Substrate Type and Concentration Differently Affect Colon Cancer Cells Ultrastructural Morphology, EMT Markers, and Matrix Degrading Enzymes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Cultures
2.2. RNA Isolation and Real-Time qPCR Analysis
2.3. E-Cadherin Expression by Western Blot
2.4. Statistical Analysis
2.5. Scanning Electron Microscopy
3. Results
3.1. Evaluation of EMT Markers and Matrix Degrading Enzymes in CRC Cells Cultured in Different Matrix Substrates
3.2. Ultrastructural Morphological Features of CRC Cells Cultured on Millipore/Matrigel Mimicking a Normal and a Thick Basement Membrane
3.3. Ultrastructural Morphological Features of LoVo-S and LoVo-R Cells Cultured on Millipore/Collagen Mimicking a Normal and a Desmoplastic Lamina Propria
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Fleming, M.; Ravula, S.; Tatishchev, S.F.; Wang, H.L. Colorectal carcinoma: Pathologic aspects. J. Gastrointest. Oncol. 2012, 3, 153–173. [Google Scholar] [CrossRef] [PubMed]
- Brenner, H.; Kloor, M.; Pox, C.P. Colorectal cancer. Lancet 2014, 383, 1490–1502. [Google Scholar] [CrossRef] [PubMed]
- Manne, U.; Shanmugam, C.; Katkoori, V.R.; Bumpers, V.R.; Grizzle, W.E. Development and progression of colorectal neoplasia. Cancer Biomark. 2010, 9, 235–265. [Google Scholar] [CrossRef] [Green Version]
- Pang, X.; Xu, B.; Lian, J.; Wang, R.; Wang, X.; Shao, J.; Tang, S.; Lu, H. Real-world survival of colon cancer after radical surgery: A single-institutional retrospective analysis. Front. Oncol. 2022, 16, 914076. [Google Scholar] [CrossRef]
- Diaz, L.A., Jr.; Williams, R.T.; Wu, J.; Kinde, I.; Hecht, J.R.; Berlin, J.; Allen, B.; Bozic, I.; Reiter, J.G.; Nowak, M.A.; et al. The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers. Nature 2012, 486, 537–540. [Google Scholar] [CrossRef] [Green Version]
- Holohan, C.; Van Schaeybroeck, S.; Longley, D.B.; Johnston, P.G. Cancer drug resistance: An evolving paradigm. Nat. Rev. Cancer 2013, 13, 714–726. [Google Scholar] [CrossRef]
- He, J.; Pei, L.; Jiang, H.; Yang, W.; Chen, J.; Liang, H. Chemoresistance of colorectal cancer to 5-fluorouracil is associated with silencing of the BNIP3 gene through aberrant methylation. J. Cancer 2017, 8, 1187–1196. [Google Scholar] [CrossRef] [Green Version]
- Momparler, R.L.; Karon, M.; Siegel, S.E.; Avila, F. Effect of adriamycin on DNA, RNA, and protein synthesis in cell-free systems and intact cells. Cancer Res. 1976, 36, 2891–2895. [Google Scholar]
- Fornari, F.A.; Randolph, J.K.; Yalowich, J.C.; Ritke, M.K.; Gewirtz, D.A. Interference by doxorubicin with DNA unwinding in MCF-7 breast tumor cells. Mol. Pharmacol. 1994, 45, 649–656. [Google Scholar]
- Engelman, J.A.; Zejnullahu, K.; Mitsudomi, T.; Song, Y.; Hyland, C.; Park, J.O.; Lindeman, N.; Gale, C.M.; Zhao, X. MET amplification leads to gefitinib resistance in lung cancer by activating ERBB3 signaling. Science 2007, 316, 1039–1043. [Google Scholar] [CrossRef] [PubMed]
- Tacar, O.; Sriamornsak, P.; Dass, C.R. Doxorubicin: An update on anticancer molecular action, toxicity and novel drug delivery systems. J. Pharm. Pharmacol. 2013, 65, 157–170. [Google Scholar] [CrossRef] [PubMed]
- Dasari, S.; Tchounwou, P.B. Cisplatin in cancer therapy: Molecular mechanisms of action. Eur. J. Pharmacol. 2014, 740, 364–378. [Google Scholar] [CrossRef] [Green Version]
