Next Article in Journal
Obstructive Sleep Apnea: A Look towards Micro-RNAs as Biomarkers of the Future
Next Article in Special Issue
Integrated Proteotranscriptomics of the Hypothalamus Reveals Altered Regulation Associated with the FecB Mutation in the BMPR1B Gene That Affects Prolificacy in Small Tail Han Sheep
Previous Article in Journal
Caffeine Delays Ethanol-Induced Sedation in Drosophila
Previous Article in Special Issue
Comprehensive Transcriptome Analysis of Different Skin Colors to Evaluate Genes Related to the Production of Pigment in Celestial Goldfish
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 12
Issue 1
10.3390/biology12010065
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Sox18 on the Induction Ability of Dermal Papilla Cells in Hu Sheep

by
Tingyan Hu
1,2,
Xiaoyang Lv
2,3,
Tesfaye Getachew
4,
Joram M. Mwacharo
4,
Aynalem Haile
4,
Kai Quan
5,
Yutao Li
6,
Shanhe Wang
1,2,* and
Wei Sun
1,2,3,7,*
1
College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, China
2
International Joint Research Laboratory in Universities of Jiangsu Province of China for Domestic Animal Germplasm Resources and Genetic Improvement, Yangzhou University, Yangzhou 225009, China
3
Joint International Research Laboratory of Agriculture and Agri-Product Safety of Ministry of Education of China, Yangzhou University, Yangzhou 225009, China
4
International Centre for Agricultural Research in the Dry Areas, Addis Ababa 999047, Ethiopia
5
College of Animal Science and Technology, Henan University of Animal Husbandry and Economy, Zhengzhou 450060, China
6
CSIRO Agriculture and Food, 306 Carmody Rd, St Lucia 4067, Australia
7
“Innovative China” “Belt and Road” International Agricultural Technology Innovation Institute for Evaluation, Protection, and Improvement on Sheep Genetic Resource, Yangzhou University, Yangzhou 225009, China
*
Authors to whom correspondence should be addressed.
Biology 2023, 12(1), 65; https://doi.org/10.3390/biology12010065
Submission received: 11 November 2022 / Revised: 19 December 2022 / Accepted: 29 December 2022 / Published: 30 December 2022
(This article belongs to the Special Issue New Advances and Insights in Animal Genetics and Breeding)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The Sox18 gene is important for the growth and function of dermal papilla cells, but its effect on the induction ability of dermal papilla cells in Hu sheep is not clear. Through experiments, we analyzed the effect of Sox18 on the induction ability of dermal papilla cells in Hu sheep. The results showed that Sox18 could enhance the induction ability of dermal papilla cells, and regulate the induction ability of dermal papilla cells through the Wnt/β-catenin signal pathway. We believe that Sox18 is an important gene that affects the induction ability of Hu sheep’s dermal papilla cells, and these findings may provide new avenues for studying the growth and development mechanism of hair.

Abstract

Sox18 is a developmental gene that encodes transcription factors. It has been indicated as be a key gene affecting the growth and development of hair follicles, in which dermal papilla cells (DPCs) have been demonstrated to play an important role through their ability to induce the formation of hair follicles. Pre-laboratory studies have found that Sox18 is differentially expressed in the dermal papilla cells of different pattern types of Hu sheep. We speculated that Sox18 plays an important role in the dermal papilla cells of Hu sheep. In our study, we analyzed the effect of Sox18 on the induction ability of DPCs in order to elucidate the function and molecular mechanism of Sox18 in the DPCs of Hu sheep. We first identified the expression of Sox18 in the DPCs of Hu sheep by immunofluorescence staining. We then used alkaline phosphatase staining, cell morphology observations and RT-PCR to detect the effect of Sox18 on the induction of DPCs after overexpression of or interference with Sox18. We also used RT-PCR, WB and immunofluorescence staining to detect the effect of Sox18 on the Wnt/β-catenin signal pathway in DPCs. We found that Sox18 was specifically expressed in the DPCs of Hu sheep, and that Sox18 could enhance the alkaline phosphatase activity in the DPCs of Hu sheep and accelerate cell agglutination. The results of RT-PCR revealed that Sox18 promoted the mRNA expression of Versican, HHIP and FGFRI, and inhibited the mRNA expression of BMP4 and WIF1. Further studies showed that Sox18 promoted the expression of β-catenin and activated the Wnt/β-catenin signal pathway in DPCs. When the Wnt/β-catenin signal pathway of DPCs was activated, the induction ability of DPCs was enhanced. Overall, we believe that Sox18 could enhance the induction ability of DPCs in Hu sheep and regulate the induction ability of DPCs through the Wnt/β-catenin signal pathway.

