Rubus coreanus Enhances Peri-Implant Bone Healing and Biomineralization in Ovariectomized and Healthy Rats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Design and Ethics
2.2. RC Administration
2.3. Implant Placement
2.4. Fluorochromes Application
2.5. Biomechanical Test—Removal Torque
2.6. Molecular Analysis—RT PCR
2.7. Laboratory Processing Immunohistochemical Analysis
2.8. Laboratory Processing of Laser Confocal Microscopy
2.9. Statistical Analysis
3. Results
3.1. Biomechanical Analysis
RC Increases Removal Torque in Healthy and Ovariectomized Rats
3.2. Molecular Results—RT PCR
3.3. Bone Dynamics
3.4. Immunohistochemical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Miller, P.D. Management of Severe Osteoporosis. Expert. Opin. Pharmacother. 2016, 17, 473–488. [Google Scholar] [CrossRef]
- Giusti, A.; Bianchi, G. Treatment of Primary Osteoporosis in Men. Clin. Interv. Aging 2014, 10, 105. [Google Scholar] [CrossRef]
- Kanis, J.A.; Odén, A.; McCloskey, E.V.; Johansson, H.; Wahl, D.A.; Cooper, C. A Systematic Review of Hip Fracture Incidence and Probability of Fracture Worldwide. Osteoporos. Int. 2012, 23, 2239–2256. [Google Scholar] [CrossRef]
- Manolagas, S.C. Birth and Death of Bone Cells: Basic Regulatory Mechanisms and Implications for the Pathogenesis and Treatment of Osteoporosis. Endocr. Rev. 2000, 21, 115–137. [Google Scholar] [CrossRef] [PubMed]
- Wright, N.C.; Looker, A.C.; Saag, K.G.; Curtis, J.R.; Delzell, E.S.; Randall, S.; Dawson-Hughes, B. The Recent Prevalence of Osteoporosis and Low Bone Mass in the United States Based on Bone Mineral Density at the Femoral Neck or Lumbar Spine. J. Bone Miner. Res. 2014, 29, 2520–2526. [Google Scholar] [CrossRef] [PubMed]
- Giro, G.; Chambrone, L.; Goldstein, A.; Rodrigues, J.A.; Zenóbio, E.; Feres, M.; Figueiredo, L.C.; Cassoni, A.; Shibli, J.A. Impact of Osteoporosis in Dental Implants: A Systematic Review. World J. Orthop. 2015, 6, 311–315. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Liu, N.; Xu, X.; Qu, X.; Lu, E. Smoking, Radiotherapy, Diabetes and Osteoporosis as Risk Factors for Dental Implant Failure: A Meta-Analysis. PLoS ONE 2013, 8, e71955. [Google Scholar] [CrossRef]
- Pisulkar, S.G.; Mistry, R.A.; Nimonkar, S.; Dahihandekar, C.; Pisulkar, G.; Belkhode, V. The Correlation of Mineral Density of Jaws With Skeletal Bone and Its Effect on Implant Stability in Osteoporotic Patients: A Review of Patient-Based Studies. Cureus 2022, 14, e27481. [Google Scholar] [CrossRef] [PubMed]
- Frumkin, N.; Iden, J.A.; Schwartz-Arad, D. Effect of Osteopenia and Osteoporosis on Failure of First and Second Dental Implants: A Retrospective Observational Study. Int. J. Implant. Dent. 2024, 10, 40. [Google Scholar] [CrossRef] [PubMed]
- Taguchi, A.; Urano, T.; Nakamura, Y.; Shiraki, M. Increased Risk of Tooth Loss in Postmenopausal Women With Prevalent Vertebral Fractures: An Observational Study. JBMR Plus 2023, 7, e10822. [Google Scholar] [CrossRef] [PubMed]
