Methionine Promotes Milk Protein Synthesis via the PI3K-mTOR Signaling Pathway in Human Mammary Epithelial Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatments
2.2. Cell Viability
2.3. Measurement of Cell Proliferation
2.4. Immunofluorescence Assay
2.5. RNA Extraction and Real-Time Quantitative PCR
2.6. Western Blotting
2.7. RNA-Seq Analysis
2.8. Statistical Analysis
3. Results
3.1. Effects of Methionine on the Proliferation of MCF-10A Cells
3.2. Effects of Methionine on Milk Protein Synthesis in MCF-10A Cells
3.3. Analysis of DEGs in the Methionine-Supplemented and Control Groups
3.4. DEGs Participation in Biological Processes
3.5. Effects of Methionine on the PI3K-mTOR Signaling Pathways in MCF-10A Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| IgA | Immunoglobulin A |
| IgM | Immunoglobulin M |
| IgG | Immunoglobulin G |
| DMEM/F-12 | Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 |
| EGF | Epidermal growth factor |
| FBS | Fetal bovine serum |
| BSA | Bovine serum albumin |
| RT-qPCR | Real-time quantitative PCR |
| CSN2 | Casein beta |
| CSN3 | Casein kappa |
| CSN1S1 | Casein alpha S1 |
| FADS3 | Fatty acid desaturase 3 |
| SLC16A4 | Solute carrier family 16 member 4 |
| MAP3K10 | Mitogen-activated protein kinase 10 |
| IL33 | Interleukin-33 |
| ITGB2 | Integrin subunit beta 2 |
| SAMD9L | Sterile alpha motif domain containing 9 like |
| mTOR | Mammalian target of rapamycin |
| PI3K | Phosphoinositide 3-kinase |
| DEGs | Differentially expressed genes |
| FDR | False discovery rate |
| GO | Gene ontology |
| KEGG | Kyoto encyclopedia of genes and genomes |
| BP | Biological processes |
| MF | Molecular functions |
| CC | Cellular components |
| BMECs | Bovine mammary epithelial cells |
| DHA | Docosahexaenoic acid |
References
- Palmquist, A.E.L.; Perrin, M.T.; Cassar-Uhl, D.; Gribble, K.D.; Bond, A.B.; Cassidy, T. Current Trends in Research on Human Milk Exchange for Infant Feeding. J. Hum. Lact. 2019, 35, 453–477. [Google Scholar] [CrossRef] [PubMed]
- Dror, D.K.; Allen, L.H. Overview of Nutrients in Human Milk. Adv. Nutr. 2018, 9, 278s–294s. [Google Scholar] [CrossRef]
- Chuang, C.K.; Lin, S.P.; Lee, H.C.; Wang, T.J.; Shih, Y.S.; Huang, T.Y.; Yeung, C.Y. Free amino acids in full-term and pre-term human milk and infant formula. J. Pediatr. Gastroenterol. Nutr. 2005, 40, 496–500. [Google Scholar] [CrossRef] [PubMed]
- Perrella, S.; Gridneva, Z.; Lai, C.T.; Stinson, L.; George, A.; Bilston-John, S.; Geddes, D. Human milk composition promotes optimal infant growth, development and health. Semin. Perinatol. 2021, 45, 151380. [Google Scholar] [CrossRef] [PubMed]
- Warren, C.D.; Chaturvedi, P.; Newburg, A.R.; Oftedal, O.T.; Tilden, C.D.; Newburg, D.S. Comparison of oligosaccharides in milk specimens from humans and twelve other species. Adv. Exp. Med. Biol. 2001, 501, 325–332. [Google Scholar] [PubMed]
- Jeong, K.; Nguyen, V.; Kim, J. Human milk oligosaccharides: The novel modulator of intestinal microbiota. BMB Rep. 2012, 45, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Walker, A. Breast Milk as the Gold Standard for Protective Nutrients. J. Pediatr. 2010, 156, S3–S7. [Google Scholar] [CrossRef]
- Horta, B.L.; Loret de Mola, C.; Victora, C.G. Long-term consequences of breastfeeding on cholesterol, obesity, systolic blood pressure and type 2 diabetes: A systematic review and meta-analysis. Acta Paediatr. 2015, 104, 30–37. [Google Scholar] [CrossRef]
