 2009, 182, 1836–1845. [Google Scholar] [CrossRef]
- Li, M.Z.; Wen, X.Y.; Liu, X.Q.; Wang, Y.Q.; Yan, L. LPS-Induced Activation of the CGAS-STING Pathway Is Regulated by Mitochondrial Dysfunction and Mitochondrial DNA Leakage in Endometritis. J. Inflamm. Res. 2022, 15, 5707–5720. [Google Scholar] [CrossRef]
- Tesser, A.; Piperno, G.M.; Pin, A.; Piscianz, E.; Boz, V.; Benvenuti, F.; Tommasini, A. Priming of the CGAS-STING-TBK1 Pathway Enhances LPS-Induced Release of Type I Interferons. Cells 2021, 10, 785. [Google Scholar] [CrossRef]
- Wan, Q.; Wicramaarachchi, W.D.N.; Whang, I.; Lim, B.S.; Oh, M.J.; Jung, S.J.; Kim, H.C.; Yeo, S.Y.; Lee, J. Molecular Cloning and Functional Characterization of Two Duplicated Two-Cysteine Containing Type I Interferon Genes in Rock Bream Oplegnathus Fasciatus. Fish Shellfish Immunol. 2012, 33, 886–898. [Google Scholar] [CrossRef]
- Huang, L.S.; Hong, Z.; Wu, W.; Xiong, S.; Zhong, M.; Gao, X.; Rehman, J.; Malik, A.B. Mitochondrial DNA Activates CGAS Signaling and Suppresses YAP-Mediated Endothelial Cell Proliferation Program to Promote Inflammatory Injury. Immunity 2020, 52, 475. [Google Scholar] [CrossRef]
- Yang, D.; Zheng, X.; Chen, S.; Wang, Z.; Xu, W.; Tan, J.; Hu, T.; Hou, M.; Wang, W.; Gu, Z.; et al. Sensing of Cytosolic LPS through Caspy2 Pyrin Domain Mediates Noncanonical Inflammasome Activation in Zebrafish. Nat. Commun. 2018, 9, 3052. [Google Scholar] [CrossRef]
- Forn-Cuní, G.; Meijer, A.H.; Varela, M. Zebrafish in Inflammasome Research. Cells 2019, 8, 901. [Google Scholar] [CrossRef]
- Novoa, B.; Bowman, T.V.; Zon, L.; Figueras, A. LPS Response and Tolerance in the Zebrafish (Danio rerio). Fish Shellfish Immunol. 2009, 26, 326–331. [Google Scholar] [CrossRef]
- Sun, W.; Li, Y.; Chen, L.; Chen, H.; You, F.; Zhou, X.; Zhou, Y.; Zhai, Z.; Chen, D.; Jiang, Z. ERIS, an Endoplasmic Reticulum IFN Stimulator, Activates Innate Immune Signaling through Dimerization. Proc. Natl. Acad. Sci. USA 2009, 106, 8653–8658. [Google Scholar] [CrossRef]
- Zhong, B.; Yang, Y.; Li, S.; Wang, Y.Y.; Li, Y.; Diao, F.; Lei, C.; He, X.; Zhang, L.; Tien, P.; et al. The Adaptor Protein MITA Links Virus-Sensing Receptors to IRF3 Transcription Factor Activation. Immunity 2008, 29, 538–550. [Google Scholar] [CrossRef]
- Wu, J.; Sun, L.; Chen, X.; Du, F.; Shi, H.; Chen, C.; Chen, Z.J. Cyclic GMP-AMP Is an Endogenous Second Messenger in Innate Immune Signaling by Cytosolic DNA. Science 2013, 339, 826–830. [Google Scholar] [CrossRef] [PubMed]
- Fang, R.; Wang, C.; Jiang, Q.; Lv, M.; Gao, P.; Yu, X.; Mu, P.; Zhang, R.; Bi, S.; Feng, J.-M.; et al. NEMO–IKKβ Are Essential for IRF3 and NF-ΚB Activation in the CGAS–STING Pathway. J. Immunol. 2017, 199, 3222–3233. [Google Scholar] [CrossRef] [PubMed]
- Sakai, M.; Hikima, J.I.; Kono, T. Fish Cytokines: Current Research and Applications. Fish. Sci. 2021, 87, 1–9. [Google Scholar] [CrossRef]
- Taft, J.; Markson, M.; Legarda, D.; Patel, R.; Chan, M.; Malle, L.; Richardson, A.; Gruber, C.; Martín-Fernández, M.; Mancini, G.M.S.; et al. Human TBK1 Deficiency Leads to Autoinflammation Driven by TNF-Induced Cell Death. Cell 2021, 184, 4447. [Google Scholar] [CrossRef]
- Lafont, E.; Draber, P.; Rieser, E.; Reichert, M.; Kupka, S.; de Miguel, D.; Draberova, H.; von Mässenhausen, A.; Bhamra, A.; Henderson, S.; et al. TBK1 and IKKε Prevent TNF-Induced Cell Death by RIPK1 Phosphorylation. Nat. Cell Biol. 2018, 20. [Google Scholar] [CrossRef]
- Li, N.; Zhou, H.; Wu, H.; Wu, Q.; Duan, M.; Deng, W.; Tang, Q. STING-IRF3 Contributes to Lipopolysaccharide-Induced Cardiac Dysfunction, Inflammation, Apoptosis and Pyroptosis by Activating NLRP3. Redox. Biol. 2019, 24, 101215. [Google Scholar] [CrossRef]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef]
- Herb, M.; Schramm, M. Functions of ROS in Macrophages and Antimicrobial Immunity. Antioxidants 2021, 10, 313. [Google Scholar] [CrossRef]
