Vitamin C Enhances Antiviral Functions of Lung Epithelial Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture, Stimulation and Uptake Assay
2.3. RNA Sequencing and Analysis
2.4. GULO-KO Mice
2.5. RT-qPCR Analysis
2.6. Flow Cytometry
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. SVCT2 Is the Predominant Vitamin C Transporter in the Lungs
3.2. Transcriptomic Changes in BEAS-2B Cells after Treatment with Vitamin C
3.3. Validation of RNA sequencing Data in BEAS-2B Cells and GULO-KO Mice
3.4. Vitamin C Treatment Enhances the Response of BEAS-2B Cells to the Antiviral Ligand Poly I:C
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Daruwala, R.; Song, J.; Koh, W.S.; Rumsey, S.C.; Levine, M. Cloning and functional characterization of the human sodium-dependent vitamin C transporters hSVCT1 and hSVCT2. FEBS Lett. 1999, 460, 480–484. [Google Scholar] [CrossRef] [Scilit]
- Rajan, D.P.; Huang, W.; Dutta, B.; Devoe, L.D.; Leibach, F.H.; Ganapathy, V.; Prasad, P.D. Human placental sodium-dependent vitamin C transporter (SVCT2): Molecular cloning and transport function. Biochem. Biophys. Res. Commun. 1999, 262, 762–768. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Mackenzie, B.; Tsukaguchi, H.; Weremowicz, S.; Morton, C.C.; Hediger, M.A. Human vitamin C (L-ascorbic acid) transporter SVCT1. Biochem. Biophys. Res. Commun. 2000, 267, 488–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maulén, N.P.; Henríquez, E.A.; Kempe, S.; Cárcamo, J.G.; Schmid-Kotsas, A.; Bachem, M.; Grünert, A.; Bustamante, M.E.; Nualart, F.; Vera, J.C. Up-regulation and polarized expression of the sodium-ascorbic acid transporter SVCT1 in post-confluent differentiated CaCo-2 cells. J. Biol. Chem. 2003, 278, 9035–9041. [Google Scholar] [CrossRef] [Scilit]
- Boyer, J.C.; Campbell, C.E.; Sigurdson, W.J.; Kuo, S.M. Polarized localization of vitamin C transporters, SVCT1 and SVCT2, in epithelial cells. Biochem. Biophys. Res. Commun. 2005, 334, 150–156. [Google Scholar] [CrossRef] [Scilit]
- Colunga Biancatelli, R.M.L.; Berrill, M.; Marik, P.E. The antiviral properties of vitamin C. Expert Rev. Anti Infect. Ther. 2020, 18, 99–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hemila, H.; Chalker, E. Vitamin C for preventing and treating the common cold. Cochrane Database Syst. Rev. 2013, 2013, CD000980. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.; Kim, H.; Bae, S.; Choi, J.; Lim, S.Y.; Lee, N.; Kong, J.M.; Hwang, Y.I.; Kang, J.S.; Lee, W.J. Vitamin C Is an Essential Factor on the Anti-viral Immune Responses through the Production of Interferon-alpha/beta at the Initial Stage of Influenza A Virus (H3N2) Infection. Immune Netw. 2013, 13, 70–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hemila, H.; de Man, A. Vitamin C and COVID-19. Front. Med. 2020, 7, 559811. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Rao, X.; Li, Y.; Zhu, Y.; Liu, F.; Guo, G.; Luo, G.; Meng, Z.; De Backer, D.; Xiang, H.; et al. Pilot trial of high-dose vitamin C in critically ill COVID-19 patients. Ann. Intensive Care 2021, 11, 5. [Google Scholar] [CrossRef] [Scilit]
- Carr, A.C.; Maggini, S. Vitamin C and Immune Function. Nutrients 2017, 9, 1211. [Google Scholar] [CrossRef] [Scilit]
