Common Variants rs429358 and rs7412 in APOE Gene Are Not Associated with POAG in a Saudi Cohort
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Considerations
2.2. Study Participants
2.3. DNA Preparation
2.4. Genotyping of APOE Variants rs429358 (T>C) and rs7412 (C>T)
2.5. Statistical Analysis
3. Results
3.1. Demographic Characteristics
3.2. Allele and Genotype Associations
3.3. Association of APOE Genotypes with POAG
3.4. Regression Analysis
3.5. Association with Clinical Variables
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khandekar, R.; Chauhan, D.; Yasir, Z.H.; Al-Zobidi, M.; Judaibi, R.; Edward, D.P. The prevalence and determinants of glaucoma among 40 years and older saudi residents in the riyadh governorate (except the capital)—A community based survey. Saudi J. Ophthalmol. 2019, 33, 332–337. [Google Scholar] [CrossRef]
- Weinreb, R.N.; Aung, T.; Medeiros, F.A. The pathophysiology and treatment of glaucoma: A review. JAMA 2014, 311, 1901–1911. [Google Scholar] [CrossRef] [PubMed]
- Tham, Y.C.; Li, X.; Wong, T.Y.; Quigley, H.A.; Aung, T.; Cheng, C.Y. Global prevalence of glaucoma and projections of glaucoma burden through 2040: A systematic review and meta-analysis. Ophthalmology 2014, 121, 2081–2090. [Google Scholar] [CrossRef] [PubMed]
- Gharahkhani, P.; Jorgenson, E.; Hysi, P.; Khawaja, A.P.; Pendergrass, S.; Han, X.; Ong, J.S.; Hewitt, A.W.; Segre, A.V.; Rouhana, J.M.; et al. Genome-wide meta-analysis identifies 127 open-angle glaucoma loci with consistent effect across ancestries. Nat. Commun. 2021, 12, 1258. [Google Scholar] [CrossRef]
- Han, X.; Gharahkhani, P.; Hamel, A.R.; Ong, J.S.; Renteria, M.E.; Mehta, P.; Dong, X.; Pasutto, F.; Hammond, C.; Young, T.L.; et al. Large-scale multitrait genome-wide association analyses identify hundreds of glaucoma risk loci. Nat. Genet. 2023, 55, 1116–1125. [Google Scholar] [CrossRef] [PubMed]
- Mahley, R.W.; Rall, S.C., Jr. Apolipoprotein e: Far more than a lipid transport protein. Annu. Rev. Genom. Hum. Genet. 2000, 1, 507–537. [Google Scholar] [CrossRef] [PubMed]
- Guillaume, D.; Bertrand, P.; Dea, D.; Davignon, J.; Poirier, J. Apolipoprotein e and low-density lipoprotein binding and internalization in primary cultures of rat astrocytes: Isoform-specific alterations. J. Neurochem. 1996, 66, 2410–2418. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Calle, R.; Konings, S.C.; Frontinan-Rubio, J.; Garcia-Revilla, J.; Camprubi-Ferrer, L.; Svensson, M.; Martinson, I.; Boza-Serrano, A.; Venero, J.L.; Nielsen, H.M.; et al. Apoe in the bullseye of neurodegenerative diseases: Impact of the apoe genotype in alzheimer’s disease pathology and brain diseases. Mol. Neurodegener. 2022, 17, 62. [Google Scholar] [CrossRef] [PubMed]