1. Introduction

The Hu sheep is a rare breed in China and is best known for its white lambskins with a wavy pattern. The lambskins have four grades: small waves, medium waves, large waves and straight wool. Among these, the pattern of small waves is the best and straight wool is the worst [1]. The curvature of wool is closely related to the development of the hair follicles, and dermal papilla cells (DPCs) can express and secrete a variety of growth factors and signaling molecules to stimulate the proliferation and differentiation of hair-producing cells, thus regulating the growth and development of hair follicles [2]. Driskell et al. found that the number of DPCs and their gene expression patterns can influence hair type and hair curvature [3], and Takahashi et al. showed that the Wnt/β-catenin signaling pathway has an influential function within the process of hair growth by regulating the induction ability of DPCs [4].
The hair follicles are important accessory organs of the skin that have a complex morphology that controls the growth of the mammalian coat and has a unique regenerative function [5]. After the birth of mammals, the growth of hair follicles has the characteristics of a lifetime cycle: a growth cycle consisting of the anagen, catagen and telogen phase. DPCs are a group of specialized fibroblasts that grow in an agglomeration at the basal layer of the hair follicle and are surrounded by hair-producing cells, and their most important characteristic is that they can maintain and induce hair follicles’ growth and development. A study has shown that hair follicles stop growing immediately after removing DPCs in the anagen phase, and transplanting DPCs in anagen or low-generation DPC lines with hair-producing cells into mouse ears can induce the formation of new hair follicles [6]. When DPCs were cultured in vitro, it was found that DPCs still had the ability to induce the formation of hair follicle [7,8], and had the characteristic of agglutinative growth which could form multi-layer agglutinates [9]. This growth characteristic seems to be closely related to the ability of DPCs to induce the formation of hair follicles [10,11]. DPCs have the function of inducing the formation of hair follicles and regulate their growth and development. Therefore, the induction ability of DPCs has a major effect on hair follicles and hair. Some growth factors secreted by DPCs participate in the regulation of periodic changes in the hair follicles, mediated the signal interaction between the dermis and epidermis of hair follicles, and promote the proliferation and differentiation of hair follicle cells, thus controlling the growth and development of hair follicles [12]. On the one hand, some characteristic molecules expressed by DPCs have been considered as typical indicators of periodic hair follicle growth, such as alkaline phosphatase (ALP), Versican, etc. [13,14,15,16]. In addition, some genes play an important role in maintaining the induction characteristics of DPCs, such as insulin-like growth factor 1 (IGF1), fibroblast growth factor 1 (FGF1), bone morphogenetic protein 4 (BMP4) and Wnt3a [17,18,19,20,21,22].
Sox18 is located on chromosome 13 in sheep. In the early stage of our laboratory work, through 10 × single-cell transcriptome genomic sequencing, we identified different types of cells in Hu sheep’s hair follicles and revealed the differential genes in different pattern types of hair follicles [23]. It was found that Sox18 was specifically expressed in the DPCs of Hu sheep and were significantly differentially expressed in the DPCs of different pattern types in Hu sheep [23]. Previous studies have found that nonsense mutations of Sox18 could cause hair development defects in mice. The heterozygotes shown a reduction in curved “zigzag hairs”, and the homozygotes showed a lack of whiskers and coat [24]. In Sox18 mutant mice, the expression of Wnt5a and the activity of the Wnt signaling pathway decreased significantly, indicating that Sox18 was a key gene that regulated the Wnt signaling pathway and affected the hair type and hair curvature in mice [25]. Combined with the function of Sox18 in the development of hair follicles in mice and its regulation of the Wnt signaling pathway, it was speculated that Sox18 affects the function of DPCs by regulating Wnt signaling in DPCs, and then plays an important role in the regulating the formation of lambskin patterns, but its specific regulatory mechanism still needs to be explored in depth. In this study, we will analyze the effect of Sox18 on the induction ability of DPCs in Hu sheep by overexpressing and interfering with Sox18 in the DPCs of Hu sheep. Ultimately, our results will provide a new direction for studying the molecular mechanism of lambskin pattern formation.