- Holtzman, M.J.; Byers, D.E.; Alexander-Brett, J.; Wang, X. The role of airway epithelial cells and innate immune cells in chronic respiratory disease. Nat. Rev. Immunol. 2014, 14, 686–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agrawal, S.; Srivastava, R.; Rahmatpanah, F.; Madiraju, C.; BenMohamed, L.; Agrawal, A. Airway Epithelial Cells Enhance the Immunogenicity of Human Myeloid Dendritic Cells under Steady State. Clin. Exp. Immunol. 2017, 189, 279–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahmatpanah, F.; Agrawal, S.; Jaiswal, N.; Nguyen, H.M.; McClelland, M.; Agrawal, A. Airway epithelial cells prime plasmacytoid dendritic cells to respond to pathogens via secretion of growth factors. Mucosal. Immunol. 2019, 12, 77–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramanian, V.S.; Sabui, S.; Moradi, H.; Marchant, J.S.; Said, H.M. Inhibition of intestinal ascorbic acid uptake by lipopolysaccharide is mediated via transcriptional mechanisms. Biochim. Biophys. Acta. Biomembr. 2018, 1860, 556–565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Subramanian, V.S.; Sabui, S.; Subramenium, G.A.; Marchant, J.S.; Said, H.M. Tumor necrosis factor alpha reduces intestinal vitamin C uptake: A role for NF-κB-mediated signaling. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 315, G241–G248. [Google Scholar] [CrossRef] [Scilit]
- Alldredge, J.; Randall, L.; De Robles, G.; Agrawal, A.; Mercola, D.; Liu, M.; Randhawa, P.; Edwards, R.; McClelland, M.; Rahmatpanah, F. Transcriptome Analysis of Ovarian and Uterine Clear Cell Malignancies. Front. Oncol. 2020, 10, 598579. [Google Scholar] [CrossRef] [Scilit]
- Samarajiwa, S.A.; Forster, S.; Auchettl, K.; Hertzog, P.J. INTERFEROME: The database of interferon regulated genes. Nucleic Acids Res. 2009, 37, D852–D857. [Google Scholar] [CrossRef] [Scilit]
- Rusinova, I.; Forster, S.; Yu, S.; Kannan, A.; Masse, M.; Cumming, H.; Chapman, R.; Hertzog, P.J. Interferome v2.0: An updated database of annotated interferon-regulated genes. Nucleic Acids Res. 2013, 41, D1040–D1046. [Google Scholar] [CrossRef] [Scilit]
- Maeda, N.; Hagihara, H.; Nakata, Y.; Hiller, S.; Wilder, J.; Reddick, R. Aortic wall damage in mice unable to synthesize ascorbic acid. Proc. Natl. Acad. Sci. USA 2000, 97, 841–846. [Google Scholar] [CrossRef] [Scilit]
- Larsson, N.; Rankin, G.D.; Bicer, E.M.; Roos-Engstrand, E.; Pourazar, J.; Blomberg, A.; Mudway, I.S.; Behndig, A.F. Identification of vitamin C transporters in the human airways: A cross-sectional in vivo study. BMJ Open 2015, 5, e006979. [Google Scholar] [CrossRef] [Scilit]
- Caput, D.; Beutler, B.; Hartog, K.; Thayer, R.; Brown-Shimer, S.; Cerami, A. Identification of a common nucleotide sequence in the 3′-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA 1986, 83, 1670–1674. [Google Scholar] [CrossRef] [Scilit]
- de Toeuf, B.; Soin, R.; Nazih, A.; Dragojevic, M.; Jurenas, D.; Delacourt, N.; Vo Ngoc, L.; Garcia-Pino, A.; Kruys, V.; Gueydan, C. ARE-mediated decay controls gene expression and cellular metabolism upon oxygen variations. Sci. Rep. 2018, 8, 5211. [Google Scholar] [CrossRef] [Scilit]
- Takayama, S.; Reed, J.C. Molecular chaperone targeting and regulation by BAG family proteins. Nat. Cell Biol. 2001, 3, E237–E241. [Google Scholar] [CrossRef] [Scilit]
- Arndt, V.; Daniel, C.; Nastainczyk, W.; Alberti, S.; Hohfeld, J. BAG-2 acts as an inhibitor of the chaperone-associated ubiquitin ligase CHIP. Mol. Biol. Cell 2005, 16, 5891–5900. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fei, X.; Ziqian, Y.; Bingwu, Y.; Min, L.; Xinmiao, X.; Zhen, M.; Lirong, G.; Song, W. Aldosterone alleviates lipopolysaccharide-induced acute lung injury by regulating epithelial sodium channel through PI3K/Akt/SGK1 signaling pathway. Mol. Cell. Probes 2021, 57, 101709. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, E.; Li, M.M.H. All About the RNA: Interferon-Stimulated Genes That Interfere with Viral RNA Processes. Front. Immunol. 2020, 11, 605024. [Google Scholar] [CrossRef] [Scilit]