- Bromann, P.A.; Korkaya, H.; Courtneidge, S.A. The interplay between Src family kinases and receptor tyrosine kinases. Oncogene 2004, 23, 7957–7968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sui, H.; Zhu, L.; Deng, W.; Li, Q. Epithelial-mesenchymal transition and drug resistance: Role, molecular mechanisms, and therapeutic strategies. Oncol. Res. Treat. 2014, 37, 584–589. [Google Scholar] [CrossRef] [PubMed]
- Ghannoum, M.A.; Rice, L.B. Antifungal agents: Mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin. Microbiol. Rev. 1999, 12, 501–517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ozben, T. Mechanisms and strategies to overcome multiple drug resistance in cancer. FEBS Lett. 2006, 580, 2903–2909. [Google Scholar] [CrossRef] [Green Version]
- Rosanò, L.; Cianfrocca, R.; Spinella, F.; Di Castro, V.; Nicotra, M.R.; Lucidi, A.; Ferrandina, G.; Natali, P.G.; Bagnato, A. Acquisition of chemoresistance and EMT phenotype is linked with activation of the endothelin A receptor pathway in ovarian carcinoma cells. Clin. Cancer Res. 2011, 17, 2350–2360. [Google Scholar] [CrossRef] [Green Version]
- Kim, A.Y.; Kwak, J.H.; Je, N.K.; Lee, Y.H.; Jung, Y.S. Epithelial-mesenchymal transition is associated with acquired resistance to 5-fluorocuracil in HT-29 colon cancer cells. Toxicol. Res. 2015, 31, 151–156. [Google Scholar] [CrossRef] [Green Version]
- Cano, A.; Perez-Moreno, M.A.; Rodrigo, I.; Locascio, A.; Blanco, M.J.; del Barrio, M.G. The transcription factor snail controls epithelialmesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2000, 2, 76–83. [Google Scholar] [CrossRef]
- Franchi, M.; Masola, V.; Bellin, G.; Onisto, M.; Karamanos, K.A.; Piperigkou, Z. Collagen Fiber Array of Peritumoral Stroma Influences Epithelial-to-Mesenchymal Transition and Invasive Potential of Mammary Cancer Cells. J. Clin. Med. 2019, 8, 213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Franchi, M.; Piperigkou, Z.; Karamanos, K.A.; Franchi, L.; Masola, V. Extracellular Matrix-Mediated Breast Cancer Cells Morphological Alterations, Invasiveness, and Microvesicles/Exosomes Release. Cells 2020, 9, 2031. [Google Scholar] [CrossRef] [PubMed]
- Kyriakopoulou, K.; Riti, E.; Piperigkou, Z.; Koutroumanou Sarri, K.; Bassiony, H.; Franchi, M.; Karamanos, N.K. ΕGFR/ERβ-Mediated Cell Morphology and Invasion Capacity Are Associated with Matrix Culture Substrates in Breast Cancer. Cells 2020, 9, 2256. [Google Scholar] [CrossRef] [PubMed]
- Liotta, L.A.; Kohn, E.C. The microenvironment of the tumour-host interface. Nature 2001, 411, 375–379. [Google Scholar] [CrossRef]
- Kirkland, S.C. Type I collagen inhibits differentiation and promotes a stem cell-like phenotype in human colorectal carcinoma cells. Br. J. Cancer 2009, 101, 320–326. [Google Scholar] [CrossRef] [Green Version]
- O’Shannessy, D.J.; Somers, E.B.; Chandrasekaran, L.K.; Nicolaides, N.C.; Bordeaux, J.; Gustavson, M.D. Influence of tumor microenvironment on prognosis in colorectal cancer: Tissue architecture-dependent signature of endosialin (TEM-1) and associated proteins. Oncotarget 2014, 5, 3983–3995. [Google Scholar] [CrossRef] [Green Version]
- Barcus, C.E.; O’Leary, K.A.; Brockman, J.L.; Rugowski, D.E.; Liu, Y.; Garcia, N.; Yu, M.; Keely, P.J.; Eliceiri, K.W.; Schuler, L.A. Elevated collagen-I augments tumor progressive signals, intravasation and metastasis of prolactin-induced estrogen receptor alpha positive mammary tumor cells. Breast Cancer Res. 2017, 19, 9. [Google Scholar] [CrossRef] [Green Version]