- Horta, B.L.; Loret de Mola, C.; Victora, C.G. Breastfeeding and intelligence: A systematic review and meta-analysis. Acta Pediátr. 2015, 104, 14–19. [Google Scholar] [CrossRef]
- Hou, L.Y.; Li, X.X.; Yan, P.J.; Li, Y.F.; Wu, Y.T.; Yang, Q.X.; Shi, X.; Ge, L.; Yang, K.H. Impact of the Duration of Breastfeeding on the Intelligence of Children: A Systematic Review with Network Meta-Analysis. Breastfeed. Med. 2021, 16, 687–696. [Google Scholar] [CrossRef]
- Khan, J.; Vesel, L.; Bahl, R.; Martines, J.C. Timing of breastfeeding initiation and exclusivity of breastfeeding during the first month of life: Effects on neonatal mortality and morbidity—A systematic review and meta-analysis. Matern. Child. Health J. 2015, 19, 468–479. [Google Scholar] [CrossRef] [PubMed]
- Victora, C.G.; Bahl, R.; Barros, A.J.; Franca, G.V.; Horton, S.; Krasevec, J.; Murch, S.; Sankar, M.J.; Walker, N.; Rollins, N.C.; et al. Breastfeeding in the 21st century: Epidemiology, mechanisms, and lifelong effect. Lancet 2016, 387, 475–490. [Google Scholar] [CrossRef] [PubMed]
- Zong, X.; Wu, H.; Zhao, M.; Magnussen, C.G.; Xi, B. Global prevalence of WHO infant feeding practices in 57 LMICs in 2010–2018 and time trends since 2000 for 44 LMICs. EClinicalMedicine 2021, 37, 100971. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Yang, Y.; Yin, X.; Li, J.; Fang, J.; Wang, X. Determinants of exclusive breastfeeding for the first six months in China: A cross-sectional study. Int. Breastfeed. J. 2021, 16, 40. [Google Scholar] [CrossRef] [PubMed]
- Pan, F.; Li, P.; Hao, G.; Liu, Y.; Wang, T.; Liu, B. Enhancing Milk Production by Nutrient Supplements: Strategies and Regulatory Pathways. Animals 2023, 13, 419. [Google Scholar] [CrossRef] [PubMed]
- Che, L.; Xu, M.M.; Gao, K.G.; Zhu, C.; Wang, L.; Yang, X.F.; Wen, X.L.; Xiao, H.; Jiang, Z.Y.; Wu, D. Valine increases milk fat synthesis in mammary gland of gilts through stimulating AKT/MTOR/SREBP1 pathway. Biol. Reprod. 2019, 101, 126–137. [Google Scholar] [CrossRef] [PubMed]
- Li, X.Y.; Li, P.; Wang, L.L.; Zhang, M.H.; Gao, X.J. Lysine Enhances the Stimulation of Fatty Acids on Milk Fat Synthesis via the GPRC6A-PI3K-FABP5 Signaling in Bovine Mammary Epithelial Cells. J. Agric. Food Chem. 2019, 67, 7005–7015. [Google Scholar] [CrossRef]
- Qi, H.; Meng, C.; Jin, X.; Li, X.; Li, P.; Gao, X. Methionine Promotes Milk Protein and Fat Synthesis and Cell Proliferation via the SNAT2-PI3K Signaling Pathway in Bovine Mammary Epithelial Cells. J. Agric. Food Chem. 2018, 66, 11027–11033. [Google Scholar] [CrossRef]
- Qiu, Y.; Qu, B.; Zhen, Z.; Yuan, X.; Zhang, L.; Zhang, M. Leucine Promotes Milk Synthesis in Bovine Mammary Epithelial Cells via the PI3K-DDX59 Signaling. J. Agric. Food Chem. 2019, 67, 8884–8895. [Google Scholar] [CrossRef]
- Métayer, S.; Seiliez, I.; Collin, A.; Duchêne, S.; Mercier, Y.; Geraert, P.A.; Tesseraud, S. Mechanisms through which sulfur amino acids control protein metabolism and oxidative status. J. Nutr. Biochem. 2008, 19, 207–215. [Google Scholar] [CrossRef]