- Pozharskaya, V.; Torres-Gonzalez, E.; Rojas, M.; Gal, A.; Amin, M.; Dollard, S.; Roman, J.; Stecenko, A.A.; Mora, A.L. Twist: A regulator of epithelial-mesenchymal transition in lung fibrosis. PLoS ONE 2009, 4, e7559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehwinkel, J.; Gack, M.U. RIG-I-like receptors: Their regulation and roles in RNA sensing. Nat. Rev. Immunol. 2020, 20, 537–551. [Google Scholar] [CrossRef] [Scilit]
- Hemila, H. Vitamin C and Infections. Nutrients 2017, 9, 339. [Google Scholar] [CrossRef] [Scilit]
- Valero, N.; Mosquera, J.; Alcocer, S.; Bonilla, E.; Salazar, J.; Alvarez-Mon, M. Melatonin, minocycline and ascorbic acid reduce oxidative stress and viral titers and increase survival rate in experimental Venezuelan equine encephalitis. Brain Res. 2015, 1622, 368–376. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y.; Li, Y.F.; Tang, L.P.; Tsoi, B.; Chen, M.; Chen, H.; Chen, X.M.; Tan, R.R.; Kurihara, H.; He, R.R. A new mechanism of vitamin C effects on A/FM/1/47(H1N1) virus-induced pneumonia in restraint-stressed mice. Biomed. Res. Int. 2015, 2015, 675149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Maeda, N.; Beck, M.A. Vitamin C deficiency increases the lung pathology of influenza virus-infected gulo-/- mice. J. Nutr. 2006, 136, 2611–2616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fischer, H.; Schwarzer, C.; Illek, B. Vitamin C controls the cystic fibrosis transmembrane conductance regulator chloride channel. Proc. Natl. Acad. Sci. USA 2004, 101, 3691–3696. [Google Scholar] [CrossRef] [Scilit]
- Traber, M.G.; Stevens, J.F. Vitamins C and E: Beneficial effects from a mechanistic perspective. Free Radic. Biol. Med. 2011, 51, 1000–1013. [Google Scholar] [CrossRef] [Scilit]
- Uchide, N.; Toyoda, H. Antioxidant therapy as a potential approach to severe influenza-associated complications. Molecules 2011, 16, 2032–2052. [Google Scholar] [CrossRef] [Scilit]
- Castro, S.M.; Guerrero-Plata, A.; Suarez-Real, G.; Adegboyega, P.A.; Colasurdo, G.N.; Khan, A.M.; Garofalo, R.P.; Casola, A. Antioxidant treatment ameliorates respiratory syncytial virus-induced disease and lung inflammation. Am. J. Respir. Crit. Care Med. 2006, 174, 1361–1369. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Wang, M.; Cheng, A.; Yang, Q.; Wu, Y.; Jia, R.; Liu, M.; Zhu, D.; Chen, S.; Zhang, S.; et al. The role of host eIF2alpha in viral infection. Virol. J. 2020, 17, 112. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef] [Scilit]
- Schneider, W.M.; Chevillotte, M.D.; Rice, C.M. Interferon-stimulated genes: A complex web of host defenses. Annu. Rev. Immunol. 2014, 32, 513–545. [Google Scholar] [CrossRef] [Scilit]
- Bailey, C.C.; Zhong, G.; Huang, I.C.; Farzan, M. IFITM-Family Proteins: The Cell’s First Line of Antiviral Defense. Annu. Rev. Virol. 2014, 1, 261–283. [Google Scholar] [CrossRef] [Scilit]
- Aumiller, V.; Balsara, N.; Wilhelm, J.; Gunther, A.; Konigshoff, M. WNT/beta-catenin signaling induces IL-1beta expression by alveolar epithelial cells in pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 2013, 49, 96–104. [Google Scholar] [CrossRef] [Scilit]
- Hussain, M.; Xu, C.; Lu, M.; Wu, X.; Tang, L.; Wu, X. Wnt/beta-catenin signaling links embryonic lung development and asthmatic airway remodeling. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 3226–3242. [Google Scholar] [CrossRef] [Scilit]