2. Materials and Methods

2.1. Culture of DPCs of Hu Sheep

All DPCs of Hu sheep used for the experiments were previously isolated and cultured in our laboratory [26]. The DPCs were cultured in DMEM/F12 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 1% penicillin–streptomycin (Gibco, Grand Island, NY, USA) at 37 °C with 5% CO2.
We used a 0.25% trypsin-EDTA solution (Solarbio, Beijing, China) to digest the DPCs and considered each digestion of DPCs as one cell passing through to the next generation. The third-generation DPCs had a single morphology and good growth activity, so the third-generation DPCs were used in the experiment.

2.2. Immunofluorescence Staining in Dermal Papilla Cells of Hu Sheep

The cells were fixed in 4% formaldehyde and incubated in primary antibodies (1:200) and secondary antibodies (1:200). The DPCs were stained by adding Hoechst dye (1 μg/mL), and the images were taken by a fluorescence inversion microscope system (Nikon, Tokyo, Japan). Primary antibodies included those against VIM (sc-6260, Santa Cruz Biotechnology, Dallas, TX, USA), β-catenin (66379-1-Ig, Proteintech, Wuhan, China), Versican (D223532, Sangon, Shanghai, China), and Sox18 (DF8720, Affinity Biosciences, Changzhou, China). Secondary antibodies included goat anti-rabbit IgG H&L (ab150078, Abcam, Cambridge, UK) and goat anti-mouse IgG H&L (ab150114, Abcam, Cambridge, UK).

2.3. Total Cellular RNA Extraction

When the DPCs were up to 80–90% confluence in six-well plates, or 24 h after cell transfection was completed, Trizol Universal Reagent (Tiangen, Beijing, China) was used to extracted total cellular RNA according to its instruction, and the RNA was stored at −80 °C until use.

2.4. Construction of the Sox18 Overexpression Vector

2.4.1. Full-Length Amplification of the Sox18 CDS Region and Restriction of pcDNA3.1 Plasmid

According to NCBI (https://www.ncbi.nlm.nih.gov/ (accessed on 17 January 2022)), the full-length CDS (coding sequence) of the Sox18 gene of sheep (1176 bp, GenBank Accession: XM_027976914.2) was acquired. The amplification primers were then designed by using Primer Premier 5. The primer sequences were as follows:
F: ctagcgtttaaacttaagcttATGCAGAGATCGCCGCTCGG
R: ccacactggactagtggatccCTATCCAGAGATGCAGGCGCTGTAG
The uppercase letters indicate the full-length amplified CDS of Sox18. The lowercase letters indicate the terminal sequence of the linearized vector (pcDNA3.1(+)) for homologous recombination, and the lowercase letters that have been underlined indicate the restriction enzyme digestion sites of HindIII (aagctt) and BamHI (ggatcc).
The full-length Sox18 CDS was amplified by using Prime STAR Max DNA polymerase reagent (Takara, Beijing, China), and the PCR products were identified by 1% agarose gel electrophoresis. The PCR products were recovered by using a SanPrep Column PCR Product Purification Kit (Sangon, Shanghai, China), and the DNA concentration was calculated by a micro-ultraviolet spectrophotometer (Life Real, Hangzhou, China).
The restriction enzymes HindⅢ and BamHIII (Takara, Kusatsu, Shiga, Japan) were used to cut the pcDNA3.1(+) plasmid (Youbio, Changsha, China), and the enzyme’s digestion products were detected with 1% agarose gel electrophoresis. The enzyme digestion products were then recovered and measured. Finally, all recovered products were stored at −20 °C.

2.4.2. Ligation of the Sox18 Fragment with Linear Vector

According to the manual of ClonExpress® II One Step Cloning Kit, the recombination reaction was carried out. The recombinant product was then transformed into Trelief™ 5α chemically competent cells (Tsingke, Beijing, China). Individual colonies were selected and placed in tubes with 15 mL of ampicillin-resistant LB broth and shaken for 16 h. The plasmid was extracted from 10 mL of the bacterial solution by using an EndoFree Mini Plasmid Kit Ⅱ (Tsingke, Beijing, China) and was examined by double restriction endonuclease digestion. Finally, the successfully constructed vector was named pcDNA3.1(+)-Sox18 (Figure S1) and stored at −20 °C.

