Dietary Methionine Hydroxy Analog Regulates Hepatic Lipid Metabolism via SIRT1/AMPK Signaling Pathways in Largemouth Bass Micropterus salmodies
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets, Feeding Trial and Sampling
2.2. Biochemical Analysis
2.3. Hepatic Histological Analysis
2.4. Real-Time Quantitative PCR
2.5. Protein Extraction and Western Blot Analysis
2.6. Statistical Analysis
3. Results
3.1. Hepatic Steatosis and Lipid Content
3.2. Lipid Synthesis-Related Parameters in Liver
3.3. Lipid Oxidation-Related Parameters in Liver
3.4. Dietary MHA Down-Regulated Hepatic SIRT1/AMPK Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhao, Y.; Yang, C.; Zhu, X.; Feng, L.; Liu, Y.; Jiang, W.; Wu, P.; Huang, X.; Chen, D.; Yang, S.; et al. Dietary methionine hydroxy analogue supplementation benefits on growth, intestinal antioxidant status and microbiota in juvenile largemouth bass Micropterus salmoides. Aquaculture 2022, 556, 738279. [Google Scholar] [CrossRef]
- Rajeev Raghavan, P.Z.X.L. Low levels of aflatoxin b1 could cause mortalities in juvenile hybrid sturgeon, Acipenser ruthenus ♂×A. Baeri♀. Aquacult. Nutr. 2011, 17, e39–e47. [Google Scholar] [CrossRef]
- Moraes, G.; de Almeida, L.C. Nutrition and functional aspects of digestion in fish. In Biology and Physiology of Freshwater Neotropical Fish; Baldisserotto, B., Urbinati, E.C., Cyrino, J.E.P., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 251–271. [Google Scholar]
- Skiba-Cassy, S.; Geurden, I.; Panserat, S.; Seiliez, I. Dietary methionine imbalance alters the transcriptional regulation of genes involved in glucose, lipid and amino acid metabolism in the liver of rainbow trout (Oncorhynchus mykiss). Aquaculture 2016, 454, 56–65. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, Q.; Wei, Y.; Liao, Z.; Liang, M. Dietary methionine increased the lipid accumulation in juvenile tiger puffer Takifugu rubripes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2019, 230, 19–28. [Google Scholar] [CrossRef] [PubMed]
- Malloy, V.L.; Perrone, C.E.; Mattocks, D.A.; Ables, G.P.; Caliendo, N.S.; Orentreich, D.S.; Orentreich, N. Methionine restriction prevents the progression of hepatic steatosis in leptin-deficient obese mice. Metabolism 2013, 62, 1651–1661. [Google Scholar] [CrossRef]
- Wang, Z.; Mai, K.; Xu, W.; Zhang, Y.; Liu, Y.; Ai, Q. Dietary methionine level influences growth and lipid metabolism via GCN2 pathway in cobia (Rachycentron canadum). Aquaculture 2016, 454, 148–156. [Google Scholar] [CrossRef]
- Nguyen, P.; Leray, V.; Diez, M.; Serisier, S.; Le Bloc’H, J.; Siliart, B.; Dumon, H. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. 2008, 92, 272–283. [Google Scholar] [CrossRef]
- Peng, M.; Xu, W.; Mai, K.; Zhou, H.; Zhang, Y.; Liufu, Z.; Zhang, K.; Ai, Q. Growth performance, lipid deposition and hepatic lipid metabolism related gene expression in juvenile turbot (Scophthalmus maximus L.) fed diets with various fish oil substitution levels by soybean oil. Aquaculture 2014, 433, 442–449. [Google Scholar] [CrossRef]