- Crotti, S.; Piccoli, M.; Rizzolio, F.; Giordano, A.; Nitti, D.; Agostini, M. Extracellular matrix and colorectal cancer: How surrounding microenvironment affect cancer cell behavior? J. Cell. Physiol. 2017, 232, 967–975. [Google Scholar] [CrossRef]
- Romero-López, M.; Trinh, A.L.; Sobrino, A.; Hatch, M.M.; Keating, M.T.; Fimbres, C.; Lewis, D.E.; Gershon, P.D.; Botvinick, E.L.; Digman, M.; et al. Recapitulating the human tumor microenvironment: Colon tumor-derived extracellular matrix promotes angiogenesis and tumor cell growth. Biomaterials 2017, 116, 118–129. [Google Scholar] [CrossRef] [Green Version]
- Franchi, M.; Piperigkou, Z.; Riti, E.; Masola, V.; Onisto, M.; Karamanos, N.K. Long filopodia and tunneling nanotubes define new phenotypes of breast cancer cells in 3D cultures. Matrix Biol. Plus. 2020, 6–7, 100026. [Google Scholar] [CrossRef]
- Le, C.C.; Bennasroune, A.; Langlois, B.; Salesse, S.; Boulagnon-Rombi, C.; Morjani, H.; Appert-Collin, A. Functional Interplay Between Collagen Network and Cell Behavior Within Tumor Microenvironment in Colorectal Cancer. Front. Oncol. 2020, 10, 527. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.; Chen, D.; Luo, F.; Wang, G.; Xu, S.; Wang, Y.; Sun, C.; Xu, X.; Li, A.; Zhuo, S.; et al. Development and validation of a collagen signature-based nomogram for preoperatively predicting lymph node metastasis and prognosis in colorectal cancer. Ann. Transl Med. 2021, 9, 651. [Google Scholar] [CrossRef]
- Hynes, R.O. Extracellular matrix: Not just pretty fibrils. Science 2009, 326, 1216–1219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Egeblad, M.; Rasch, M.G.; Weaver, V.M. Dynamic interplay between the collagen scaffold and tumor evolution. Curr. Opin. Cell Biol. 2010, 22, 697–706. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karamanos, N.K.; Theocharis, A.D.; Piperigkou, Z.; Manou, D.; Passi, A.; Skandalis, S.S.; Vynios, D.H.; Orian-Rousseau, V.; Ricard-Blum, S.; Schmelzer, C.E.H.; et al. A guide to the composition and functions of the extracellular matrix. FEBS J. 2021, 288, 6850–6912. [Google Scholar] [CrossRef] [PubMed]
- Lu, P.; Weaver, V.M.; Werb, Z. The extracellular matrix: A dynamic niche in cancer progression. J. Cell Biol. 2012, 196, 395–406. [Google Scholar] [CrossRef] [PubMed]
- Zou, X.; Feng, B.; Dong, T.; Yan, G.; Tan, B.; Shen, H.; Huang, A.; Zhang, X. Up-regulation of type I collagen during tumorigenesis of colorectal cancer revealed by quantitative proteomic analysis. J. Proteomics 2013, 94, 473–485. [Google Scholar] [CrossRef]
- Brauchle, E.; Kasper, J.; Daum, R.; Schierbaum, N.; Falch, C.; Kirschniak, A.; Schäffer, T.E.; Schenke-Layland, K. Biomechanical and biomolecular characterization of extracellular matrix structures in human colon carcinomas. Matrix Biol. 2018, 68–69, 180–193. [Google Scholar] [CrossRef]
- Conklin, M.W.; Eickhoff, J.C.; Riching, K.M.; Pehlke, C.A.; Eliceiri, K.W.; Provenzano, P.P.; Friedl, A.; Keely, P.J. Aligned collagen is a prognostic signature for survival in human breast carcinoma. Am. J. Pathol. 2011, 178, 1221–1232. [Google Scholar] [CrossRef]
- Aoudjit, F.; Vuori, K. Integrin signaling inhibits paclitaxel-induced apoptosis in breast cancer cells. Oncogene 2001, 20, 4995–5004. [Google Scholar] [CrossRef] [Green Version]