- Serrano-Pozo, A.; Das, S.; Hyman, B.T. Apoe and alzheimer’s disease: Advances in genetics, pathophysiology, and therapeutic approaches. Lancet Neurol. 2021, 20, 68–80. [Google Scholar] [CrossRef]
- Chan, J.W.; Chan, N.C.Y.; Sadun, A.A. Glaucoma as neurodegeneration in the brain. Eye Brain 2021, 13, 21–28. [Google Scholar] [CrossRef]
- Kuang, G.; Halimitabrizi, M.; Edziah, A.A.; Salowe, R.; O’Brien, J.M. The potential for mitochondrial therapeutics in the treatment of primary open-angle glaucoma: A review. Front. Physiol. 2023, 14, 1184060. [Google Scholar] [CrossRef]
- Kuang, G.; Salowe, R.; O’Brien, J. Genetic factors implicated in the investigation of possible connections between alzheimer’s disease and primary open angle glaucoma. Genes 2023, 14, 338. [Google Scholar] [CrossRef] [PubMed]
- Civeira-Marin, M.; Cenarro, A.; Marco-Benedi, V.; Bea, A.M.; Mateo-Gallego, R.; Moreno-Franco, B.; Ordovas, J.M.; Laclaustra, M.; Civeira, F.; Lamiquiz-Moneo, I. Apoe genotypes modulate inflammation independently of their effect on lipid metabolism. Int. J. Mol. Sci. 2022, 23, 12947. [Google Scholar] [CrossRef] [PubMed]
- Amaratunga, A.; Abraham, C.R.; Edwards, R.B.; Sandell, J.H.; Schreiber, B.M.; Fine, R.E. Apolipoprotein e is synthesized in the retina by muller glial cells, secreted into the vitreous, and rapidly transported into the optic nerve by retinal ganglion cells. J. Biol. Chem. 1996, 271, 5628–5632. [Google Scholar] [CrossRef] [PubMed]
- Fan, B.J.; Wang, D.Y.; Fan, D.S.; Tam, P.O.; Lam, D.S.; Tham, C.C.; Lam, C.Y.; Lau, T.C.; Pang, C.P. Snps and interaction analyses of myocilin, optineurin, and apolipoprotein e in primary open angle glaucoma patients. Mol. Vis. 2005, 11, 625–631. [Google Scholar] [PubMed]
- Liao, R.; Ye, M.; Xu, X. An updated meta-analysis: Apolipoprotein e genotypes and risk of primary open-angle glaucoma. Mol. Vis. 2014, 20, 1025–1036. [Google Scholar]
- Wang, Y.; Zhou, Y.F.; Zhao, B.Y.; Gu, Z.Y.; Li, S.L. Apolipoprotein e gene epsilon4epsilon4 is associated with elevated risk of primary open angle glaucoma in asians: A meta-analysis. BMC Med. Genet. 2014, 15, 60. [Google Scholar] [CrossRef]
- Ressiniotis, T.; Griffiths, P.G.; Birch, M.; Keers, S.; Chinnery, P.F. The role of apolipoproteine gene polymorphisms in primary open-angle glaucoma. Arch. Ophthalmol. 2004, 122, 258–261. [Google Scholar] [CrossRef]
- Zetterberg, M.; Tasa, G.; Palmer, M.S.; Juronen, E.; Teesalu, P.; Blennow, K.; Zetterberg, H. Apolipoprotein e polymorphisms in patients with primary open-angle glaucoma. Am. J. Ophthalmol. 2007, 143, 1059–1060. [Google Scholar] [CrossRef]
- Margeta, M.A.; Letcher, S.M.; Igo, R.P., Jr.; Cooke Bailey, J.N.; Pasquale, L.R.; Haines, J.L.; Butovsky, O.; Wiggs, J.L. Association of apoe with primary open-angle glaucoma suggests a protective effect for apoe epsilon4. Investig. Ophthalmol. Vis. Sci. 2020, 61, 3. [Google Scholar] [CrossRef]