- Moon, Y.A. The SCAP/SREBP pathway: A mediator of hepatic steatosis. Endocrinol. Metab. 2017, 32, 6–10. [Google Scholar] [CrossRef]
- Morak, M.; Schmidinger, H.; Riesenhuber, G.; Rechberger, G.N.; Kollroser, M.; Haemmerle, G.; Zechner, R.; Kronenberg, F.; Hermetter, A. Adipose triglyceride lipase (ATGL) and hormone-sensitive lipase (HSL) deficiencies affect expression of lipolytic activities in mouse adipose tissues. Mol. Cell. Proteom. 2012, 11, 1777–1789. [Google Scholar] [CrossRef]
- Chen, H.; Zhang, L.; Li, X.; Li, X.; Sun, G.; Yuan, X.; Lei, L.; Liu, J.; Yin, L.; Deng, Q.; et al. Adiponectin activates the AMPK signaling pathway to regulate lipid metabolism in bovine hepatocytes. J. Steroid Biochem. Mol. Biol. 2013, 138, 445–454. [Google Scholar] [CrossRef] [PubMed]
- Aissa, A.F.; Tryndyak, V.; de Conti, A.; Melnyk, S.; Gomes, T.D.; Bianchi, M.L.; James, S.J.; Beland, F.A.; Antunes, L.M.; Pogribny, I.P. Effect of methionine-deficient and methionine-supplemented diets on the hepatic one-carbon and lipid metabolism in mice. Mol. Nutr. Food Res. 2014, 58, 1502–1512. [Google Scholar] [CrossRef] [PubMed]
- Craig, P.M.; Moon, T.W. Methionine restriction affects the phenotypic and transcriptional response of rainbow trout (Oncorhynchus mykiss) to carbohydrate-enriched diets. Br. J. Nutr. 2013, 109, 402–412. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Gao, Y.; Hogstrand, C.; Li, D.; Pan, Y.; Luo, Z. Upstream regulators of apoptosis mediates methionine-induced changes of lipid metabolism. Cell Signal. 2018, 51, 176–190. [Google Scholar] [CrossRef]
- Ji, K.; Liang, H.; Ren, M.; Ge, X.; Pan, L.; Yu, H. Nutrient metabolism in the liver and muscle of juvenile blunt snout bream (Megalobrama amblycephala) in response to dietary methionine levels. Sci. Rep.-Uk 2021, 11, 23843. [Google Scholar] [CrossRef]
- Hou, X.; Xu, S.; Maitland-Toolan, K.A.; Sato, K.; Jiang, B.; Ido, Y.; Lan, F.; Walsh, K.; Wierzbicki, M.; Verbeuren, T.J.; et al. SIRT1 regulates hepatocyte lipid metabolism through activating AMP-activated protein kinase. J. Biol. Chem. 2008, 283, 20015–20026. [Google Scholar] [CrossRef]
- Li, J.; Liu, M.; Yu, H.; Wang, W.; Han, L.; Chen, Q.; Ruan, J.; Wen, S.; Zhang, Y.; Wang, T. Mangiferin Improves Hepatic Lipid Metabolism Mainly Through Its Metabolite-Norathyriol by Modulating SIRT-1/AMPK/SREBP-1c Signaling. Front. Pharmacol. 2018, 9, 201. [Google Scholar] [CrossRef]
- Zhang, Y.; Geng, C.; Liu, X.; Li, M.; Gao, M.; Liu, X.; Fang, F.; Chang, Y. Celastrol ameliorates liver metabolic damage caused by a high-fat diet through Sirt1. Mol. Metab. 2017, 6, 138–147. [Google Scholar] [CrossRef]