- Cohen, E.; Tendler, T.; Lu, H.; Hansen, C.K.; Kertsman, J.; Barrios, J.; Wieder, R. Collagen I provide a survival advantage to MD-1483 head and neck squamous cell carcinoma cells through phosphoinositol 3-kinase signaling. Anticancer Res. 2013, 33, 79–86. [Google Scholar]
- Badaoui, M.; Mimsy-Julienne, C.; Saby, C.; Van Gulick, L.; Peretti, M.; Jeannesson, P.; Morjani, H.; Ouadid-Ahidouch, H. Collagen type 1 promotes survival of human breast cancer cells by overexpressing Kv10.1 potassium and Orai1 calcium channels through DDR1-dependent pathway. Oncotarget 2018, 9, 24653–24671. [Google Scholar] [CrossRef] [PubMed]
- Grandi, M.; Geroni, C.; Giuliani, F.C. Isolation and characterization of a human colon adenocarcinoma cell line resistant to doxorubicin. Br. J. Cancer 1986, 54, 515–518. [Google Scholar] [CrossRef] [PubMed]
- Castiglioni, S.; Cazzaniga, A.; Trapani, V.; Cappadone, C.; Farruggia, G.; Merolle, L.; Wolf, F.I.; Iotti, S.; Maier, J.A.M. Magnesium homeostasis in colon carcinoma LoVo cells sensitive or resistant to doxorubicin. Sci. Rep. 2015, 5, 16538. [Google Scholar] [CrossRef] [Green Version]
- Bisi, A.; Cappadone, C.; Rampa, A.; Farruggia, G.; Sargenti, A.; Belluti, F.; Di Martino, R.M.C.; Malucelli, E.; Meluzzi, A.; Iotti, S.; et al. Coumarin derivatives as potential antitumor agents: Growth inhibition, apoptosis induction and multidrug resistance reverting activity. Eur. J. Med. Chem. 2017, 127, 577–585. [Google Scholar] [CrossRef]
- Secchi, M.F.; Crescenzi, M.; Masola, V.; Russo, F.P.; Floreani, A.; Onisto, M. Heparanase and macrophage interplay in the onset of liver fibrosis. Sci. Rep. 2017, 7, 14956. [Google Scholar] [CrossRef] [Green Version]
- Masola, V.; Bonomini, M.; Onisto, M.; Ferraro, P.M.; Arduini, A.; Gambaro, G. Biological Effects of XyloCore, a Glucose Sparing PD Solution, on Mesothelial Cells: Focus on Mesothelial-Mesenchymal Transition, Inflammation and Angiogenesis. Nutrients 2021, 13, 2282. [Google Scholar] [CrossRef]
- Iozzo, R.V.; Theocharis, A.D.; Neill, T.; Karamanos, N.K. Complexity of matrix phenotypes. Matrix Biol. Plus 2020, 6–7, 100038. [Google Scholar] [CrossRef]
- Acerbi, I.; Cassereau, L.; Dean, I.; Shi, Q.; Au, A.; Park, C.; Chen, Y.Y.; Liphardt, J.; Hwang, E.S.; Weaver, V.M. Human breast cancer invasion and aggression correlates with ECM stiffening and immune cell infiltration. Integr. Biol. 2015, 7, 1120–1134. [Google Scholar] [CrossRef] [Green Version]
- Marangon, I.; Silva, A.A.; Guilbert, T.; Kolosnjaj-Tabi, J.; Marchiol, C.; Natkhunarajah, S.; Chamming’s, F.; Ménard-Moyon, C.; Bianco, A.; Gennisson, J.L.; et al. Tumor Stiffening, a Key Determinant of Tumor Progression, is Reversed by Nanomaterial-Induced Photothermal Therapy. Theranostics 2017, 7, 329–343. [Google Scholar] [CrossRef]
- Byrne, C.E.; Decombe, J.B.; Bingham, G.C.; Remont, J.; Miller, L.G.; Khalif, L.; King, C.T.; Hamel, K.; Bunnell, B.A.; Burow, M.E.; et al. Evaluation of Extracellular Matrix Composition to Improve Breast Cancer Modeling. Tissue Eng. Part A 2021, 27, 500–511. [Google Scholar] [CrossRef] [PubMed]
- Bozzuto, G.; Condello, M.; Molinari, A. Migratory behaviour of tumour cells: A scanning electron microscopy study. Ann. Ist. Super. Sanita 2015, 51, 139–147. [Google Scholar] [CrossRef] [PubMed]
- Khalil, A.A.; Ilina, O.; Gritsenko, P.G.; Bult, P.; Span, P.N.; Friedl, P. Collective invasion in ductal and lobular breast cancer associates with distant metastasis. Clin. Exp. Metastasis 2017, 34, 421–429. [Google Scholar] [CrossRef] [PubMed]
