Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Primary Culture of Bovine Granulosa Cells
2.2. Non-Esterified Fatty Acid Preparation
2.3. Cell Transfection and Treatment
2.4. Cell Viability Assay
2.5. Immunofluorescence Staining
2.6. Assay for Malondialdehyde (MDA) and Superoxide Dismutase (SOD)
2.7. Measurement of ROS
2.8. Total RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.9. Preparation of Cytoplasm and Nuclear Extracts
2.10. Western Blot Analysis
2.11. Flow Cytometer Detection of Apoptosis
2.12. Statistical Analysis
3. Results
3.1. Proliferative and Morphological Effects of NEFA Treatment on BGCs
3.2. NEFA Produced ROS and Induced Oxidative Stress in BGCs
3.3. NEFA-Induced Apoptosis in BGCs
3.4. Effects of NEFA Treatment on Steroid Hormone Synthesis Gene Expression in BGCs
3.5. NEFA Regulated the Expression of PI3K/AKT Pathways in BGCs
3.6. AKT Activator SC79 Reduced the Sensitivity of BGCs to NEFA-Mediated Oxidative Stress
3.7. AKT Activator SC79 Inhibited NEFA-Mediated Apoptosis in BGCs
3.8. AKT Activator SC79 Reversed the Effects of NEFA on Steroid Hormone Synthesis Gene Expression in BGCs
3.9. NEFA Regulated FoxO1 Levels and Activity via PI3K/AKT Signaling Pathway in BGCs
3.10. Establishment of an in Vitro Knockdown of FoxO1
3.11. Silencing of FoxO1 by siRNA Reversed the Pro-Apoptotic Phenomenon Induced by the Addition of NEFA to BGCs
3.12. FoxO1 Regulated the Effects of NEFA on Steroid Hormone Synthesis Gene Expression in BGCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Drackley, J.K. ADSA Foundation Scholar Award. Biology of dairy cows during the transition period: The final frontier? J. Dairy Sci. 1999, 82, 2259–2273. [Google Scholar] [CrossRef] [PubMed]
- Wathes, D.C.; Fenwick, M.; Cheng, Z.; Bourne, N.; Llewellyn, S.; Morris, D.G.; Kenny, D.; Murphy, J.; Fitzpatrick, R. Influence of negative energy balance on cyclicity and fertility in the high producing dairy cow. Theriogenology 2007, 68 (Suppl. 1), S232–S241. [Google Scholar] [CrossRef]
- Ospina, P.A.; Nydam, D.V.; Stokol, T.; Overton, T.R. Association between the proportion of sampled transition cows with increased nonesterified fatty acids and beta-hydroxybutyrate and disease incidence, pregnancy rate, and milk production at the herd level. J. Dairy Sci. 2010, 93, 3595–3601. [Google Scholar] [CrossRef] [PubMed]
- Adewuyi, A.A.; Gruys, E.; van Eerdenburg, F.J. Non esterified fatty acids (NEFA) in dairy cattle. A review. Vet. Q. 2005, 27, 117–126. [Google Scholar] [CrossRef]
- Aardema, H.; van Tol, H.T.A.; Vos, P. An overview on how cumulus cells interact with the oocyte in a condition with elevated NEFA levels in dairy cows. Anim. Reprod. Sci. 2019, 207, 131–137. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Wylie, A.; Ferris, C.; Ingvartsen, K.L.; Wathes, D.C. Effect of diet and nonesterified fatty acid levels on global transcriptomic profiles in circulating peripheral blood mononuclear cells in early lactation dairy cows. J. Dairy Sci. 2021, 104, 10059–10075. [Google Scholar] [CrossRef] [PubMed]