- Civitelli, R.; Pilgram, T.K.; Dotson, M.; Muckerman, J.; Lewandowski, N.; Armamento-Villareal, R.; Yokoyama-Crothers, N.; Kardaris, E.E.; Hauser, J.; Cohen, S.; et al. Alveolar and Postcranial Bone Density in Postmenopausal Women Receiving Hormone/Estrogen Replacement Therapy: A Randomized, Double-Blind, Placebo-Controlled Trial. Arch. Intern. Med. 2002, 162, 1409–1415. [Google Scholar] [CrossRef]
- Lemos, C.A.A.; de Oliveira, A.S.; Faé, D.S.; Oliveira, H.F.F.E.; Del Rei Daltro Rosa, C.D.; Bento, V.A.A.; Verri, F.R.; Pellizzer, E.P. Do Dental Implants Placed in Patients with Osteoporosis Have Higher Risks of Failure and Marginal Bone Loss Compared to Those in Healthy Patients? A Systematic Review with Meta-Analysis. Clin. Oral. Investig. 2023, 27, 2483–2493. [Google Scholar] [CrossRef]
- Ahmed, A.; Al-Rasheed, A.; Badwelan, M.; Alghamdi, H.S. Peri-Implant Bone Response around Porous-Surface Dental Implants: A Preclinical Meta-Analysis. Saudi Dent. J. 2020, 33, 239. [Google Scholar] [CrossRef]
- Insua, A.; Monje, A.; Wang, H.-L.; Miron, R.J. Basis of Bone Metabolism around Dental Implants during Osseointegration and Peri-Implant Bone Loss. J. Biomed. Mater Res. A 2017, 105, 2075–2089. [Google Scholar] [CrossRef]
- Busch, A.; Jäger, M.; Mayer, C.; Sowislok, A. Functionalization of Synthetic Bone Substitutes. Int. J. Mol. Sci. 2021, 22, 4412. [Google Scholar] [CrossRef] [PubMed]
- Khosla, S.; Hofbauer, L.C. Osteoporosis Treatment: Recent Developments and Ongoing Challenges. Lancet Diabetes Endocrinol. 2017, 5, 898–907. [Google Scholar] [CrossRef]
- Lufkin, E.G.; Whitaker, M.D.; Nickelsen, T.; Argueta, R.; Caplan, R.H.; Knickerbocker, R.K.; Riggs, B.L. Treatment of Established Postmenopausal Osteoporosis with Raloxifene: A Randomized Trial. J. Bone Miner. Res. 1998, 13, 1747–1754. [Google Scholar] [CrossRef]
- Ruggiero, S.L.; Dodson, T.B.; Aghaloo, T.; Carlson, E.R.; Ward, B.B.; Kademani, D. American Association of Oral and Maxillofacial Surgeons’ Position Paper on Medication-Related Osteonecrosis of the Jaws-2022 Update. J. Oral. Maxillofac. Surg. 2022, 80, 920–943. [Google Scholar] [CrossRef]
- Jung Koo, H.; Sohn, E.-H.; Kim, Y.-J.; Jang, S.-A.; Namkoong, S.; Chan Kang, S. Effect of the Combinatory Mixture of Rubus Coreanus Miquel and Astragalus Membranaceus Bunge Extracts on Ovariectomy-Induced Osteoporosis in Mice and Anti-RANK Signaling Effect. J. Ethnopharmacol. 2014, 151, 951–959. [Google Scholar] [CrossRef] [PubMed]
- Bone-Protecting Effect of Rubus Coreanus by Dual Regulation of Osteoblasts and Osteoclasts—PubMed. Available online: https://pubmed.ncbi.nlm.nih.gov/18709701/ (accessed on 31 October 2024).
- Choi, C.; Lee, H.; Lim, H.; Park, S.; Lee, J.; Do, S. Effect of Rubus Coreanus Extracts on Diabetic Osteoporosis by Simultaneous Regulation of Osteoblasts and Osteoclasts. Menopause 2012, 19, 1043. [Google Scholar] [CrossRef] [PubMed]
- The Blackberry Fruit: A Review on Its Composition and Chemistry, Metabolism and Bioavailability, and Health Benefits—PubMed. Available online: https://pubmed.ncbi.nlm.nih.gov/22082199/ (accessed on 31 October 2024).