- Biller, J.D.; Takahashi, L.S. Oxidative Stress and Fish Immune System: Phagocytosis and Leukocyte Respiratory Burst Activity. An. Acad. Bras. Cienc. 2018, 90, 3403–3414. [Google Scholar] [CrossRef]
- Archer, K.A.; Durack, J.; Portnoy, D.A. STING-Dependent Type I IFN Production Inhibits Cell-Mediated Immunity to Listeria Monocytogenes. PLoS Pathog. 2014, 10. [Google Scholar] [CrossRef]
- Ji, D.X.; Witt, K.C.; Kotov, D.I.; Margolis, S.R.; Louie, A.; Chevée, V.; Chen, K.J.; Gaidt, M.M.; Dhaliwal, H.S.; Lee, A.Y.; et al. Role of the Transcriptional Regulator SP140 in Resistance to Bacterial Infections via Repression of Type I Interferons. Elife 2021, 10, 67290. [Google Scholar] [CrossRef]
- Mancuso, G.; Midiri, A.; Biondo, C.; Beninati, C.; Zummo, S.; Galbo, R.; Tomasello, F.; Gambuzza, M.; Macrì, G.; Ruggeri, A.; et al. Type I IFN Signaling Is Crucial for Host Resistance against Different Species of Pathogenic Bacteria. J. Immunol. 2007, 178, 3126–3133. [Google Scholar] [CrossRef]
- Feng, H.; Zhang, Q.-M.; Zhang, Y.-B.; Li, Z.; Zhang, J.; Xiong, Y.-W.; Wu, M.; Gui, J.-F. Zebrafish IRF1, IRF3, and IRF7 Differentially Regulate IFNΦ1 and IFNΦ3 Expression through Assembly of Homo- or Heteroprotein Complexes. J. Immunol. 2016, 197, 1893–1904. [Google Scholar] [CrossRef]




| Gene | Application | Sequence (5′-3′) |
|---|---|---|
| sting | sgRNA F | TAATACGACTCACTATAGGCAGCCTGCTGCGCGCTCTGTTTTAGAGCTAGAAATAGC |
| sgRNA R (Universal) | GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAG | |
| T7E1 F | GCAGTCATTTCTGTGTGGCTCTG | |
| T7E1 R | TCCAGCATGAGCCCAAAAGC | |
| qPCR F | TTTGGCGAGAGAGAACGGAAGC | |
| qPCR R | AGAGCTCTCTGGAGAGGTAATGAGG | |
| Mutation-specific F | TCGTCCCCAGAGCGCGCA | |
| Mutation-specific R | TCCGGCGCACATGAGGTTGAAGTGG | |
| tbk1 | qPCR F | CCTGTGGATGATGTCCGACC |
| qPCR R | GGCGAACAGCTTGACGATG | |
| nf-κb (p65) | qPCR F | CAAAGATCTGGGAGGAGGAGTTCG |
| qPCR R | GATCTTCAGCTCAGCAGTGTTAGGAG | |
| irf3 | qPCR F | CTGTACCTGATCACACTGCCATTCC |
| qPCR R | GCCTGACTCATCCATGTTTCTGTGG | |
| irf7 | qPCR F | GAAGAGACCTTGGTGACGCG |
| qPCR R | GAGACTGTGAAGTGCACATCGG | |
| tnfα | qPCR F | CTCTCCGCTCTTCAGTTGACC |
| qPCR R | GTGTGGTTTTGCCGTGGTC | |
| il6 | qPCR F | GATGAGGAGTACTTGCCGGG |
| qPCR R | CCTGAGCCTAAATCCATGATCGC | |
| ifnphi1 | qPCR F | CCGCTTGTACACCTTGATGGAC |
| qPCR R | GCCACACATTCTTTGAGGTCAG | |
| β-actin | qPCR F | GCACATCTGCTGTAACAAGATCC |
| qPCR R | GTCAGCAGATTCTGTCTGGC | |
| ef1∝ | qPCR F | CTCCTCTTGGTCGCTTTGCT |
| qPCR R | CCGATTTTCTTCTCAACGCTCT | |
| caspb | qPCR F | CAAGCAGAACGAACGTGCAAAGC |
| qPCR R | TGCGAGATGATCTGCTGGATGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sellaththurai, S.; Jung, S.; Kim, M.-J.; Nadarajapillai, K.; Ganeshalingam, S.; Jeong, J.B.; Lee, J. CRISPR/Cas9-Induced Knockout of Sting Increases Susceptibility of Zebrafish to Bacterial Infection. Biomolecules 2023, 13, 324. https://doi.org/10.3390/biom13020324
Sellaththurai S, Jung S, Kim M-J, Nadarajapillai K, Ganeshalingam S, Jeong JB, Lee J. CRISPR/Cas9-Induced Knockout of Sting Increases Susceptibility of Zebrafish to Bacterial Infection. Biomolecules. 2023; 13(2):324. https://doi.org/10.3390/biom13020324
Chicago/Turabian StyleSellaththurai, Sarithaa, Sumi Jung, Myoung-Jin Kim, Kishanthini Nadarajapillai, Subothini Ganeshalingam, Joon Bum Jeong, and Jehee Lee. 2023. "CRISPR/Cas9-Induced Knockout of Sting Increases Susceptibility of Zebrafish to Bacterial Infection" Biomolecules 13, no. 2: 324. https://doi.org/10.3390/biom13020324
APA StyleSellaththurai, S., Jung, S., Kim, M.-J., Nadarajapillai, K., Ganeshalingam, S., Jeong, J. B., & Lee, J. (2023). CRISPR/Cas9-Induced Knockout of Sting Increases Susceptibility of Zebrafish to Bacterial Infection. Biomolecules, 13(2), 324. https://doi.org/10.3390/biom13020324