- Freeman, E.E.; Bastasic, J.; Grant, A.; Leung, G.; Li, G.; Buhrmann, R.; Roy-Gagnon, M.H. Inverse association of apoe epsilon4 and glaucoma modified by systemic hypertension: The canadian longitudinal study on aging. Investig. Ophthalmol. Vis. Sci. 2022, 63, 9. [Google Scholar] [CrossRef] [PubMed]
- Mullany, S.; Marshall, H.; Diaz-Torres, S.; Berry, E.C.; Schmidt, J.M.; Thomson, D.; Qassim, A.; To, M.S.; Dimasi, D.; Kuot, A.; et al. The apoe e4 allele is associated with faster rates of neuroretinal thinning in a prospective cohort study of suspect and early glaucoma. Ophthalmol. Sci. 2022, 2, 100159. [Google Scholar] [CrossRef] [PubMed]
- Saglar, E.; Yucel, D.; Bozkurt, B.; Ozgul, R.K.; Irkec, M.; Ogus, A. Association of polymorphisms in apoe, p53, and p21 with primary open-angle glaucoma in turkish patients. Mol. Vis. 2009, 15, 1270–1276. [Google Scholar] [PubMed]
- Wang, W.; Zhou, M.; Huang, W.; Chen, S.; Zhang, X. Lack of association of apolipoprotein e (apo e) epsilon2/epsilon3/epsilon4 polymorphisms with primary open-angle glaucoma: A meta-analysis from 1916 cases and 1756 controls. PLoS ONE 2013, 8, e72644. [Google Scholar]
- Al-Dabbagh, N.M.; Al-Dohayan, N.; Arfin, M.; Tariq, M. Apolipoprotein e polymorphisms and primary glaucoma in saudis. Mol. Vis. 2009, 15, 912–919. [Google Scholar]
- Kondkar, A.A.; Azad, T.A.; Almobarak, F.A.; Bahabri, I.M.; Kalantan, H.; Abu-Amero, K.K.; Al-Obeidan, S.A. Lack of association between variant rs7916697 in atoh7 and primary open angle glaucoma in a saudi cohort. Genet. Res. Int. 2018, 2018, 2148056. [Google Scholar] [CrossRef]
- Abondio, P.; Sazzini, M.; Garagnani, P.; Boattini, A.; Monti, D.; Franceschi, C.; Luiselli, D.; Giuliani, C. The genetic variability of apoe in different human populations and its implications for longevity. Genes 2019, 10, 222. [Google Scholar] [CrossRef]
- Anderson, D.H.; Ozaki, S.; Nealon, M.; Neitz, J.; Mullins, R.F.; Hageman, G.S.; Johnson, L.V. Local cellular sources of apolipoprotein e in the human retina and retinal pigmented epithelium: Implications for the process of drusen formation. Am. J. Ophthalmol. 2001, 131, 767–781. [Google Scholar] [CrossRef]
- Klaver, C.C.; Kliffen, M.; van Duijn, C.M.; Hofman, A.; Cruts, M.; Grobbee, D.E.; van Broeckhoven, C.; de Jong, P.T. Genetic association of apolipoprotein e with age-related macular degeneration. Am. J. Hum. Genet. 1998, 63, 200–206. [Google Scholar] [CrossRef]
- Vickers, J.C.; Craig, J.E.; Stankovich, J.; McCormack, G.H.; West, A.K.; Dickinson, J.L.; McCartney, P.J.; Coote, M.A.; Healey, D.L.; Mackey, D.A. The apolipoprotein epsilon4 gene is associated with elevated risk of normal tension glaucoma. Mol. Vis. 2002, 8, 389–393. [Google Scholar]