- Lee, M.Y.; Kim, H.Y.; Singh, D.; Yeo, S.H.; Baek, S.Y.; Park, Y.K.; Lee, C.H. Metabolite Profiling Reveals the Effect of Dietary Rubus Coreanus Vinegar on Ovariectomy-Induced Osteoporosis in a Rat Model. Molecules 2016, 21, 149. [Google Scholar] [CrossRef]
- Manolagas, S.C.; O’Brien, C.A.; Almeida, M. The Role of Estrogen and Androgen Receptors in Bone Health and Disease. Nat. Rev. Endocrinol. 2013, 9, 699–712. [Google Scholar] [CrossRef] [PubMed]
- Marie, P.J.; Hott, M.; Modrowski, D.; De Pollak, C.; Guillemain, J.; Deloffre, P.; Tsouderos, Y. An Uncoupling Agent Containing Strontium Prevents Bone Loss by Depressing Bone Resorption and Maintaining Bone Formation in Estrogen-Deficient Rats. J. Bone Miner. Res. 1993, 8, 607–615. [Google Scholar] [CrossRef] [PubMed]
- Cerda, D.; Peris, P.; Monegal, A.; Albaladejo, C.; Martinez de Osaba, M.J.; Suris, X.; Guanabens, N. Increase of PTH in post-menopausal osteoporosis. Rev. Clin. Esp. 2011, 211, 338–343. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; He, B.; Zhou, Y.; Zhang, X.; Zhao, L. Investigating the Effect of History of Fractures and Hypertension on the Risk of All-Cause Death from Osteoporosis: A Retrospective Cohort Study. Medicine 2023, 102, e33342. [Google Scholar] [CrossRef] [PubMed]
- Mulinari-Santos, G.; dos Santos, J.S.; Kitagawa, I.L.; de Souza Batista, F.R.; Botacin, P.R.; Antoniali, C.; Lisboa-Filho, P.N.; Okamoto, R. Estrogen Deficiency Impairs Osseointegration in Hypertensive Rats Even Treated with Alendronate Coated on the Implant Surface. J. Funct. Biomater. 2023, 14, 471. [Google Scholar] [CrossRef] [PubMed]
- Merheb, J.; Temmerman, A.; Rasmusson, L.; Kübler, A.; Thor, A.; Quirynen, M. Influence of Skeletal and Local Bone Density on Dental Implant Stability in Patients with Osteoporosis. Clin. Implant. Dent. Relat. Res. 2016, 18, 253–260. [Google Scholar] [CrossRef]
- Yoon, Y.; Kim, J.-E.; Kim, E.; Park, S.; Kang, I.; Kwon, Y.-D. Stability of the Implant–Alveolar Bone Complex According to the Peri-Implant Bone Loss and Bone Quality: A Finite Element Analysis Study. Appl. Sci. 2024, 14, 11674. [Google Scholar] [CrossRef]
- Glosel, B.; Kuchler, U.; Watzek, G.; Gruber, R. Review of Dental Implant Rat Research Models Simulating Osteoporosis or Diabetes. Int. J. Oral Maxillofac. Implant. 2010, 25, 516–524. [Google Scholar]
- Scarano, A.; Khater, A.G.A.; Gehrke, S.A.; Inchingolo, F.; Tari, S.R. Animal Models for Investigating Osseointegration: An Overview of Implant Research over the Last Three Decades. J. Funct. Biomater. 2024, 15, 83. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.-H.; Pei, X.; Tulu, U.S.; Aghvami, M.; Chen, C.-T.; Gaudillière, D.; Arioka, M.; Moghim, M.M.; Bahat, O.; Kolinski, M.; et al. A Comparative Assessment of Implant Site Viability in Humans and Rats. J. Dent. Res. 2017, 97, 451. [Google Scholar] [CrossRef] [PubMed]