- Contreras, G.A.; Strieder-Barboza, C.; Raphael, W. Adipose tissue lipolysis and remodeling during the transition period of dairy cows. J. Anim. Sci. Biotechnol. 2017, 8, 41. [Google Scholar] [CrossRef]
- Khan, M.Z.; Ma, Y.; Xiao, J.; Chen, T.; Ma, J.; Liu, S.; Wang, Y.; Khan, A.; Alugongo, G.M.; Cao, Z. Role of Selenium and Vitamins E and B9 in the Alleviation of Bovine Mastitis during the Periparturient Period. Antioxidants 2022, 11, 657. [Google Scholar] [CrossRef]
- Dionísio, P.A.; Amaral, J.D.; Rodrigues, C.M.P. Oxidative stress and regulated cell death in Parkinson’s disease. Ageing Res. Rev. 2021, 67, 101263. [Google Scholar] [CrossRef]
- Holze, C.; Michaudel, C.; Mackowiak, C.; Haas, D.A.; Benda, C.; Hubel, P.; Pennemann, F.L.; Schnepf, D.; Wettmarshausen, J.; Braun, M.; et al. Oxeiptosis, a ROS-induced caspase-independent apoptosis-like cell-death pathway. Nat. Immunol. 2018, 19, 130–140. [Google Scholar] [CrossRef]
- Li, Y.; Ding, H.; Liu, L.; Song, Y.; Du, X.; Feng, S.; Wang, X.; Li, X.; Wang, Z.; Li, X.; et al. Non-esterified Fatty Acid Induce Dairy Cow Hepatocytes Apoptosis via the Mitochondria-Mediated ROS-JNK/ERK Signaling Pathway. Front. Cell Dev. Biol. 2020, 8, 245. [Google Scholar] [CrossRef]
- Palumbo, A.; Yeh, J. Apoptosis as a basic mechanism in the ovarian cycle: Follicular atresia and luteal regression. J. Soc. Gynecol. Investig. 1995, 2, 565–573. [Google Scholar] [CrossRef]
- Zhou, J.; Peng, X.; Mei, S. Autophagy in Ovarian Follicular Development and Atresia. Int. J. Biol. Sci. 2019, 15, 726–737. [Google Scholar] [CrossRef]
- Baddela, V.S.; Sharma, A.; Vanselow, J. Non-esterified fatty acids in the ovary: Friends or foes? Reprod. Biol. Endocrinol. 2020, 18, 60. [Google Scholar] [CrossRef]
- Asselin, E.; Xiao, C.W.; Wang, Y.F.; Tsang, B.K. Mammalian follicular development and atresia: Role of apoptosis. Biol. Signals Recept. 2000, 9, 87–95. [Google Scholar] [CrossRef]
- De Felici, M.; Klinger, F.G. PI3K/PTEN/AKT Signaling Pathways in Germ Cell Development and Their Involvement in Germ Cell Tumors and Ovarian Dysfunctions. Int. J. Mol. Sci. 2021, 22, 9838. [Google Scholar] [CrossRef]
- Jafari, M.; Ghadami, E.; Dadkhah, T.; Akhavan-Niaki, H. PI3k/AKT signaling pathway: Erythropoiesis and beyond. J. Cell. Physiol. 2019, 234, 2373–2385. [Google Scholar] [CrossRef]
- Fang, Y.; Ou, S.; Wu, T.; Zhou, L.; Tang, H.; Jiang, M.; Xu, J.; Guo, K. Lycopene alleviates oxidative stress via the PI3K/Akt/Nrf2pathway in a cell model of Alzheimer’s disease. PeerJ 2020, 8, e9308. [Google Scholar] [CrossRef]
- Xu, Y.P.; Han, F.; Tan, J. Edaravone protects the retina against ischemia/reperfusion-induced oxidative injury through the PI3K/Akt/Nrf2 pathway. Mol. Med. Rep. 2017, 16, 9210–9216. [Google Scholar] [CrossRef]
- Link, W. Introduction to FOXO Biology. Methods Mol. Biol. 2019, 1890, 1–9. [Google Scholar] [CrossRef]
- Cao, W.; Li, M.; Wu, T.; Feng, F.; Feng, T.; Xu, Y.; Sun, C. αMSH prevents ROS-induced apoptosis by inhibiting Foxo1/mTORC2 in mice adipose tissue. Oncotarget 2017, 8, 40872–40884. [Google Scholar] [CrossRef] [PubMed]