2.5. Sox18 siRNA Synthesis

The siRNA of Sox18 was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The sequences are shown in Table 1.

2.6. Cell Transfection

When the DPCs had grown to 50–70% confluence, the plasmids or siRNAs were transfected into the DPCs by using jetPRIME (Polyplus transfection, Illkirch, France).

2.7. Alkaline Phosphatase Activity

The DPCs were fixed with 4% formaldehyde. The alkaline phosphatase activity of DPCs was detected by using a BCIP/NBT Alkaline Phosphatase Color Development Kit (Beyotime, Shanghai, China). Finally, the images were acquired by a fluorescence inversion microscope system (Nikon, Tokyo, Japan) and we used Image J software to calculate the staining area in different treatment groups from the same field of view.

2.8. Real-Time Quantitative Polymerase Chain Reaction (RT-PCR)

FastKing gDNA Dispelling RT SuperMix (TIANGEN, Beijing, China) was used to obtain the first-stand cDNA, then the mRNA expression levels were detected by 2×TSINGKE® Master qPCR Mix (SYBR Green I) (Tsingke, Beijing, China).
The primers’ information is listed in Table 2. We used GAPDH as the reference genes and each RT-PCR experiment included three biological replicates and three technical replicates.

2.9. Western Blotting

The protein was extracted using a Total Protein Extraction Kit (Beyotime, Shanghai, China), and the concentration was measured using a BCA Protein Assay Kit (Beyotime, Shanghai, China). The proteins were separated and transferred to PVDF membranes. The PVDF membranes were probed with the primary antibodies and the secondary antibodies. Finally, the expression of protein was measured using the ECL Western Blot kit (Biosharp, Hefei, China) and analyzed by a ChemiDocTM Touch Imaging System (Bio-Rad, CAL, USA).
The primary antibodies were anti-Sox18 (1:1000, DF8720, Affinity Biosciences, Changzhou, China), anti-β-catenin (1:1000, AF0069, Beyotime, Shanghai, China) and anti-GAPDH (1:3000, T0004, Affinity Bio-sciences, Changzhou, China). The secondary antibodies were HRP goat anti-rabbit IgG (1:1000, AS014, ABclonal, Wuhan, China) and HRP goat anti-mouse IgG (1:1000, AS014, ABclonal, Wuhan, China).

2.10. Activation and Inhibition of Wnt/β-Catenin Signal Pathway

SKL2001 (HY-101085, MedChemExpress, Shanghai, China) was used as an agonist of the Wnt/β-catenin signal pathway and IWP-2 (SF6831, Beyotime, Shanghai, China) was used as an inhibitor of the Wnt/β-catenin signal pathway [27,28]. The DPCs were grown to 50–80% confluence and treated with 40 μΜ SKL2001 or 10 μΜ IWP-2 for 24 h.

2.11. Statistical Analysis

SPSS 20.0 software was used for statistical analysis. Independent samples t-tests were used to calculate the statistical significance between two groups, and one-way ANOVA was used for multiple groups. Composite data are shown as the mean ± standard error.

3. Results

3.1. Sox18 Was a Marker Gene of DPCs in Hu Sheep

After the isolation and culture of DPCs, immunofluorescence identification was carried out. Firstly, the expression of the specific marker genes VIM and Versican in the DPCs of Hu sheep was detected, and the results were positive (Figure 1). It was indicated that the cells cultured in this experiment were dermal papilla cells. In combination with the result of 10× single cell transcriptome genomic sequencing, which showed that Sox18 was specifically expressed in the DPCs of Hu sheep, the expression of Sox18 in the primary DPCs of Hu sheep was detected. The result showed that all cells were positive (Figure 1), which indicated that Sox18 was a marker gene of DPCs in Hu sheep.