- Kalil, E.C.; Cotrim, K.C.; Siqueira, R.; Moraschini, V.; Faverani, L.P.; Souza, J.G.G.; Shibli, J.A. Does an Osteoporosis-like Condition Jeopardize the Osseointegration Process around Dental Implants Placed in Animal Models? A Systematic Review. Int. J. Oral Maxillofac. Implants 2024. online ahead of print. [Google Scholar] [CrossRef]
- Yamazaki, M.; Shirota, T.; Tokugawa, Y.; Motohashi, M.; Ohno, K.; Michi, K.; Yamaguchi, A. Bone Reactions to Titanium Screw Implants in Ovariectomized Animals. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 1999, 87, 411–418. [Google Scholar] [CrossRef]
- Duarte, P.M.; César Neto, J.B.; Gonçalves, P.F.; Sallum, E.A.; Nociti, F.H., Jr. Estrogen Deficiency Affects Bone Healing around Titanium Implants: A Histometric Study in Rats. Implant. Dent. 2003, 12, 340–346. [Google Scholar] [CrossRef] [PubMed]
- Percie du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE Guidelines 2.0: Updated Guidelines for Reporting Animal Research. PLoS Biol. 2020, 18, e3000410. [Google Scholar] [CrossRef]
- Okagu, I.U.; Ezeorba, T.P.C.; Aguchem, R.N.; Ohanenye, I.C.; Aham, E.C.; Okafor, S.N.; Bollati, C.; Lammi, C. A Review on the Molecular Mechanisms of Action of Natural Products in Preventing Bone Diseases. Int. J. Mol. Sci. 2022, 23, 8468. [Google Scholar] [CrossRef] [PubMed]
- Hassumi, J.S.; Mulinari-Santos, G.; Fabris, A.L.d.S.; Jacob, R.G.M.; Gonçalves, A.; Rossi, A.C.; Freire, A.R.; Faverani, L.P.; Okamoto, R. Alveolar Bone Healing in Rats: Micro-CT, Immunohistochemical and Molecular Analysis. J. Appl. Oral Sci. 2018, 26, e20170326. [Google Scholar] [CrossRef] [PubMed]
- Palin, L.P.; Polo, T.O.B.; Batista, F.R.d.S.; Gomes-Ferreira, P.H.S.; Garcia Junior, I.R.; Rossi, A.C.; Freire, A.; Faverani, L.P.; Sumida, D.H.; Okamoto, R. Daily Melatonin Administration Improves Osseointegration in Pinealectomized Rats. J. Appl. Oral Sci. 2018, 26, e20170470. [Google Scholar] [CrossRef]
- Schlesinger, P.H.; Blair, H.C.; Stolz, D.B.; Riazanski, V.; Ray, E.C.; Tourkova, I.L.; Nelson, D.J. Cellular and Extracellular Matrix of Bone, with Principles of Synthesis and Dependency of Mineral Deposition on Cell Membrane Transport. Am. J. Physiol.-Cell Physiol. 2019, 318, C111. [Google Scholar] [CrossRef] [PubMed]
- Shu, J.; Tan, A.; Li, Y.; Huang, H.; Yang, J. The Correlation between Serum Total Alkaline Phosphatase and Bone Mineral Density in Young Adults. BMC Musculoskelet. Disord. 2022, 23, 467. [Google Scholar] [CrossRef]
- Tsao, Y.-T.; Huang, Y.-J.; Wu, H.-H.; Liu, Y.-A.; Liu, Y.-S.; Lee, O.K. Osteocalcin Mediates Biomineralization during Osteogenic Maturation in Human Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2017, 18, 159. [Google Scholar] [CrossRef]
- Liu, T.M.; Lee, E.H. Transcriptional Regulatory Cascades in Runx2-Dependent Bone Development. Tissue Engineering. Part B Rev. 2012, 19, 254. [Google Scholar] [CrossRef]