- Kajihara, T.; Uchino, S.; Suzuki, M.; Itakura, A.; Brosens, J.J.; Ishihara, O. Increased ovarian follicle atresia in obese Zucker rats is associated with enhanced expression of the forkhead transcription factor FOXO1. Med. Mol. Morphol. 2009, 42, 216–221. [Google Scholar] [CrossRef] [PubMed]
- Shen, M.; Lin, F.; Zhang, J.; Tang, Y.; Chen, W.K.; Liu, H. Involvement of the up-regulated FoxO1 expression in follicular granulosa cell apoptosis induced by oxidative stress. J. Biol. Chem. 2012, 287, 25727–25740. [Google Scholar] [CrossRef] [PubMed]
- Murtaza, G.; Khan, A.K.; Rashid, R.; Muneer, S.; Hasan, S.M.F.; Chen, J. FOXO Transcriptional Factors and Long-Term Living. Oxid. Med. Cell. Longev. 2017, 2017, 3494289. [Google Scholar] [CrossRef] [PubMed]
- Gross, D.N.; Wan, M.; Birnbaum, M.J. The role of FOXO in the regulation of metabolism. Curr. Diab. Rep. 2009, 9, 208–214. [Google Scholar] [CrossRef]
- Hay, N. Interplay between FOXO, TOR, and Akt. Biochim. Biophys. Acta 2011, 1813, 1965–1970. [Google Scholar] [CrossRef]
- Morris, D.G.; Waters, S.M.; McCarthy, S.D.; Patton, J.; Earley, B.; Fitzpatrick, R.; Murphy, J.J.; Diskin, M.G.; Kenny, D.A.; Brass, A.; et al. Pleiotropic effects of negative energy balance in the postpartum dairy cow on splenic gene expression: Repercussions for innate and adaptive immunity. Physiol. Genomics 2009, 39, 28–37. [Google Scholar] [CrossRef]
- Schönfeld, P.; Schlüter, T.; Fischer, K.D.; Reiser, G. Non-esterified polyunsaturated fatty acids distinctly modulate the mitochondrial and cellular ROS production in normoxia and hypoxia. J. Neurochem. 2011, 118, 69–78. [Google Scholar] [CrossRef]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid. Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef]
- He, L.; He, T.; Farrar, S.; Ji, L.; Liu, T.; Ma, X. Antioxidants Maintain Cellular Redox Homeostasis by Elimination of Reactive Oxygen Species. Cell. Physiol. Biochem. 2017, 44, 532–553. [Google Scholar] [CrossRef]
- Zhang, B.; Li, M.; Zou, Y.; Guo, H.; Zhang, B.; Xia, C.; Zhang, H.; Yang, W.; Xu, C. NFκB/Orai1 Facilitates Endoplasmic Reticulum Stress by Oxidative Stress in the Pathogenesis of Non-alcoholic Fatty Liver Disease. Front. Cell Dev. Biol. 2019, 7, 202. [Google Scholar] [CrossRef]
- Qin, X.; Yang, S.; Zhang, Y.; Li, L.; Li, P.; Long, M.; Guo, Y. Effects of non-esterified fatty acids on relative abundance of prostaglandin E(2) and F(2α) synthesis-related mRNA transcripts and protein in endometrial cells of cattle in vitro. Anim. Reprod. Sci. 2020, 221, 106549. [Google Scholar] [CrossRef]
- Dietrich, J.B. Apoptosis and anti-apoptosis genes in the Bcl-2 family. Arch. Physiol. Biochem. 1997, 105, 125–135. [Google Scholar] [CrossRef]
- Yan, Y.; Huang, J.; Huan, C.; Li, L.; Li, C. Non-Esterified Fatty Acid Induces ER Stress-Mediated Apoptosis via ROS/MAPK Signaling Pathway in Bovine Mammary Epithelial Cells. Metabolites 2022, 12, 803. [Google Scholar] [CrossRef]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular growth and atresia in mammalian ovaries: Regulation by survival and death of granulosa cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef]
