Citral-Enriched Fraction of Lemon Essential Oil Mitigates LPS-Induced Hepatocyte Injuries
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5 Diphenyl Tetrazolium Bromide) Assay
2.3. RNA Isolation and Quantitative Real-Time PCR
2.4. ELISA (Enzyme Immunosorbent Assay)
2.5. Western Blot
2.6. Confocal Microscopy
2.7. Dichlorodihydrofluorescein Diacetate (DCFH-DA) Assay
2.8. Statistical Analysis
3. Results
3.1. In Vitro Anti-Inflammatory Effects of Cfr-LEO
3.2. Antioxidant Effects of Cfr-LEO
3.3. Cfr-LEO Protects Hepatocytes from the LPS-Induced EMT
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Friedman, S.L. Mechanisms of hepatic fibrogenesis. Gastroenterology 2008, 134, 1655–1669. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The Role of Oxidative Stress and Antioxidants in Liver Diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [PubMed]
- Tan, Z.; Sun, H.; Xue, T.; Gan, C.; Liu, H.; Xie, Y.; Yao, Y.; Ye, T. Liver Fibrosis: Therapeutic Targets and Advances in Drug Therapy. Front. Cell Dev. Biol. 2021, 9, 730176. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.L.; Zhang, X.Y.; Ge, X.Q.; Liu, M.X. Mangiferin prevents hepatocyte epithelial-mesenchymal transition in liver fibrosis via targeting HSP27-mediated JAK2/STAT3 and TGF-beta1/Smad pathway. Phytother. Res. PTR 2022, 36, 4167–4182. [Google Scholar] [CrossRef] [PubMed]
- Gandhi, C.R. Pro- and Anti-fibrogenic Functions of Gram-Negative Bacterial Lipopolysaccharide in the Liver. Front. Med. 2020, 7, 130. [Google Scholar] [CrossRef]
- Markotic, A.; Flegar, D.; Grcevic, D.; Sucur, A.; Lalic, H.; Turcic, P.; Kovacic, N.; Lukac, N.; Pravdic, D.; Vukojevic, K.; et al. LPS-induced inflammation desensitizes hepatocytes to Fas-induced apoptosis through Stat3 activation-The effect can be reversed by ruxolitinib. J. Cell. Mol. Med. 2020, 24, 2981–2992. [Google Scholar] [CrossRef]
- Migita, K.; Abiru, S.; Nakamura, M.; Komori, A.; Yoshida, Y.; Yokoyama, T.; Daikoku, M.; Ueki, T.; Takii, Y.; Yano, K.; et al. Lipopolysaccharide signaling induces serum amyloid A (SAA) synthesis in human hepatocytes in vitro. FEBS Lett. 2004, 569, 235–239. [Google Scholar] [CrossRef]
- Wang, F.; Zhou, R.-J.; Zhao, X.; Ye, H.; Xie, M.-L. Apigenin inhibits ethanol-induced oxidative stress and LPS-induced inflammatory cytokine production in cultured rat hepatocytes. J. Appl. Biomed. 2018, 16, 75–80. [Google Scholar] [CrossRef]
- Yu, Z.; Yang, L.; Deng, S.; Liang, M. Daidzein ameliorates LPS-induced hepatocyte injury by inhibiting inflammation and oxidative stress. Eur. J. Pharmacol. 2020, 885, 173399. [Google Scholar] [CrossRef]
- Chen, M.C.; Chang, W.W.; Kuan, Y.D.; Lin, S.T.; Hsu, H.C.; Lee, C.H. Resveratrol inhibits LPS-induced epithelial-mesenchymal transition in mouse melanoma model. Innate Immun. 2012, 18, 685–693. [Google Scholar] [CrossRef]
- Ho, C.H.; Huang, J.H.; Sun, M.S.; Tzeng, I.S.; Hsu, Y.C.; Kuo, C.Y. Wild Bitter Melon Extract Regulates LPS-Induced Hepatic Stellate Cell Activation, Inflammation, Endoplasmic Reticulum Stress, and Ferroptosis. Evid. Based Complement. Altern. Med. Ecam 2021, 2021, 6671129. [Google Scholar] [CrossRef] [PubMed]