- Dai, W.T.; Zhao, F.Q.; Liu, J.X.; Liu, H.Y. ASCT2 Is Involved in SARS-Mediated β-Casein Synthesis of Bovine Mammary Epithelial Cells with Methionine Supply. J. Agric. Food Chem. 2020, 68, 13038–13045. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.F.; Batistel, F.; Xu, T.L.; Han, L.Q.; Bucktrout, R.; Liang, Y.; Coleman, D.N.; Parys, C.; Loor, J.J. Phosphorylation of AKT serine/threonine kinase and abundance of milk protein synthesis gene networks in mammary tissue in response to supply of methionine in periparturient Holstein cows. J. Dairy Sci. 2019, 102, 4264–4274. [Google Scholar] [CrossRef] [PubMed]
- Flores, A.; Mendoza, G.; Pinos-Rodriguez, J.M.; Plata, F.; Vega, S.; Bárcena, R. Effects of rumen-protected methionine on milk production of dairy goats. Ital. J. Anim. Sci. 2009, 8, 271–275. [Google Scholar] [CrossRef]
- Wang, C.; Liu, H.Y.; Wang, Y.M.; Yang, Z.Q.; Liu, J.X.; Wu, Y.M.; Yan, T.; Ye, H.W. Effects of dietary supplementation of methionine and lysine on milk production and nitrogen utilization in dairy cows. J. Dairy. Sci. 2010, 93, 3661–3670. [Google Scholar] [CrossRef] [PubMed]
- Okada, T.; Lee, A.Y.; Qin, L.X.; Agaram, N.; Mimae, T.; Shen, Y.; O’Connor, R.; Lopez-Lago, M.A.; Craig, A.; Miller, M.L.; et al. Integrin-alpha10 Dependency Identifies RAC and RICTOR as Therapeutic Targets in High-Grade Myxofibrosarcoma. Cancer Discov. 2016, 6, 1148–1165. [Google Scholar] [CrossRef] [PubMed]
- Cayrol, C.; Girard, J.P. Interleukin-33 (IL-33): A nuclear cytokine from the IL-1 family. Immunol. Rev. 2018, 281, 154–168. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Huang, X.J.; Huang, Y.; Xiong, M.Y.; Yao, X.Y.; Huang, Z.N.; Li, S.N.; Zhou, W.J.; Fang, D.L.; Deng, D.H.; et al. Key immune-related gene ITGB2 as a prognostic signature for acute myeloid leukemia. Ann. Transl. Med. 2021, 9, 1386. [Google Scholar] [CrossRef]
- Tian, H.; Yu, H.; Lin, Y.; Li, Y.; Xu, W.; Chen, Y.; Liu, G.; Xie, L. Association between FADS Gene Expression and Polyunsaturated Fatty Acids in Breast Milk. Nutrients 2022, 14, 457. [Google Scholar] [CrossRef]
- Martinez, Y.; Li, X.; Liu, G.; Bin, P.; Yan, W.X.; Mas, D.; Valdivie, M.; Hu, C.A.A.; Ren, W.K.; Yin, Y.L. The role of methionine on metabolism, oxidative stress, and diseases. Amino Acids 2017, 49, 2091–2098. [Google Scholar] [CrossRef]
- Zhang, N. Role of methionine on epigenetic modification of DNA methylation and gene expression in animals. Anim. Nutr. 2018, 4, 11–16. [Google Scholar] [CrossRef]
- Lauinger, L.; Kaiser, P. Sensing and Signaling of Methionine Metabolism. Metabolites 2021, 11, 83. [Google Scholar] [CrossRef] [PubMed]
- Toledo, M.Z.; Stangaferro, M.L.; Gennari, R.S.; Barletta, R.V.; Perez, M.M.; Wijma, R.; Sitko, E.M.; Granados, G.; Masello, M.; Van Amburgh, M.E.; et al. Effects of feeding rumen-protected methionine pre- and postpartum in multiparous Holstein cows: Lactation performance and plasma amino acid concentrations. J. Dairy Sci. 2021, 104, 7583–7603. [Google Scholar] [CrossRef]
- Li, P.; Yu, M.; Zhou, C.; Qi, H.; Wen, X.; Hou, X.; Li, M.; Gao, X. FABP5 is a critical regulator of methionine- and estrogen-induced SREBP-1c gene expression in bovine mammary epithelial cells. J. Cell. Physiol. 2018, 234, 537–549. [Google Scholar] [CrossRef] [PubMed]
- Porstmann, T.; Santos, C.R.; Griffiths, B.; Cully, M.; Wu, M.; Leevers, S.; Griffiths, J.R.; Chung, Y.L.; Schulze, A. SREBP activity is regulated by mTORC1 and contributes to Akt-dependent cell growth. Cell Metab. 2008, 8, 224–236. [Google Scholar] [CrossRef] [PubMed]