- Honma, M.; Ikebuchi, Y.; Kariya, Y.; Suzuki, H. Regulatory Mechanisms of RANKL Presentation to Osteoclast Precursors. Curr. Osteoporos. Rep. 2014, 12, 115–120. [Google Scholar] [CrossRef]
- Kim, T.-H.; Jeong, C.G.; Son, H.-U.; Huh, M.-I.; Kim, S.-Y.; Kim, H.K.; Lee, S.-H. Ethanolic Extract of Rubus Coreanus Fruits Inhibits Bone Marrow-Derived Osteoclast Differentiation and Lipopolysaccharide-Induced Bone Loss. Natural Product Communications 2017, 12, 1925–1928. [Google Scholar] [CrossRef]







| Gene | Gene Reference | Code Identification | Forward Primer, 5′→3′ | Reverse Primer, 5′→3′ |
|---|---|---|---|---|
| OPG | NM_057149.2 | Rn00563499_m1 | GCACTCCTGGTGTTCTTGGA | TTTGGTCCCAGGCAAACTGT |
| RANKL | NM_057149.1 | Rn00589289_m1 | CGAGCGCAGATGGATCCTAA | GAGCCACGAACCTTCCATCA |
| OCN | NM_013414.1 | Rn00566386_g1 | CTCTGAGTCTGACAAAGCCTTCAT | GTAGCGCCGGAGTCTATTCA |
| ALP | NM_013059.1 | Rn00564931_m1 | GAGGAACGGATCTCGGGGTA | ATGAGTTGGTAAGGCAGGGTC |
| ß-actin | NM_031144.3 | Rn00667869_m1 | CCACCATGTACCCAGGCATT | CCTAGAAGCATTTGCGGTGC |
| SHAM | SHAM/RC | OVX | OVX/RC | |
|---|---|---|---|---|
| RUNX2 | 1 | 2 | 2 | 2 |
| ALP | 2 | 2 | 1 | 2 |
| OPN | 2 | 2 | 1 | 2 |
| OCN | 1 | 3 | 2 | 1 |
| OPG | 1 | 2 | 1 | 2 |
| RANKL | 1 | 2 | 1 | 2 |
| TRAP | 0 | 0 | 0 | 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Monteiro, N.G.; de Oliveira-Filho, O.N.; Gandolfo, M.I.L.; Ervolino da Silva, A.C.; Pitol-Palin, L.; Botacin, P.R.; Mulinari-Santos, G.; de Souza Batista, F.R.; Okamoto, R. Rubus coreanus Enhances Peri-Implant Bone Healing and Biomineralization in Ovariectomized and Healthy Rats. Biology 2025, 14, 139. https://doi.org/10.3390/biology14020139
Monteiro NG, de Oliveira-Filho ON, Gandolfo MIL, Ervolino da Silva AC, Pitol-Palin L, Botacin PR, Mulinari-Santos G, de Souza Batista FR, Okamoto R. Rubus coreanus Enhances Peri-Implant Bone Healing and Biomineralization in Ovariectomized and Healthy Rats. Biology. 2025; 14(2):139. https://doi.org/10.3390/biology14020139
Chicago/Turabian StyleMonteiro, Naara Gabriela, Odir Nunes de Oliveira-Filho, Maria Isabela Lopes Gandolfo, Ana Cláudia Ervolino da Silva, Letícia Pitol-Palin, Paulo Roberto Botacin, Gabriel Mulinari-Santos, Fábio Roberto de Souza Batista, and Roberta Okamoto. 2025. "Rubus coreanus Enhances Peri-Implant Bone Healing and Biomineralization in Ovariectomized and Healthy Rats" Biology 14, no. 2: 139. https://doi.org/10.3390/biology14020139
APA StyleMonteiro, N. G., de Oliveira-Filho, O. N., Gandolfo, M. I. L., Ervolino da Silva, A. C., Pitol-Palin, L., Botacin, P. R., Mulinari-Santos, G., de Souza Batista, F. R., & Okamoto, R. (2025). Rubus coreanus Enhances Peri-Implant Bone Healing and Biomineralization in Ovariectomized and Healthy Rats. Biology, 14(2), 139. https://doi.org/10.3390/biology14020139