- Bunse, M.; Daniels, R.; Grundemann, C.; Heilmann, J.; Kammerer, D.R.; Keusgen, M.; Lindequist, U.; Melzig, M.F.; Morlock, G.E.; Schulz, H.; et al. Essential Oils as Multicomponent Mixtures and Their Potential for Human Health and Well-Being. Front. Pharmacol. 2022, 13, 956541. [Google Scholar] [CrossRef] [PubMed]
- Daoudi, N.E.; Bnouham, M. Hepatoprotective Essential Oils: A Review. J. Pharmacopunct. 2020, 23, 124–141. [Google Scholar] [CrossRef] [PubMed]
- Ogaly, H.A.; Eltablawy, N.A.; Abd-Elsalam, R.M. Antifibrogenic Influence of Mentha piperita L. Essential Oil against CCl(4)-Induced Liver Fibrosis in Rats. Oxidative Med. Cell. Longev. 2018, 2018, 4039753. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Zhang, Z.; Nie, D.; Li, Y. Protective Effect of Lemon Essential Oil and Its Major Active Component, D-Limonene, on Intestinal Injury and Inflammation of E. coli-Challenged Mice. Front. Nutr. 2022, 9, 843096. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Woo, M.; Kim, M.; Noh, J.S.; Song, Y.O. Antioxidative and Cholesterol-Lowering Effects of Lemon Essential Oil in Hypercholesterolemia-Induced Rabbits. Prev. Nutr. Food Sci. 2018, 23, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Balusamy, S.R.; Perumalsamy, H.; Veerappan, K.; Huq, M.A.; Rajeshkumar, S.; Lakshmi, T.; Kim, Y.J. Citral Induced Apoptosis through Modulation of Key Genes Involved in Fatty Acid Biosynthesis in Human Prostate Cancer Cells: In Silico and In Vitro Study. BioMed Res. Int. 2020, 2020, 6040727. [Google Scholar] [CrossRef]
- Bhalla, Y.; Gupta, V.K.; Jaitak, V. Anticancer activity of essential oils: A review. J. Sci. Food Agric. 2013, 93, 3643–3653. [Google Scholar] [CrossRef]
- Bouzenna, H.; Hfaiedh, N.; Giroux-Metges, M.A.; Elfeki, A.; Talarmin, H. Biological properties of citral and its potential protective effects against cytotoxicity caused by aspirin in the IEC-6 cells. Biomed. Pharmacother. 2017, 87, 653–660. [Google Scholar] [CrossRef]
- Katsukawa, M.; Nakata, R.; Takizawa, Y.; Hori, K.; Takahashi, S.; Inoue, H. Citral, a component of lemongrass oil, activates PPARalpha and gamma and suppresses COX-2 expression. Biochim. Biophys. Acta 2010, 1801, 1214–1220. [Google Scholar] [CrossRef]
- Puatanachokchai, R.; Kishida, H.; Denda, A.; Murata, N.; Konishi, Y.; Vinitketkumnuen, U.; Nakae, D. Inhibitory effects of lemon grass (Cymbopogon citratus, Stapf) extract on the early phase of hepatocarcinogenesis after initiation with diethylnitrosamine in male Fischer 344 rats. Cancer Lett. 2002, 183, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Pucci, M.; Raimondo, S.; Zichittella, C.; Tinnirello, V.; Corleone, V.; Aiello, G.; Moschetti, M.; Conigliaro, A.; Fontana, S.; Alessandro, R. Biological Properties of a Citral-Enriched Fraction of Citrus limon Essential Oil. Foods 2020, 9, 1290. [Google Scholar] [CrossRef] [PubMed]
- Pyrillou, K.; Burzynski, L.C.; Clarke, M.C.H. Alternative Pathways of IL-1 Activation, and Its Role in Health and Disease. Front. Immunol. 2020, 11, 613170. [Google Scholar] [CrossRef] [PubMed]
- Kawai, T.; Akira, S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol. Med. 2007, 13, 460–469. [Google Scholar] [CrossRef]