- Benevenga, N.J. Toxicities of methionine and other amino acids. J. Agric. Food Chem. 1974, 22, 2–9. [Google Scholar] [CrossRef] [PubMed]
- Dioguardi, F.S. Clinical use of amino acids as dietary supplement: Pros and cons. J. Cachexia Sarcopeni 2011, 2, 75–80. [Google Scholar] [CrossRef] [PubMed]
- Dever, J.T.; Elfarra, A.A. L-methionine toxicity in freshly isolated mouse hepatocytes is gender-dependent and mediated in part by transamination. J. Pharmacol. Exp. Ther. 2008, 326, 809–817. [Google Scholar] [CrossRef] [PubMed]
- Harslof, L.B.; Larsen, L.H.; Ritz, C.; Hellgren, L.I.; Michaelsen, K.F.; Vogel, U.; Lauritzen, L. FADS genotype and diet are important determinants of DHA status: A cross-sectional study in Danish infants. Am. J. Clin. Nutr. 2013, 97, 1403–1410. [Google Scholar] [CrossRef] [PubMed]
- Ramachandraiah, K.; Puttalingaiah, R.T. The role of mixed lineage kinase 3 (MLK3) in cancers. Pharmacol. Therapeut 2022, 238, 108269. [Google Scholar] [CrossRef]
- Luo, C.; Yu, M.; Li, S.; Huang, X.; Qi, H.; Gao, X. Methionine stimulates GlyRS phosphorylation via the GPR87-CDC42/Rac1-MAP3K10 signaling pathway. Biochem. Biophys. Res. Commun. 2020, 523, 847–852. [Google Scholar] [CrossRef]
- Lin, W.R.; Chiang, J.M.; Lim, S.N.; Su, M.Y.; Chen, T.H.; Huang, S.W.; Chen, C.W.; Wu, R.C.; Tsai, C.L.; Lin, Y.H.; et al. Dynamic bioenergetic alterations in colorectal adenomatous polyps and adenocarcinomas. EBioMedicine 2019, 44, 334–345. [Google Scholar] [CrossRef] [PubMed]
- Sutherland, T.E.; Dyer, D.P.; Allen, J.E. The extracellular matrix and the immune system: A mutually dependent relationship. Science 2023, 379, eabp8964. [Google Scholar] [CrossRef] [PubMed]
- Twigger, A.J.; Engelbrecht, L.K.; Bach, K.; Schultz-Pernice, I.; Pensa, S.; Stenning, J.; Petricca, S.; Scheel, C.H.; Khaled, W.T. Transcriptional changes in the mammary gland during lactation revealed by single cell sequencing of cells from human milk. Nat. Commun. 2022, 13, 562. [Google Scholar] [CrossRef] [PubMed]
- Taddei, I.; Faraldo, M.M.; Teuliere, J.; Deugnier, M.A.; Thiery, J.P.; Glukhova, M.A. Integrins in mammary gland development and differentiation of mammary epithelium. J. Mammary Gland. Biol. Neoplasia 2003, 8, 383–394. [Google Scholar] [CrossRef] [PubMed]
- Rooney, N.; Streuli, C.H. How integrins control mammary epithelial differentiation: A possible role for the ILK-PINCH-Parvin complex. Febs Lett. 2011, 585, 1663–1672. [Google Scholar] [CrossRef] [PubMed]
- Slepicka, P.F.; Somasundara, A.V.H.; dos Santos, C.O. The molecular basis of mammary gland development and epithelial differentiation. Semin. Cell Dev. Biol. 2021, 114, 93–112. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Wang, Y.; Zhou, C.; Mei, W.; Zeng, C. PI3K/Akt/mTOR Pathway and Its Role in Cancer Therapeutics: Are We Making Headway? Front. Oncol. 2022, 12, 819128. [Google Scholar] [CrossRef]
- Kimball, S.R.; Jefferson, L.S. New functions for amino acids: Effects on gene transcription and translation. Am. J. Clin. Nutr. 2006, 83, 500s–507s. [Google Scholar] [CrossRef]
- Kimball, S.R.; Jefferson, L.S. Role of amino acids in the translational control of protein synthesis in mammals. Semin. Cell Dev. Biol. 2005, 16, 21–27. [Google Scholar] [CrossRef]