- Truong, H.H.; Xiong, J.; Ghotra, V.P.; Nirmala, E.; Haazen, L.; Le Dévédec, S.E.; Balcioğlu, H.E.; He, S.; Snaar-Jagalska, B.E.; Vreugdenhil, E.; et al. β1 integrin inhibition elicits a prometastatic switch through the TGFβ-miR-200-ZEB network in E-cadherin-positive triple-negative breast cancer. Sci. Signal 2014, 7, ra15. [Google Scholar] [CrossRef]
- Fischer, K.R. Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance. Nature 2015, 527, 472–476. [Google Scholar] [CrossRef] [Green Version]
- Padmanaban, V.; Krol, I.; Suhail, Y.; Szczerba, B.M.; Aceto, N.; Bader, J.S.; Ewald, A.J. E-cadherin is required for metastasis in multiple models of breast cancer. Nature 2019, 573, 439–444. [Google Scholar] [CrossRef] [PubMed]
- Na, T.Y.; Schecterson, L.; Mendonsa, A.M.; Gumbiner, B.M. The functional activity of E-cadherin controls tumor cell metastasis at multiple steps. Proc. Natl. Acad. Sci. USA 2020, 117, 5931–5937. [Google Scholar] [CrossRef] [PubMed]
- Ilina, O.; Gritsenko, P.G.; Syga, S.; Lippoldt, J.; La Porta, C.A.M.; Chepizhko, O.; Grosser, S.; Vullings, M.; Bakker, G.J.; Starruß, J.; et al. Cell-cell adhesion and 3D matrix confinement determine jamming transitions in breast cancer invasion. Nat Cell Biol. 2020, 22, 1103–1115. [Google Scholar] [CrossRef]
- Aiello, N.M.; Maddipati, R.; Norgard, R.J. EMT Subtype Influences Epithelial Plasticity and Mode of Cell Migration. Dev. Cell. 2018, 45, 681–695. [Google Scholar] [CrossRef] [Green Version]
- Jolly, M.K.; Ware, K.E.; Gilja, S.; Somarelli, J.A.; Levine, H. EMT and MET: Necessary or permissive for metastasis? Mol. Oncol. 2017, 11, 755–769. [Google Scholar] [CrossRef] [Green Version]
- Masola, V.; Zaza, G.; Gambaro, G.; Franchi, M.; Onisto, M. Role of heparanase in tumor progression: Molecular aspects and therapeutic options. Semin. Cancer Biol. 2020, 62, 86–98. [Google Scholar] [CrossRef]
- Liu, M.; Liu, Q.; Yuan, Y.; Li, S.; Dong, Y.; Liang, L.; Zou, Z.; Liu, T. Heparanase (HPSE) Associates with the Tumor Immune Microenvironment in Colorectal Cancer. Processes 2021, 9, 1605. [Google Scholar] [CrossRef]
- Cazzaniga, A.; Moscheni, C.; Trapani, V.; Wolf, F.I.; Farruggia, G.; Sargenti, A.; Iotti, S.; Maier, J.A.; Castiglioni, S. The different expression of TRPM7 and MagT1 impacts on the proliferation of colon carcinoma cells sensitive or resistant to doxorubicin. Sci. Rep. 2017, 7, 1. [Google Scholar] [CrossRef] [PubMed]
- Orgaz, J.L.; Pandya, P.; Dalmeida, R.; Karagiannis, P.; Sanchez-Laorden, B.; Viros, A.; Albrengues, J.; Nestle, F.O.; Ridley, A.J.; Gaggioli, C.; et al. Diverse matrix metalloproteinase functions regulate cancer amoeboid migration. Nat. Commun. 2014, 25, 4255. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Graziani, V.; Rodriguez-Hernandez, I.; Maiques, O.; Sanz-Moreno, V. The amoeboid state as part of the epithelial-to-mesenchymal transition programme. Trends Cell Biol. 2022, 32, 228–242. [Google Scholar] [CrossRef]