- Junemann, A.; Bleich, S.; Reulbach, U.; Henkel, K.; Wakili, N.; Beck, G.; Rautenstrauss, B.; Mardin, C.; Naumann, G.O.; Reis, A.; et al. Prospective case control study on genetic assocation of apolipoprotein epsilon2 with intraocular pressure. Br. J. Ophthalmol. 2004, 88, 581–582. [Google Scholar] [CrossRef]
- Mabuchi, F.; Tang, S.; Ando, D.; Yamakita, M.; Wang, J.; Kashiwagi, K.; Yamagata, Z.; Iijima, H.; Tsukahara, S. The apolipoprotein e gene polymorphism is associated with open angle glaucoma in the japanese population. Mol. Vis. 2005, 11, 609–612. [Google Scholar]
- Occhiutto, M.L.; de Melo, M.B.; Cabral de Vasconcellos, J.P.; Rodrigues, T.A.R.; Bajano, F.F.; Costa, F.F.; Costa, V.P. Association of apoe gene polymorphisms with primary open angle glaucoma in brazilian patients. Ophthalmic Genet. 2021, 42, 53–61. [Google Scholar] [CrossRef]
- Mullany, S.; Diaz-Torres, S.; Schmidt, J.M.; Thomson, D.; Qassim, A.; Marshall, H.N.; Knight, L.S.W.; Berry, E.C.; Kolovos, A.; Dimasi, D.; et al. No strong association between the apolipoprotein e e4 allele and glaucoma: A multicohort study. Ophthalmol. Sci. 2023, 3, 100287. [Google Scholar] [CrossRef] [PubMed]
- Jia, L.Y.; Tam, P.O.; Chiang, S.W.; Ding, N.; Chen, L.J.; Yam, G.H.; Pang, C.P.; Wang, N.L. Multiple gene polymorphisms analysis revealed a different profile of genetic polymorphisms of primary open-angle glaucoma in northern chinese. Mol. Vis. 2009, 15, 89–98. [Google Scholar] [PubMed]
- Tamura, H.; Kawakami, H.; Kanamoto, T.; Kato, T.; Yokoyama, T.; Sasaki, K.; Izumi, Y.; Matsumoto, M.; Mishima, H.K. High frequency of open-angle glaucoma in japanese patients with alzheimer’s disease. J. Neurol. Sci. 2006, 246, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Song, Q.; Chen, P.; Liu, Q. Role of the apoe epsilon2/epsilon3/epsilon4 polymorphism in the development of primary open-angle glaucoma: Evidence from a comprehensive meta-analysis. PLoS ONE 2013, 8, e82347. [Google Scholar] [CrossRef] [PubMed]
- Parhizkar, S.; Holtzman, D.M. Apoe mediated neuroinflammation and neurodegeneration in alzheimer’s disease. Semin. Immunol. 2022, 59, 101594. [Google Scholar] [CrossRef] [PubMed]
- Corbo, R.M.; Scacchi, R. Apolipoprotein e (apoe) allele distribution in the world. Is apoe*4 a ‘thrifty’ allele? Ann. Hum. Genet. 1999, 63, 301–310. [Google Scholar] [CrossRef]



| PCR Primers | Primer Sequences (5′–3′) | Amplification Condition |
|---|---|---|
| Forward | TGTAAAACGACGGCCAGTGACCATGAGGAGTTGAAGGCCTAC |
|
| Reverse | CAGGAAACAGCTATGACCGATGGCGCTGAGGCCGCGCT | 95 °C—1 min 59 °C—30 s 72 °C—1 min |
|
| SNP ID | Gene/ Locus | Chromosome | Position * | Minor Allele | MAF | OR (95% CI) | p | |
|---|---|---|---|---|---|---|---|---|
| Controls | POAG | |||||||