- Drummond, A.E. The role of steroids in follicular growth. Reprod. Biol. Endocrinol. 2006, 4, 16. [Google Scholar] [CrossRef]
- Engelking, L.J.; Cantoria, M.J.; Xu, Y.; Liang, G. Developmental and extrahepatic physiological functions of SREBP pathway genes in mice. Semin. Cell Dev. Biol. 2018, 81, 98–109. [Google Scholar] [CrossRef]
- Ortega-García, A.P.; Díaz-Hernández, V.; Collazo-Saldaña, P.; Merchant-Larios, H. Bisphenol A alters differentiation of Leydig cells in the rabbit fetal testis. Int. J. Dev. Biol. 2021, 65, 403–412. [Google Scholar] [CrossRef]
- Lima, F.S.; Acosta, D.A.V.; Egan, T.R.; Skenandore, C.; Sulzberger, S.; French, D.D.; Cardoso, F.C. Steroidogenic, Metabolic, and Immunological Markers in Dairy Cows Diagnosed with Cystic Ovarian Follicles at Early and Mid-Late Lactation. Front. Vet. Sci. 2019, 6, 324. [Google Scholar] [CrossRef]
- Guengerich, F.P. Cytochrome P450 research and The Journal of Biological Chemistry. J. Biol. Chem. 2019, 294, 1671–1680. [Google Scholar] [CrossRef]
- Pan, Z.; Zhang, J.; Lin, F.; Ma, X.; Wang, X.; Liu, H. Expression profiles of key candidate genes involved in steroidogenesis during follicular atresia in the pig ovary. Mol. Biol. Rep. 2012, 39, 10823–10832. [Google Scholar] [CrossRef] [PubMed]
- Akhtar, M.; Wright, J.N.; Lee-Robichaud, P. A review of mechanistic studies on aromatase (CYP19) and 17α-hydroxylase-17,20-lyase (CYP17). J. Steroid Biochem. Mol. Biol. 2011, 125, 2–12. [Google Scholar] [CrossRef] [PubMed]
- Ferst, J.G.; Missio, D.; Bertolin, K.; Gasperin, B.G.; Leivas, F.G.; Bordignon, V.; Gonçalves, P.B.; Ferreira, R. Intrafollicular injection of nonesterified fatty acids impaired dominant follicle growth in cattle. Anim. Reprod. Sci. 2020, 219, 106536. [Google Scholar] [CrossRef] [PubMed]
- Hoxhaj, G.; Manning, B.D. The PI3K-AKT network at the interface of oncogenic signalling and cancer metabolism. Nat. Rev. Cancer 2020, 20, 74–88. [Google Scholar] [CrossRef]
- Kma, L.; Baruah, T.J. The interplay of ROS and the PI3K/Akt pathway in autophagy regulation. Biotechnol. Appl. Biochem. 2022, 69, 248–264. [Google Scholar] [CrossRef]
- Sun, R.; Xiao, R.; Lv, P.; Guo, F.; Gong, Y.; Yan, M. Pink Lotus Essential Oil and Alleviates on Free Fatty Acid Induced Steatosis in HepG2 Cells via PI3K/Akt and NF-κB Pathways. J. Oleo Sci. 2022, 71, 95–104. [Google Scholar] [CrossRef]
- Li, S.T.; Chen, N.N.; Qiao, Y.B.; Zhu, W.L.; Ruan, J.W.; Zhou, X.Z. SC79 rescues osteoblasts from dexamethasone though activating Akt-Nrf2 signaling. Biochem. Biophys. Res. Commun. 2016, 479, 54–60. [Google Scholar] [CrossRef]
- Jing, Z.T.; Liu, W.; Xue, C.R.; Wu, S.X.; Chen, W.N.; Lin, X.J.; Lin, X. AKT activator SC79 protects hepatocytes from TNF-α-mediated apoptosis and alleviates d-Gal/LPS-induced liver injury. Am. J. Physiol. Gastrointest. Liver Physiol. 2019, 316, G387–G396. [Google Scholar] [CrossRef]