- Chan, S.H.; Hung, C.H.; Shih, J.Y.; Chu, P.M.; Cheng, Y.H.; Lin, H.C.; Hsieh, P.L.; Tsai, K.L. Exercise intervention attenuates hyperhomocysteinemia-induced aortic endothelial oxidative injury by regulating SIRT1 through mitigating NADPH oxidase/LOX-1 signaling. Redox Biol. 2018, 14, 116–125. [Google Scholar] [CrossRef]
- Grant, L.; Lees, E.K.; Forney, L.A.; Mody, N.; Gettys, T.; Brown, P.A.; Wilson, H.M.; Delibegovic, M. Methionine restriction improves renal insulin signalling in aged kidneys. Mech. Ageing Dev. 2016, 157, 35–43. [Google Scholar] [CrossRef]
- Hasek, B.E.; Stewart, L.K.; Henagan, T.M.; Boudreau, A.; Lenard, N.R.; Black, C.; Shin, J.; Huypens, P.; Malloy, V.L.; Plaisance, E.P.; et al. Dietary methionine restriction enhances metabolic flexibility and increases uncoupled respiration in both fed and fasted states. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2010, 299, R728–R739. [Google Scholar] [CrossRef] [PubMed]
- Jiang, H.; Bian, F.; Zhou, H.; Wang, X.; Wang, K.; Mai, K.; He, G. Nutrient sensing and metabolic changes after methionine deprivation in primary muscle cells of turbot (Scophthalmus maximus L.). J. Nutr. Biochem. 2017, 50, 74–82. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.S.Z.L. Addition of l-carnitine to formulated feed improved growth performance, antioxidant status and lipid metabolism of juvenile largemouth bass, Micropterus salmoides. Aquaculture 2020, 518, 734434. [Google Scholar] [CrossRef]
- Jiang, J.; Wu, X.Y.; Zhou, X.Q.; Feng, L.; Liu, Y.; Jiang, W.D.; Wu, P.; Zhao, Y. Glutamate ameliorates copper-induced oxidative injury by regulating antioxidant defences in fish intestine. Br. J. Nutr. 2016, 116, 70–79. [Google Scholar] [CrossRef]
- Folch, J.; Lees, M.; Sloane, S.G. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Hultmann, L.; Phu, T.M.; Tobiassen, T.; Aas-Hansen, Ø.; Rustad, T. Effects of pre-slaughter stress on proteolytic enzyme activities and muscle quality of farmed Atlantic cod (Gadus morhua). Food Chem. 2012, 134, 1399–1408. [Google Scholar] [CrossRef]
- Yu, L.L.; Yu, H.H.; Liang, X.F.; Li, N.; Wang, X.; Li, F.H.; Wu, X.F.; Zheng, Y.H.; Xue, M.; Liang, X.F. Dietary butylated hydroxytoluene improves lipid metabolism, antioxidant and anti-apoptotic response of largemouth bass (Micropterus salmoides). Fish. Shellfish. Immunol. 2018, 72, 220–229. [Google Scholar] [CrossRef]
- Ye, H.; Xu, M.; Chen, L.; Tan, X.; Chen, S.; Zou, C.; Sun, Z.; Liu, Q.; Ye, C.; Wang, A. Effects of dietary plant protein sources influencing hepatic lipid metabolism and hepatocyte apoptosis in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀). Aquaculture 2019, 506, 437–444. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wu, P.; Tang, L.; Jiang, W.; Hu, K.; Liu, Y.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; Zhang, Y.; et al. The relationship between dietary methionine and growth, digestion, absorption, and antioxidant status in intestinal and hepatopancreatic tissues of sub-adult grass carp (Ctenopharyngodon idella). J. Anim. Sci. Biotechnol. 2017, 8, 63. [Google Scholar] [CrossRef]