| rs429358 | APOE | 19q13.32 | 44908683 | C | 0.10 | 0.09 | 1.05 (0.57–1.91) | 0.887 |
| rs7412 | APOE | 19q13.32 | 44908821 | T | 0.03 | 0.04 | 1.14 (0.40–3.25) | 0.806 |
| SNP/Model | Genotype | Control | POAG | OR (95% CI) | p § | AIC | BIC |
|---|---|---|---|---|---|---|---|
| rs429358 | |||||||
| Codominant | T/T | 204 (81.3) | 147 (82.1) | 1.00 | 0.580 | 588.9 | 601.1 |
| T/C | 46 (18.3) | 32 (17.9) | 0.97 (0.59–1.59) | ||||
| C/C | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) | ||||
| Dominant | T/T | 204 (81.3) | 147 (82.1) | 1.00 | 0.820 | 587.9 | 596.1 |
| T/C-C/C | 47 (18.7) | 32 (17.9) | 0.94 (0.57–1.55) | ||||
| Recessive | T/T-T/C | 250 (99.6) | 179 (100) | 1.00 | 0.300 | 586.9 | 595 |
| C/C | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) | ||||
| T/C | 46 (18.3) | 32 (17.9) | 0.97 (0.59–1.60) | ||||
| rs7412 | |||||||
| Codominant | C/C | 238 (94.8) | 166 (92.7) | 1.00 | 0.330 | 587.8 | 600 |
| C/T | 12 (4.8) | 13 (7.3) | 1.55 (0.69–3.49) | ||||
| T/T | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) | ||||
| Dominant | C/C | 238 (94.8) | 166 (92.7) | 1.00 | 0.370 | 587.2 | 595.3 |
| C/T-T/T | 13 (5.2) | 13 (7.3) | 1.43 (0.65–3.17) | ||||
| Recessive | C/C-C/T | 250 (99.6) | 179 (100) | 1.00 | 0.300 | 586.9 | 595.0 |
| T/T | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) |
| APOE Variants | rs429358 | rs7412 |
|---|---|---|
| Alleles | ||
| ε2 | T | T |
| ε3 | T | C |
| ε4 | C | C |
| Genotypes | ||
| ε3/ε3 | TT | CC |
| ε2/ε2 | TT | TT |
| ε4/ε4 | CC | CC |
| ε2/ε3 | TT | TC |
| ε3/ε4 | TC | CC |
| ε2/ε4 | TC | TC |
| APOE | Controls n (%) | POAG n (%) | Odds Ratio (95% Confidence Interval) | p |
|---|---|---|---|---|
| Alleles | ||||
| ε3 | 440 (87.6) | 313 (87.4) | 1.00 | - |
| ε2 | 14 (2.8) | 13 (3.6) | 1.30 (0.60–2.81) | 0.497 |
| ε4 | 48 (9.6) | 32 (8.9) | 0.89 (0.28–2.79) | 0.841 |
| Genotypes | ||||
| ε3/ε3 | 199 (79.3) | 139 (77.6) | 1.00 | - |
| ε2/ε2 | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) | 0.999 |
| ε2/ε3 | 4 (1.6) | 8 (4.5) | 2.80 (0.84–9.69) | 0.078 |
| ε2/ε4 | 8 (3.2) | 5 (2.8) | 0.89 (0.28–2.79) | 0.841 |
| ε3/ε4 | 38 (15.1) | 27 (15.1) | 1.01 (0.59–1.74) | 0.999 |
| ε4/ε4 | 1 (0.4) | 0 (0) | 0.00 (0.00–NA) | 0.999 |
| Carrier a | ||||
| ε3/ε3 | 199 (81.9) | 139 (79.9) | 1.00 | - |
| ε*2 b | 5 (2.0) | 8 (4.6) | 2.29 (0.73–7.150) | 0.143 |
| ε*4 c | 39 (16.0) | 27 (15.5) | 0.99 (0.58–1.70) | 0.999 |
| Group Variables | B | SE | Wald | Odds Ratio | 95% Confidence Interval | p |
|---|---|---|---|---|---|---|
| Age | 0.019 | 0.12 | 2.73 | 1.02 | 0.99–1.044 | 0.098 |
| Sex | 0.098 | 0.198 | 0.243 | 1.10 | 0.74–1.62 | 0.622 |
| rs429358 | 0.126 | - | - | 0.939 | ||
| T/C | −0.094 | 0.263 | 0.126 | 0.911 | 0.543–1.526 | 0.723 |