- Provenzano, P.P.; Eliceiri, K.W.; Campbell, J.M.; Inman, D.R.; White, J.G.; Keely, P.J. Collagen reorganization at the tumor-stromal interface facilitates local invasion. BMC Med. 2006, 4, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Provenzano, P.P.; Inman, D.R.; Eliceiri, K.W.; Keely, P.J. Matrix density-induced mechanoregulation of breast cell phenotype, signaling and gene expression through a FAK-ERK linkage. Oncogene 2009, 28, 4326–4343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lovitt, C.J.; Shelper, T.B. Avery VM. Doxorubicin resistance in breast cancer cells is mediated by extracellular matrix proteins. BMC Cancer 2018, 18, 41. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joyce, M.H.; Lu, C.; James, E.R.; Hegab, R.; Allen, S.C.; Suggs, L.J.; Brock, A. Phenotypic Basis for Matrix Stiffness-Dependent Chemoresistance of Breast Cancer Cells to Doxorubicin. Front. Oncol. 2018, 8, 337. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henke, E.; Nandigama, R.; Ergün, S. Extracellular Matrix in the Tumor Microenvironment and Its Impact on Cancer Therapy. Front. Mol. Biosci. 2020, 31, 160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xiuxiu, H.; Byoungkoo, L.; Yi, J. Extracellular matrix in cancer progression and therapy. Med. Rev. 2022, 2, 125–139. [Google Scholar] [CrossRef]
- Gonzalez-Molina, J.; Moyano-Galceran, L.; Single, A.; Gultekin, O.; Alsalhi, S.; Lehti, K. Chemotherapy as a regulator of extracellular matrix-cell communication: Implications in therapy resistance. Semin. Cancer Biol. 2022. Epub ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Zheng, X.; Zheng, Y.; Chen, Y.; Fei, W.; Wang, F.; Zheng, C. Extracellular Matrix: Emerging Roles and Potential Therapeutic Targets for Breast Cancer. Front. Oncol. 2021, 22, 50453. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence |
---|---|
E-Cadherin | F: TTCTGCTGCTCTTGCTGTTT, R: TGGCTCAAGTCAAAGTCCTG; |
Vimentin (VIM) | F: AAAACACCCTGCAATCTTTCAGA, R: CACTTTGCGTTCAAGGTCAAGAC; |
SNAIL | F: AGTTTACCTTCCAGCAGCCCTAC, R: AGCCTTTCCCACTGTCCTCATC; |
MMP-2 | F: TGCATCCAGACTTCCTCAGGC, R: TCCTGGCAATCCCTTTGTATGTT; |
MMP-9 | F: GGTGATTGACGACGCCTTTG, R-CTGTACACGCGAGTGAAGGT; |
MMP-14 | F: TGCCATGCAGAAGTTTTACGG, R: TCCTTCGAACATTGGCCTTG; |
Heparanase (HPSE) | F: ATTTGAATGGACGGACTGC R: GTTTCTCCTAACCAGACCTTC; |
GAPDH | F: ACACCCACTCCTCCACCTTT R: TCCACCACCCTGTTGCTGTA; |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Franchi, M.; Karamanos, K.-A.; Cappadone, C.; Calonghi, N.; Greco, N.; Franchi, L.; Onisto, M.; Masola, V. Substrate Type and Concentration Differently Affect Colon Cancer Cells Ultrastructural Morphology, EMT Markers, and Matrix Degrading Enzymes. Biomolecules 2022, 12, 1786. https://doi.org/10.3390/biom12121786
Franchi M, Karamanos K-A, Cappadone C, Calonghi N, Greco N, Franchi L, Onisto M, Masola V. Substrate Type and Concentration Differently Affect Colon Cancer Cells Ultrastructural Morphology, EMT Markers, and Matrix Degrading Enzymes. Biomolecules. 2022; 12(12):1786. https://doi.org/10.3390/biom12121786
Chicago/Turabian StyleFranchi, Marco, Konstantinos-Athanasios Karamanos, Concettina Cappadone, Natalia Calonghi, Nicola Greco, Leonardo Franchi, Maurizio Onisto, and Valentina Masola. 2022. "Substrate Type and Concentration Differently Affect Colon Cancer Cells Ultrastructural Morphology, EMT Markers, and Matrix Degrading Enzymes" Biomolecules 12, no. 12: 1786. https://doi.org/10.3390/biom12121786
APA StyleFranchi, M., Karamanos, K.-A., Cappadone, C., Calonghi, N., Greco, N., Franchi, L., Onisto, M., & Masola, V. (2022). Substrate Type and Concentration Differently Affect Colon Cancer Cells Ultrastructural Morphology, EMT Markers, and Matrix Degrading Enzymes. Biomolecules, 12(12), 1786. https://doi.org/10.3390/biom12121786