- Park, C.; Cha, H.J.; Lee, H.; Kim, G.Y.; Choi, Y.H. The regulation of the TLR4/NF-kappaB and Nrf2/HO-1 signaling pathways is involved in the inhibition of lipopolysaccharide-induced inflammation and oxidative reactions by morroniside in RAW 264.7 macrophages. Arch. Biochem. Biophys. 2021, 706, 108926. [Google Scholar] [CrossRef]
- Seki, E.; Schwabe, R.F. Hepatic inflammation and fibrosis: Functional links and key pathways. Hepatology 2015, 61, 1066–1079. [Google Scholar] [CrossRef]
- Tu, T.; Calabro, S.R.; Lee, A.; Maczurek, A.E.; Budzinska, M.A.; Warner, F.J.; McLennan, S.V.; Shackel, N.A. Hepatocytes in liver injury: Victim, bystander, or accomplice in progressive fibrosis? J. Gastroenterol. Hepatol. 2015, 30, 1696–1704. [Google Scholar] [CrossRef]
- Yu, K.; Li, Q.; Shi, G.; Li, N. Involvement of epithelial-mesenchymal transition in liver fibrosis. Saudi J. Gastroenterol. Off. J. Saudi Gastroenterol. Assoc. 2018, 24, 5–11. [Google Scholar] [CrossRef]
- Qin, Y.; Zhao, P.; Chen, Y.; Liu, X.; Dong, H.; Zheng, W.; Li, C.; Mao, X.; Li, J. Lipopolysaccharide induces epithelial-mesenchymal transition of alveolar epithelial cells cocultured with macrophages possibly via the JAK2/STAT3 signaling pathway. Hum. Exp. Toxicol. 2020, 39, 224–234. [Google Scholar] [CrossRef]
- Zhao, L.; Yang, R.; Cheng, L.; Wang, M.; Jiang, Y.; Wang, S. LPS-induced epithelial-mesenchymal transition of intrahepatic biliary epithelial cells. J. Surg. Res. 2011, 171, 819–825. [Google Scholar] [CrossRef]
- Al-Mijalli, S.H.; Mrabti, N.N.; Ouassou, H.; Sheikh, R.A.; Assaggaf, H.; Bakrim, S.; Abdallah, E.M.; Alshahrani, M.M.; Al Awadh, A.A.; Lee, L.H.; et al. Chemical Composition and Antioxidant, Antimicrobial, and Anti-Inflammatory Properties of Origanum compactum Benth Essential Oils from Two Regions: In Vitro and In Vivo Evidence and In Silico Molecular Investigations. Molecules 2022, 27, 7329. [Google Scholar] [CrossRef] [PubMed]
- Bouyahya, A.; Lagrouh, F.; El Omari, N.; Bourais, I.; El Jemli, M.; Marmouzi, I.; Salhi, N.; Faouzi, M.E.A.; Belmehdi, O.; Dakka, N.; et al. Essential oils of Mentha viridis rich phenolic compounds show important antioxidant, antidiabetic, dermatoprotective, antidermatophyte and antibacterial properties. Biocatal. Agric. Biotechnol. 2020, 23, 101471. [Google Scholar] [CrossRef]
- Molteni, M.; Bosi, A.; Rossetti, C. Natural Products with Toll-like Receptor 4 Antagonist Activity. Int. J. Inflamm. 2018, 2018, 2859135. [Google Scholar] [CrossRef] [PubMed]
- Mansouri, A.; Gattolliat, C.H.; Asselah, T. Mitochondrial Dysfunction and Signaling in Chronic Liver Diseases. Gastroenterology 2018, 155, 629–647. [Google Scholar] [CrossRef] [PubMed]
- Jing, Y.Y.; Han, Z.P.; Sun, K.; Zhang, S.S.; Hou, J.; Liu, Y.; Li, R.; Gao, L.; Zhao, X.; Zhao, Q.D.; et al. Toll-like receptor 4 signaling promotes epithelial-mesenchymal transition in human hepatocellular carcinoma induced by lipopolysaccharide. BMC Med. 2012, 10, 98. [Google Scholar] [CrossRef] [PubMed]
- Moon, A.M.; Singal, A.G.; Tapper, E.B. Contemporary Epidemiology of Chronic Liver Disease and Cirrhosis. Clin. Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 2020, 18, 2650–2666. [Google Scholar] [CrossRef] [PubMed]