- Tocher, D.R. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 2003, 11, 107–184. [Google Scholar] [CrossRef]
- Greene, D.H.; Selivonchick, D.P. Lipid metabolism in fish. Prog. Lipid Res. 1987, 26, 53–85. [Google Scholar] [CrossRef] [PubMed]
- Qiang, J.; Tao, Y.F.; Bao, J.W.; Chen, D.J.; Li, H.X.; He, J.; Xu, P. High fat diet-induced miR-122 regulates lipid metabolism and fat deposition in genetically improved farmed tilapia (GIFT, Oreochromis niloticus) liver. Front. Physiol. 2018, 9, 1422. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.H. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 1997, 17, 77–99. [Google Scholar] [CrossRef]
- Smith, S.; Witkowski, A.; Joshi, A.K. Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 2003, 42, 289–317. [Google Scholar] [CrossRef]
- Forney, L.A.; Stone, K.P.; Wanders, D.; Ntambi, J.M.; Gettys, T.W. The role of suppression of hepatic SCD1 expression in the metabolic effects of dietary methionine restriction. Appl. Physiol. Nutr. Metab. 2018, 43, 123–130. [Google Scholar] [CrossRef]
- Schlaepfer, I.R.; Joshi, M. CPT1a-mediated fat oxidation, mechanisms, and therapeutic potential. Endocrinology 2020, 161, bqz046. [Google Scholar] [CrossRef]
- Canbay, A.; Bechmann, L.; Gerken, G. Lipid metabolism in the liver. Z. Für Gastroenterol. 2007, 45, 35. [Google Scholar] [CrossRef]
- Steinberg, G.R.; Kemp, B.E. AMPK in health and disease. Physiol. Rev. 2009, 89, 1025–1078. [Google Scholar] [CrossRef]
- Barroso, E.; Rodriguez-Calvo, R.; Serrano-Marco, L.; Astudillo, A.M.; Balsinde, J.; Palomer, X.; Vazquez-Carrera, M. The PPARβ/δ activator GW501516 prevents the down-regulation of AMPK caused by a high-fat diet in liver and amplifies the PGC-1α-Lipin 1-PPARα pathway leading to increased fatty acid oxidation. Endocrinology 2011, 152, 1848–1859. [Google Scholar] [CrossRef]
- Jung, E.J.; Kwon, S.W.; Jung, B.H.; Oh, S.H.; Lee, B.H. Role of the AMPK/SREBP-1 pathway in the development of orotic acid-induced fatty liver. J. Lipid Res. 2011, 52, 1617–1625. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.; et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab. 2011, 13, 376–388. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Sun, B.; Yu, C.; Cao, Y.; Cai, C.; Yao, J. Choline and methionine regulate lipid metabolism via the AMPK signaling pathway in hepatocytes exposed to high concentrations of nonesterified fatty acids. J. Cell Biochem. 2020, 121, 3667–3678. [Google Scholar] [CrossRef] [PubMed]
- Liou, C.J.; Dai, Y.W.; Wang, C.L.; Fang, L.W.; Huang, W.C. Maslinic acid protects against obesity-induced nonalcoholic fatty liver disease in mice through regulation of the Sirt1/AMPK signaling pathway. Faseb J. 2019, 33, 11791–11803. [Google Scholar] [CrossRef]