- Konstandi, M.; Andriopoulou, C.E.; Cheng, J.; Gonzalez, F.J. Sex steroid hormones differentially regulate CYP2D in female wild-type and CYP2D6-humanized mice. J. Endocrinol. 2020, 245, 301–314. [Google Scholar] [CrossRef]
- Wei, C.; Xiang, S.; Yu, Y.; Song, J.; Zheng, M.; Lian, F. miR-221-3p regulates apoptosis of ovarian granulosa cells via targeting FOXO1 in older women with diminished ovarian reserve (DOR). Mol. Reprod. Dev. 2021, 88, 251–260. [Google Scholar] [CrossRef]
- Shukla, S.; Rizvi, F.; Raisuddin, S.; Kakkar, P. FoxO proteins’ nuclear retention and BH3-only protein Bim induction evoke mitochondrial dysfunction-mediated apoptosis in berberine-treated HepG2 cells. Free Radic. Biol. Med. 2014, 76, 185–199. [Google Scholar] [CrossRef]
- Xue, R.; Li, S.; Zou, H.; Ji, D.; Lv, M.; Zhou, P.; Wei, Z.; Zhang, Z.; Cao, Y. Melatonin alleviates deoxynivalenol-induced apoptosis of human granulosa cells by reducing mutually accentuated FOXO1 and ER stress‡. Biol. Reprod. 2021, 105, 554–566. [Google Scholar] [CrossRef]
- Shao, M.; He, Z.; Yin, Z.; Ma, P.; Xiao, Q.; Song, Y.; Huang, Z.; Ma, Y.; Qiu, Y.; Zhao, A.; et al. Xihuang Pill Induces Apoptosis of Human Glioblastoma U-87 MG Cells via Targeting ROS-Mediated Akt/mTOR/FOXO1 Pathway. Evid. Based Complement. Alternat. Med. 2018, 2018, 6049498. [Google Scholar] [CrossRef]
- Zhang, J.; Ng, S.; Wang, J.; Zhou, J.; Tan, S.H.; Yang, N.; Lin, Q.; Xia, D.; Shen, H.M. Histone deacetylase inhibitors induce autophagy through FOXO1-dependent pathways. Autophagy 2015, 11, 629–642. [Google Scholar] [CrossRef]
- He, Q.; Luo, J.; Wu, J.; Yao, W.; Li, Z.; Wang, H.; Xu, H. FoxO1 Knockdown Promotes Fatty Acid Synthesis via Modulating SREBP1 Activities in the Dairy Goat Mammary Epithelial Cells. J. Agric. Food Chem. 2020, 68, 12067–12078. [Google Scholar] [CrossRef]
- Ioannilli, L.; Ciccarone, F.; Ciriolo, M.R. Adipose Tissue and FoxO1: Bridging Physiology and Mechanisms. Cells 2020, 9, 849. [Google Scholar] [CrossRef]
- Lee, H.; Lee, J. Anti-diabetic effect of hydroxybenzoic acid derivatives in free fatty acid-induced HepG2 cells via miR-1271/IRS1/PI3K/AKT/FOXO1 pathway. J. Food Biochem. 2021, 45, e13993. [Google Scholar] [CrossRef]
- Moeinifard, M.; Hassan, Z.M.; Fallahian, F.; Hamzeloo-Moghadam, M.; Taghikhani, M. Britannin induces apoptosis through AKT-FOXO1 pathway in human pancreatic cancer cells. Biomed. Pharmacother. 2017, 94, 1101–1110. [Google Scholar] [CrossRef]
- Tan, S.H.; Shui, G.; Zhou, J.; Shi, Y.; Huang, J.; Xia, D.; Wenk, M.R.; Shen, H.M. Critical role of SCD1 in autophagy regulation via lipogenesis and lipid rafts-coupled AKT-FOXO1 signaling pathway. Autophagy 2014, 10, 226–242. [Google Scholar] [CrossRef]
- Zhou, J.; Liao, W.; Yang, J.; Ma, K.; Li, X.; Wang, Y.; Wang, D.; Wang, L.; Zhang, Y.; Yin, Y.; et al. FOXO3 induces FOXO1-dependent autophagy by activating the AKT1 signaling pathway. Autophagy 2012, 8, 1712–1723. [Google Scholar] [CrossRef]
Genes | Forward (5′-3′) | Reverse (5′-3′) | Accession Number |
---|---|---|---|
SOD2 | TGAGCCCTAACGGTGGTGGA | ATTGAAGCCGAGCCAACCCC | NM_201527.2 |