- Roehlen, N.; Crouchet, E.; Baumert, T.F. Liver Fibrosis: Mechanistic Concepts and Therapeutic Perspectives. Cells 2020, 9, 875. [Google Scholar] [CrossRef]
- Keenan, B.P.; Fong, L.; Kelley, R.K. Immunotherapy in hepatocellular carcinoma: The complex interface between inflammation, fibrosis, and the immune response. J. Immunother. Cancer 2019, 7, 267. [Google Scholar] [CrossRef]
- Sanchez-Valle, V.; Chavez-Tapia, N.C.; Uribe, M.; Mendez-Sanchez, N. Role of oxidative stress and molecular changes in liver fibrosis: A review. Curr. Med. Chem. 2012, 19, 4850–4860. [Google Scholar] [CrossRef]
- Qin, L.; Gabazza, E.C. Links between Fibrogenesis and Cancer: Mechanistic and Therapeutic Challenges. Int. J. Mol. Sci. 2019, 20, 4313. [Google Scholar] [CrossRef]
- Chang, Y.; Li, H. Hepatic Antifibrotic Pharmacotherapy: Are We Approaching Success? J. Clin. Transl. Hepatol. 2020, 8, 222–229. [Google Scholar] [CrossRef] [PubMed]
- Ogaly, H.A.; Eltablawy, N.A.; El-Behairy, A.M.; El-Hindi, H.; Abd-Elsalam, R.M. Hepatocyte Growth Factor Mediates the Antifibrogenic Action of Ocimum bacilicum Essential Oil against CCl4-Induced Liver Fibrosis in Rats. Molecules 2015, 20, 13518–13535. [Google Scholar] [CrossRef] [PubMed]
- Sheweita, S.A.; El-Hosseiny, L.S.; Nashashibi, M.A. Protective Effects of Essential Oils as Natural Antioxidants against Hepatotoxicity Induced by Cyclophosphamide in Mice. PLoS ONE 2016, 11, e0165667. [Google Scholar] [CrossRef] [PubMed]
Primers. | Forward | Reverse |
---|---|---|
GAPDH | ATGGGGAAGGTGAAGGTCG | GGGTCATTGATGGCAACAATAT |
IL-6 | GGTACATCCTCGACGGCATCT | GTGCCTCTTTGCTGCTTTCAC |
IL-1β | ACAGATGAAGTGCTCCTTCCA | GTCGGAGATTCGTAGCTGGAT |
TNFα | CCAGGCAGTCAGATCATCTTCTCTC | AGCTGGTTATCTCTCAGCTCCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gasparro, R.; Pucci, M.; Costanzo, E.; Urzì, O.; Tinnirello, V.; Moschetti, M.; Conigliaro, A.; Raimondo, S.; Corleone, V.; Fontana, S.; et al. Citral-Enriched Fraction of Lemon Essential Oil Mitigates LPS-Induced Hepatocyte Injuries. Biology 2023, 12, 1535. https://doi.org/10.3390/biology12121535
Gasparro R, Pucci M, Costanzo E, Urzì O, Tinnirello V, Moschetti M, Conigliaro A, Raimondo S, Corleone V, Fontana S, et al. Citral-Enriched Fraction of Lemon Essential Oil Mitigates LPS-Induced Hepatocyte Injuries. Biology. 2023; 12(12):1535. https://doi.org/10.3390/biology12121535
Chicago/Turabian StyleGasparro, Roberta, Marzia Pucci, Elisa Costanzo, Ornella Urzì, Vincenza Tinnirello, Marta Moschetti, Alice Conigliaro, Stefania Raimondo, Valeria Corleone, Simona Fontana, and et al. 2023. "Citral-Enriched Fraction of Lemon Essential Oil Mitigates LPS-Induced Hepatocyte Injuries" Biology 12, no. 12: 1535. https://doi.org/10.3390/biology12121535
APA StyleGasparro, R., Pucci, M., Costanzo, E., Urzì, O., Tinnirello, V., Moschetti, M., Conigliaro, A., Raimondo, S., Corleone, V., Fontana, S., & Alessandro, R. (2023). Citral-Enriched Fraction of Lemon Essential Oil Mitigates LPS-Induced Hepatocyte Injuries. Biology, 12(12), 1535. https://doi.org/10.3390/biology12121535