- Zhang, D.; Yan, Y.; Tian, H.; Jiang, G.; Li, X.; Liu, W. Resveratrol supplementation improves lipid and glucose metabolism in high-fat diet-fed blunt snout bream. Fish. Physiol. Biochem. 2018, 44, 163–173. [Google Scholar] [CrossRef]




| Ingredients | Dietary MHA Level | |||
|---|---|---|---|---|
| 0.0 | 3.0 | 6.0 | 9.0 | |
| Fish meal | 250.0 | 250.0 | 250.0 | 250 |
| Soybean meal | 220.0 | 220.0 | 220.0 | 220.0 |
| Corn protein meal | 100.0 | 100.0 | 100.0 | 100.0 |
| Gelatin | 60.0 | 60.0 | 60.0 | 60.0 |
| Soybean oil | 100.0 | 100.0 | 100.0 | 100.0 |
| Wheat flour | 165.0 | 162.0 | 159.0 | 156.0 |
| CaH2PO4 | 40.0 | 40.0 | 40.0 | 40.0 |
| Methionine hydroxy analog | 0.0 | 3.0 | 6.0 | 9.0 |
| Vitamin premix 1 | 10.0 | 10.0 | 10.0 | 10.0 |
| Mineral premix 2 | 20.0 | 20.0 | 20.0 | 20.0 |
| Amino acid premix 3 | 11.8 | 11.8 | 11.8 | 11.8 |
| Choline chloride (50%) | 10.0 | 10.0 | 10.0 | 10.0 |
| Ethoxyquin (30%) | 0.5 | 0.5 | 0.5 | 0.5 |
| Microcrystalline cellulose | 12.7 | 12.7 | 12.7 | 12.7 |
| Nutrients content 4 | ||||
| Crude protein | 419.6 | 417.8 | 417.7 | 416.7 |
| Crude lipid | 124.6 | 126.8 | 127.0 | 125.2 |
| Crude ash | 105.8 | 106.2 | 105.7 | 106.4 |
| Moisture | 96.2 | 94.1 | 93.7 | 94.9 |
| MHA Levels | 0.0 | 3.0 | 6.0 | 9.0 |
|---|---|---|---|---|
| Thr | 16.6 | 16.4 | 17.1 | 16.8 |
| Val | 18.5 | 18.7 | 17.9 | 19.2 |
| Met | 8.3 | 11.0 | 13.6 | 16.3 |
| Cys | 6.5 | 6.2 | 6.7 | 6.4 |
| Ile | 15.5 | 16.4 | 16.0 | 16.7 |
| Leu | 31.0 | 30.5 | 31.3 | 31.6 |
| Phe | 15.7 | 16.2 | 15.8 | 16.4 |
| Tyr | 12.9 | 12.7 | 12.1 | 12.5 |
| His | 10.6 | 10.2 | 10.8 | 10.3 |
| Lys | 20.1 | 20.6 | 20.8 | 19.9 |
| Arg | 22.5 | 22.7 | 22.2 | 22.6 |
| Trp | 3.4 | 3.6 | 3.3 | 3.1 |
| Name | Sequences | OAT | Accession Number |
|---|---|---|---|
| ACC1-QF | GGCTCAGTGATGGAGGTCTAT | 62.3 | MW465382 |
| ACC1-QR | GGTGATCGTAGCAGTGAAGGA | ||
| ACC2-QF | TGGAAAGGGTATCCGTAAAGT | 61.8 | MW435454 |
| ACC2-QR | AGCAGTCTCGTCCGAACAG | ||
| FAS-QF | CAGGTCTGTACGGTCTTCCA | 62.2 | MW465391 |
| FAS-QR | CGGGTTCACTCCTCCATCTA | ||
| SCD1-QF | TATCTTTGAATGGGCTCGTGA | 60.1 | MW465401 |
| SCD1-QR | AACTTTGTCGGCGTACAGGTC | ||
| ATGL-QF | GGAATCTCAGACAACCTGCCTC | 62.7 | XM_038705351 |
| ATGL-QR | GGTGGAGTGAACTGGATGCTT | ||
| HSLa-QF | TGAACGCATTACCCAGAACC | 61.8 | MW465409 |
| HSLa-QR | GTGTAGAGTCACAGGAGGCAAA | ||
| HSLb-QF | TCGTCTCCCTGCCTCCTAAT | 62.3 | MW465407 |
| HSLb-QR | GGCGTAGAAACACTCCTCCAG | ||
| CPT1-QF | TTCCCCTTTATTGAC | 60.0 | XM_038705335.1 |
| CPT1-QR | AGAACTTCCCTTTGTC | ||
| PPARα-QF | TGGAGCTGGATGACACTGACC | 59.0 | MK388672.1 |
| PPARα-QR | GAGCCGTAGTGCCTGAACAAT | ||
| SREBP-1c-QF | CCTCCCAGTCCTTTGCTATTG | 57.9 | MW465403 |
| SREBP-1c-QR | TCCTTGGAGCCAGTTGATGA | ||
| AMPKα1-QF | CCTGAAGGAGGTATGTGACAAG | 60.7 | MW465410 |
| AMPKα1-QR | CAATGATGAGATGGTAGGCAAC | ||
| AMPKα2-QF | GAGGCGTCTTCTACATCCCA | 58.7 | MW465405 |
| AMPKα2-QR | GGTCCTGCTTAAACCATTCAT | ||