- Lu, C.; Huang, T.; Chen, W.; Lu, H. GnRH participates in the self-renewal of A549-derived lung cancer stem-like cells through upregulation of the JNK signaling pathway. Oncol. Rep. 2015, 34, 244–250. [Google Scholar] [CrossRef] [Scilit]
- Patterson, T.; Isales, C.M.; Fulzele, S. Low level of Vitamin C and dysregulation of Vitamin C transporter might be involved in the severity of COVID-19 Infection. Aging Dis. 2021, 12, 14–26. [Google Scholar] [CrossRef] [Scilit]
- Hemilä, H.; Chalker, E. Vitamin C Can Shorten the Length of Stay in the ICU: A Meta-Analysis. Nutrients 2019, 11, 708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marik, P.E.; Khangoora, V.; Rivera, R.; Hooper, M.H.; Catravas, J. Hydrocortisone, Vitamin C, and Thiamine for the Treatment of Severe Sepsis and Septic Shock: A Retrospective Before-After Study. Chest 2017, 151, 1229–1238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patel, V.; Dial, K.; Wu, J.; Gauthier, A.G.; Wu, W.; Lin, M.; Espey, M.G.; Thomas, D.D.; Ashby, C.R., Jr.; Mantell, L.L. Dietary Antioxidants Significantly Attenuate Hyperoxia-Induced Acute Inflammatory Lung Injury by Enhancing Macrophage Function via Reducing the Accumulation of Airway HMGB1. Int. J. Mol. Sci. 2020, 21, 977. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thomas, S.; Patel, D.; Bittel, B.; Wolski, K.; Wang, Q.; Kumar, A.; Il’Giovine, Z.J.; Mehra, R.; McWilliams, C.; Nissen, S.E.; et al. Effect of High-Dose Zinc and Ascorbic Acid Supplementation vs. Usual Care on Symptom Length and Reduction Among Ambulatory Patients With SARS-CoV-2 Infection: The COVID A to Z Randomized Clinical Trial. JAMA Netw. Open 2021, 4, e210369. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Forward; Reverse Primer Sequence (5′-3′) | Product Size (bp) |
|---|---|---|
| Human primers | ||
| hSVCT1 | TCATCCTCTTCTCCCAGTACCT; AGAGCAGCCACACGGTCAT | 141 |
| hSVCT2 | TCTTTGTGCTTGGATTTTCGAT; ACGTTCAACACTTGATCGATTC | 106 |
| hMX1 | GGTGGTCCCCAGTAATGTGG; CGTCAAGATTCCGATGGTCCT | 97 |
| hDDX58 | TGTGCTCCTACAGGTTGTGGA; CACTGGGATCTGATTCGCAAAA | 120 |
| hIFIH1 | TCGAATGGGTATTCCACAGACG; GTGGCGACTGTCCTCTGAA | 152 |
| hβ-actin | CATCCTGCGTCTGGACCT; TAATGTCACGCACGATTTCC | 116 |
| Mouse primers | ||
| mSVCT1 | CAGCAGGGACTTCCACCA; CCACACAGGTGAAGATGGTA | 240 |
| mSVCT2 | AACGGCAGAGCTGTTGGA; GAAAATCGTCAGCATGGCAA | 238 |
| mMX1 | GACCATAGGGGTCTTGACCAA; AGACTTGCTCTTTCTGAAAAGCC | 182 |
| mDDX58 | AAGAGCCAGAGTGTCAGAATCT; AGCTCCAGTTGGTAATTTCTTGG | 106 |
| mIFIH1 | AGATCAACACCTGTGGTAACACC; CTCTAGGGCCTCCACGAACA | 107 |
| mβ-actin | ATCCTCTTCCTCCCTGGA; TTCATGGATGCCACAGGA | 136 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Teafatiller, T.; Agrawal, S.; De Robles, G.; Rahmatpanah, F.; Subramanian, V.S.; Agrawal, A. Vitamin C Enhances Antiviral Functions of Lung Epithelial Cells. Biomolecules 2021, 11, 1148. https://doi.org/10.3390/biom11081148
Teafatiller T, Agrawal S, De Robles G, Rahmatpanah F, Subramanian VS, Agrawal A. Vitamin C Enhances Antiviral Functions of Lung Epithelial Cells. Biomolecules. 2021; 11(8):1148. https://doi.org/10.3390/biom11081148
Chicago/Turabian StyleTeafatiller, Trevor, Sudhanshu Agrawal, Gabriela De Robles, Farah Rahmatpanah, Veedamali S. Subramanian, and Anshu Agrawal. 2021. "Vitamin C Enhances Antiviral Functions of Lung Epithelial Cells" Biomolecules 11, no. 8: 1148. https://doi.org/10.3390/biom11081148
APA StyleTeafatiller, T., Agrawal, S., De Robles, G., Rahmatpanah, F., Subramanian, V. S., & Agrawal, A. (2021). Vitamin C Enhances Antiviral Functions of Lung Epithelial Cells. Biomolecules, 11(8), 1148. https://doi.org/10.3390/biom11081148