| C/C | −21.236 | 40192.970 | 0.000 | 0.000 | - | 1.000 |
| T/C + C/C | −0.096 | 0.261 | 0.134 | 0.910 | 0.54–1.51 | 0.714 |
| rs7412 | 1.006 | - | - | 0.605 | ||
| C/T | 0.429 | 0.428 | 1.006 | 1.536 | 0.664–3.55 | 0.316 |
| C/C | −21.070 | 40192.970 | 0.000 | 0.000 | - | 1.000 |
| C/T + C/C | 0.355 | 0.418 | 0.720 | 1.42 | 0.62–3.23 | 0.396 |
| Ethnicity | Cases n | Controls n | Cases Frequency % | Controls Frequency % | Reference | ||||
|---|---|---|---|---|---|---|---|---|---|
| ε2 | ε3 | ε4 | ε2 | ε3 | ε4 | ||||
| German | 96 | 32 | 12 | 71 | 17 | 14 | 62 | 24 | [31] |
| Japanese | 310 | 179 | 2.6 | 91.4 | 6.0 | 5.0 | 84.0 | 10.6 | [32] |
| Saudi Arabs | 60 | 130 | 0 | 90.5 | 9.5 | 0 | 95.7 | 4.2 | [25] |
| Canadian | 1093 | 23,562 | 4.1 | 78.1 | 17.8 | 2.6 | 77.9 | 19.5 | [21] |
| Brazilian | 402 | 401 | 8.6 | 79.9 | 11.4 | 6.11 | 81.8 | 12.1 | [33] |
| Australian | 1161 | 2571 | 7.7 | 77.4 | 14.9 | 8.4 | 77.1 | 14.5 | [22] |
| European | 137 | 75 | 12.8 | 72.6 | 14.6 | 10.7 | 76.0 | 13.3 | [18] |
| Chinese | 400 | 281 | 10.7 | 82.7 | 6.6 | 8.5 | 82.2 | 9.4 | [15] |
| Japanese | 28 | 77 | 5.4 | 75.0 | 19.6 | 7.8 | 87.7 | 4.5 | [36] |
| Swedish | 484 | 374 | 10.3 | 77.7 | 12.0 | 11.2 | 77.3 | 11.5 | [19] |
| Chinese | 176 | 200 | 10.3 | 9.7 | 79.5 | 9.0 | 8.7 | 82.2 | [35] |
| Turkish | 75 | 119 | 8.7 | 84.0 | 7.3 | 4.2 | 85.7 | 10.1 | [23] |
| European | 13,988 | 56,894 | 8.0 | 77.0 | 15.0 | 8.0 | 76.8 | 15.1 | [34] |
| Saudi Arabs | 179 | 251 | 3.6 | 87.4 | 8.9 | 2.8 | 87.6 | 9.6 | This study |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kondkar, A.A.; Sultan, T.; Azad, T.A.; Khatlani, T.; Alshehri, A.A.; Osman, E.A.; Lobo, G.P.; Almobarak, F.A.; Al-Obeidan, S.A. Common Variants rs429358 and rs7412 in APOE Gene Are Not Associated with POAG in a Saudi Cohort. Biology 2024, 13, 62. https://doi.org/10.3390/biology13010062
Kondkar AA, Sultan T, Azad TA, Khatlani T, Alshehri AA, Osman EA, Lobo GP, Almobarak FA, Al-Obeidan SA. Common Variants rs429358 and rs7412 in APOE Gene Are Not Associated with POAG in a Saudi Cohort. Biology. 2024; 13(1):62. https://doi.org/10.3390/biology13010062
Chicago/Turabian StyleKondkar, Altaf A., Tahira Sultan, Taif A. Azad, Tanvir Khatlani, Abdulaziz A. Alshehri, Essam A. Osman, Glenn P. Lobo, Faisal A. Almobarak, and Saleh A. Al-Obeidan. 2024. "Common Variants rs429358 and rs7412 in APOE Gene Are Not Associated with POAG in a Saudi Cohort" Biology 13, no. 1: 62. https://doi.org/10.3390/biology13010062
APA StyleKondkar, A. A., Sultan, T., Azad, T. A., Khatlani, T., Alshehri, A. A., Osman, E. A., Lobo, G. P., Almobarak, F. A., & Al-Obeidan, S. A. (2024). Common Variants rs429358 and rs7412 in APOE Gene Are Not Associated with POAG in a Saudi Cohort. Biology, 13(1), 62. https://doi.org/10.3390/biology13010062