- Nan, X.; Bu, D.; Li, X.; Wang, J.; Wei, H.; Hu, H.; Zhou, L.; Loor, J.J. Ratio of lysine to methionine alters expression of genes involved in milk protein transcription and translation and mTOR phosphorylation in bovine mammary cells. Physiol. Genomics 2014, 46, 268–275. [Google Scholar] [CrossRef]
- Li, S.S.; Loor, J.J.; Liu, H.Y.; Liu, L.; Hosseini, A.; Zhao, W.S.; Liu, J.X. Optimal ratios of essential amino acids stimulate beta-casein synthesis via activation of the mammalian target of rapamycin signaling pathway in MAC-T cells and bovine mammary tissue explants. J. Dairy Sci. 2017, 100, 6676–6688. [Google Scholar] [CrossRef]





| Primer | Forward Sequences (5′-3′) | Reverse Sequences (5′-3′) |
|---|---|---|
| CSN2 | GCAGGTCCCTCAGCCTATTC | ACAGCTCTCTGAGGGTAGGG |
| CSN1S1 | AGGGCACCTAATCAGAGGGT | AATTGATGGCACTTACAGAACTGG |
| CSN3 | AAATAGCCACCCACCCACTG | GCAGGAGCTGGTGTAGGTTC |
| FADS3 | CCTGGCTCCTTATCTACCTCCT | GCTGGAAGTGGCGGAAGTT |
| SLC16A4 | TCTCCTCAGTCAGTTAGCA | GAGCAAGCAGGTTAGTGAT |
| MAP3K10 | AACCACAACCTCGCAGACA | TATTCATAGCCACGCCATACG |
| IL33 | TACTCGCTGCCTGTCAACA | CAACACCGTCACCTGATTCAT |
| ITGB2 | TATGTGGATGAGAGCCGAGAG | CCAGATGACCAGCAGGAGAA |
| SAMD9L | CAAGCAGGCAAGCACACTT | GTTAGACGACGCAGGAGGT |
| β-actin | AGACCTGTACGCCAACACAG | CGCTCAGGAGGAGCAATGAT |
| Gene | Ensenble ID | NC | Met | Log2FC | Padj |
|---|---|---|---|---|---|
| ITGB3 | ENSG00000259207 | 19.2 | 59.5 | 1.6322 | 0.00 |
| IL33 | ENSG00000137033 | 260.21 | 447.02 | 0.7808 | 0.00 |
| SDCBP2 | ENSG00000125775 | 226.52 | 355.9 | 0.6519 | 0.00 |
| ITGA10 | ENSG00000143127 | 144.82 | 217.96 | 0.5897 | 0.02 |
| BTBD19 | ENSG00000222009 | 189 | 282.59 | 0.5794 | 0.00 |
| SPRED3 | ENSG00000188766 | 173.43 | 254.18 | 0.5513 | 0.00 |
| SLC16A4 | ENSG00000168679 | 550.43 | 805.07 | 0.5485 | 0.00 |
| NTSR1 | ENSG00000101188 | 246.48 | 360.08 | 0.5459 | 0.00 |
| DNAH1 | ENSG00000114841 | 156.58 | 226.68 | 0.534 | 0.03 |
| ITGB2 | ENSG00000160255 | 1097.5 | 1589.83 | 0.5338 | 0.00 |
| SAMD9L | ENSG00000177409 | 271 | 386.57 | 0.512 | 0.00 |
| TPT1-AS1 | ENSG00000170919 | 210.16 | 298.19 | 0.5043 | 0.00 |
| TTLL3 | ENSG00000214021 | 288.57 | 405.53 | 0.492 | 0.00 |
| MAP3K10 | ENSG00000130758 | 283.86 | 395.58 | 0.4786 | 0.00 |
| FADS3 | ENSG00000221968 | 827.16 | 1139.78 | 0.4619 | 0.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, P.; Fang, X.; Hao, G.; Li, X.; Cai, Y.; Yan, Y.; Zan, L.; Yang, R.; Liu, B. Methionine Promotes Milk Protein Synthesis via the PI3K-mTOR Signaling Pathway in Human Mammary Epithelial Cells. Metabolites 2023, 13, 1149. https://doi.org/10.3390/metabo13111149
Li P, Fang X, Hao G, Li X, Cai Y, Yan Y, Zan L, Yang R, Liu B. Methionine Promotes Milk Protein Synthesis via the PI3K-mTOR Signaling Pathway in Human Mammary Epithelial Cells. Metabolites. 2023; 13(11):1149. https://doi.org/10.3390/metabo13111149
Chicago/Turabian StyleLi, Peizhi, Xibi Fang, Guijie Hao, Xiaohui Li, Yue Cai, Yuhao Yan, Liting Zan, Runjun Yang, and Boqun Liu. 2023. "Methionine Promotes Milk Protein Synthesis via the PI3K-mTOR Signaling Pathway in Human Mammary Epithelial Cells" Metabolites 13, no. 11: 1149. https://doi.org/10.3390/metabo13111149
APA StyleLi, P., Fang, X., Hao, G., Li, X., Cai, Y., Yan, Y., Zan, L., Yang, R., & Liu, B. (2023). Methionine Promotes Milk Protein Synthesis via the PI3K-mTOR Signaling Pathway in Human Mammary Epithelial Cells. Metabolites, 13(11), 1149. https://doi.org/10.3390/metabo13111149