NQO1 | CCGAGGATGCCCGAGTTCAG | ACTTGCCCAAGTGATGGCCC | NM_001034535.1 |
HMOX1 | CAGGCACCTCTCCTGCGATG | AGACAGCAGGAGCCCTGACA | NM_001014912.1 |
Bax | CATCATGGGCTGGACATTGG | AAGATGGTCACTGTCTGCCA | NM_173894.1 |
Bcl-2 | ATGACCGAGTACCTGAACCG | GCCATACAGCTCCACAAAGG | NM_001166486.1 |
Caspase-3 | TTGAGACAGACAGTGGTGCT | TCTTTGCATTTCGCCAGGAA | NM_001077840.1 |
SREBP-1 | CCTGTGGGCCACCGTTTCTT | CCACGCAATTCAGTGCTCGC | NM_001113302.1 |
HSD3β1 | AACCCTTGCTTCAACCGCCA | CCCAGGCTTGTGTCCGTGTT | NM_174343.3 |
StAR | TGACGTGGGCAAGGTGTTCC | ATGCCAGCCAGCACACACAT | NM_174189.3 |
CYP11 | AGACTTGGAGGGACCATGTA | GGATGCCTGGGTAATTCCTAAA | NM_176644.2 |
CYP17 | CTGCTGCCACCCAGACACAA | GGCCAACTGGTGGTGTCCAA | NM_174304.2 |
CYP19 | GACGCTTCCACGTGCAGACT | GGGGCAGGGACTGACCAAAC | NM_174305.1 |
PI3K | TTGCCGTGCATGTGGGATGT | GGTCGCCGCATTTGCTCAAC | NM_174574.1 |
AKT | CGTTCTCCAGAACTCCCGGC | GGTAATCCAGGGCCGACACG | NM_173986.2 |
FoxO1 | CGACTCACGCTGTCGCAGAT | GCACGCGGATGAACTTGCTG | XM_025000053.1 |
BIM | TGCGTCACCAGGCAGTTGAG | CTGCCCACCCTTCCAGCAAA | NM_001075310.1 |
β-actin | GGGCAGGTCATCACCATCGG | TCATTGTGCTGGGTGCCAGG | NM_173979.3 |
Antibody | Host Species | Dilution | Vendor | Catalog Number |
---|---|---|---|---|
SOD2 | rabbit | 1:500 | ABclonal Technology, China | A1340 |
Bax | rabbit | 1:2000 | Proteintech, China | 50599-2-Ig |
Bcl-2 | rabbit | 1:500 | Wanleibio, China | WL01556 |
Cleaved Caspase-3 | rabbit | 1:500 | Affinity, China | AF7022 |
SREBP-1 | rabbit | 1:1000 | Proteintech, China | 14088-1-AP |
CYP17 | rabbit | 1:500 | ABclonal Technology, China | A5067 |
CYP19 | rabbit | 1:500 | ABclonal Technology, China | A2161 |
AKT | rabbit | 1:500 | Bioss, China | bs-0115R |
p-AKT | rabbit | 1:500 | ABclonal Technology, China | AP0637 |
PI3K | rabbit | 1:500 | ABclonal Technology, China | A0265 |
FoxO1 | rabbit | 1:1000 | Cell Signalling Technology, USA | #2880 |
p-FoxO1 | rabbit | 1:500 | ABclonal Technology, China | AP0172 |
BIM | rabbit | 1:500 | ABclonal Technology, China | A15771 |
GAPDH | rabbit | 1:5000 | Proteintech, China | 10494-1-AP |
histone-H3 | rabbit | 1:2000 | Proteintech, China | 17168-1-AP |
β-Tubulin | rabbit | 1:5000 | Bioworld Technology, USA | AP0064 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lei, Z.; Ali, I.; Yang, M.; Yang, C.; Li, Y.; Li, L. Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway. Antioxidants 2023, 12, 434. https://doi.org/10.3390/antiox12020434
Lei Z, Ali I, Yang M, Yang C, Li Y, Li L. Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway. Antioxidants. 2023; 12(2):434. https://doi.org/10.3390/antiox12020434
Chicago/Turabian StyleLei, Zhiqi, Ilyas Ali, Min Yang, Caixia Yang, Yifei Li, and Lian Li. 2023. "Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway" Antioxidants 12, no. 2: 434. https://doi.org/10.3390/antiox12020434
APA StyleLei, Z., Ali, I., Yang, M., Yang, C., Li, Y., & Li, L. (2023). Non-Esterified Fatty Acid-Induced Apoptosis in Bovine Granulosa Cells via ROS-Activated PI3K/AKT/FoxO1 Pathway. Antioxidants, 12(2), 434. https://doi.org/10.3390/antiox12020434