| LKB1-QF | CTACCAGCCACGGAGGAAG | 62.7 | MW465396 |
| LKB1-QR | TGCGGCATAGTGTCTCTGAGT | ||
| SIRT1-QF | TACCAGAACAGCCACCAAGT | 58.7 | MW465402 |
| SIRT1-QR | CATTATTACCAGCAGTCTCCGT | ||
| β-actin-QF | CCCCATCCACCATGAAGA | 55.7 | AF253319.1 |
| β-actin-QR | CCTGCTTGCTGATCCACAT | ||
| 18S-QF | TGAATACCGCAGCTAGGAATAATG | 59.0 | MH018569.1 |
| 18S-QR | CCTCCGACTTTCGTTCTTGATT |
| Items 2 | Dietary MHA Levels, g/kg | Pr > F2 | |||||
|---|---|---|---|---|---|---|---|
| 0.0 | 3.0 | 6.0 | 9.0 | ANOVA | Linear | Quadratic | |
| ACC | 65.86 ± 4.70 a | 77.54 ± 4.73 b | 80.88 ± 5.05 b | 86.96 ± 2.54 c | 0.00 | <0.0001 | 0.06 |
| FAS | 48.86 ± 5.44 a | 61.36 ± 2.72 b | 73.29 ± 3.25 c | 75.25 ± 2.25 c | 0.00 | <0.0001 | 0.00 |
| SCD-1 | 52.93 ± 3.03 a | 64.24 ± 3.10 b | 84.37 ± 9.13 c | 89.49 ± 7.11 c | 0.00 | <0.0001 | 0.14 |
| HSL | 205.04 ± 14.56 c | 164.07 ± 6.40 b | 155.73 ± 6.52 b | 133.59 ± 13.79 a | 0.00 | <0.0001 | 0.06 |
| CPT-1 | 243.67 ± 4.24 c | 212.75 ± 4.36 b | 179.42 ± 10.19 a | 168.79 ± 7.20 a | 0.00 | <0.0001 | 0.15 |
| Independent Parameters | Dependent Parameters | Correlation Coefficients | p |
|---|---|---|---|
| ACC | ACC1 mRNA | 0.956 | 0.044 |
| FAS | FAS mRNA | 0.976 | 0.024 |
| SCD1 | SCD1 mRNA | 0.953 | 0.047 |
| HSL | HSLa mRNA | 0.988 | 0.012 |
| CPT-1 | CPT-1 mRNA | 0.818 | 0.091 |
| SREBP-1c mRNA | ACC1 mRNA | 0.977 | 0.023 |
| ACC2 mRNA | 0.981 | 0.019 | |
| FAS mRNA | 0.963 | 0.037 | |
| SCD1 mRNA | 0.932 | 0.068 | |
| PPARα mRNA | ATGL mRNA | 0.984 | 0.016 |
| HSLa mRNA | 0.988 | 0.012 | |
| CPT-1 mRNA | 0.942 | 0.058 | |
| AMPKα1 mRNA | SREBP-1c mRNA | −0.964 | 0.036 |
| PPARα mRNA | 0.962 | 0.038 | |
| SIRT1 mRNA | 0.947 | 0.053 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, J.; Yang, Z.; Liu, H.; Yang, C.; Chen, Y.; Cao, Q.; Jiang, J. Dietary Methionine Hydroxy Analog Regulates Hepatic Lipid Metabolism via SIRT1/AMPK Signaling Pathways in Largemouth Bass Micropterus salmodies. Biology 2025, 14, 227. https://doi.org/10.3390/biology14030227
Zhao J, Yang Z, Liu H, Yang C, Chen Y, Cao Q, Jiang J. Dietary Methionine Hydroxy Analog Regulates Hepatic Lipid Metabolism via SIRT1/AMPK Signaling Pathways in Largemouth Bass Micropterus salmodies. Biology. 2025; 14(3):227. https://doi.org/10.3390/biology14030227
Chicago/Turabian StyleZhao, Ju, Zhongjie Yang, Haifeng Liu, Chao Yang, Yujun Chen, Quanquan Cao, and Jun Jiang. 2025. "Dietary Methionine Hydroxy Analog Regulates Hepatic Lipid Metabolism via SIRT1/AMPK Signaling Pathways in Largemouth Bass Micropterus salmodies" Biology 14, no. 3: 227. https://doi.org/10.3390/biology14030227
APA StyleZhao, J., Yang, Z., Liu, H., Yang, C., Chen, Y., Cao, Q., & Jiang, J. (2025). Dietary Methionine Hydroxy Analog Regulates Hepatic Lipid Metabolism via SIRT1/AMPK Signaling Pathways in Largemouth Bass Micropterus salmodies. Biology, 14(3), 227. https://doi.org/10.3390/biology14030227