3.2. Sox18 Enhanced the Induction Ability of DPCs in Hu Seep

In order to express Sox18 efficiently in the DPCs of Hu sheep and explored the effect of Sox18 on the induction ability of DPCs in Hu sheep, we constructed a Sox18 overexpression vector successfully and transfected it into the DPCs (Figure 2).
Alkaline phosphatase activity is an important index for evaluating the induction ability of DPCs [15]. Therefore, we detected the alkaline phosphatase activity of DPCs in Hu sheep by staining, and an increased number of staining sites and a darker color indicated stronger alkaline phosphatase activity. Firstly, we detected the alkaline phosphatase activity of primary DPCs. The results showed that primary DPCs had strong alkaline phosphatase activity (Figure 3A). We then stained the third-generation DPCs and found that the alkaline phosphatase activity of the third-generation DPCs became weak (Figure 3A). Finally, we transfected pcDNA3.1(+)-Sox18, pcDNA3.1(+), siRNA-Sox18 and siRNA-NC separately in the third-generation DPCs, and detected alkaline phosphatase activity in the DPCs 24 h after transfection. The results showed that overexpression of Sox18 significantly enhanced the alkaline phosphatase activity of DPCs, and interfering with Sox18 decreased the alkaline phosphatase activity of DPCs (Figure 3B,C). Further observations showed that the overexpression of Sox18 could promote the agglutination of DPCs (Figure 3D). These results showed that Sox18 enhanced the induction ability of DPCs.
The mRNA expression levels of the target gene Sox18 and the genes related to the induction ability of DPCs were detected by RT-PCR. GAPDH was the internal reference gene. After overexpression of Sox18 in DPCs, the mRNA expression of Sox18 increased significantly (p < 0.05) (Figure 4A). Moreover, the mRNA expression levels of Versican, HHIP and FGFRI increased, and the mRNA expression levels of BMP4 and WIF1 decreased (Figure 4B). However, after interfering with Sox18 in DPCs, the mRNA expression of Sox18 decreased significantly (p < 0.05) (Figure 4C). At the same time, the mRNA expression levels of Versican, HHIP and FGFRI decreased, and the mRNA expression levels of BMP4 and WIF1 increased (Figure 4D). The results of Western blotting showed that the protein expression levels of Sox18 were upregulated after overexpression of Sox18 (Figure 4E), and decreased after interfering with Sox18 (Figure 4F). To sum up, Sox18 could enhance the induction ability of DPCs.

3.3. Sox18 Regulated the Induction Ability of DPCs through the Wnt/β-Catenin Signal Pathway

The Wnt/β-catenin signal pathway is closely related to the growth and development of hair follicles. The results of RT-PCR and WB revealed that the expression of β-catenin was significantly changed in DPCs when Sox18 was overexpressed or interfered with (Figure 5A,B). We speculated that Sox18 regulated the induction ability of DPCs through the Wnt/β-catenin signal pathway. SKL2001 was used to activate the Wnt/β-catenin signal pathway of DPCs [27]. After the Wnt/β-catenin pathway signal of DPCs had been activated, the amount of β-catenin expressed in the nucleus of DPCs increased (Figure 5C). When Sox18 was overexpressed in DPCs, the amount of β-catenin expressed in the nucleus of DPCs also increased, indicating that Sox18 activated the Wnt/β-catenin signal pathway of DPCs (Figure 5C). Further study found that the alkaline phosphatase activity of DPCs was enhanced when Sox18 was overexpressed in DPCs, which was the same as when the Wnt/β-catenin signal pathway was activated (Figure 5D,E). However, the positive effect of Sox18 on the alkaline phosphatase activity of DPCs was aborted when we added IWP-2, an inhibitor of the Wnt/β-catenin signal pathway [28], to DPCs overexpressing Sox18 (Figure 5D,E). Therefore, we believe that the Wnt/β-catenin signal pathway was closely related to the induction ability of DPCs. It was further observed that overexpressed Sox18 as well as activation of the Wnt/β-catenin signal pathway in DPCs enhanced the agglutination of DPCs, while inhibition of the Wnt/β-catenin signal pathway weakened the effect of Sox18 on the agglutination of DPCs (Figure 5F). This further suggested that Sox18 regulated the induction ability of DPCs through the Wnt/β-catenin signal pathway. To sum up, Sox18 activated the Wnt/β-catenin signal pathway in DPCs, thus enhancing the induction ability of DPCs.

4. Discussion

DPCs have the ability to induce the formation of hair follicles and regulate their growth. When cultured in vitro, DPCs still had the ability to induce hair follicle formation [7,8], and had the characteristic of agglutinative growth that allowed the formation of multi-layer agglutinates [9]. This growth characteristic seems to be closely related to the ability of DPCs to induce hair follicle formation [10,11]. However, as the number of generations increased, the ability and growth characteristics are gradually reduced and were ultimately lost, resulting in inactivation of the hair follicle and causing hair loss [29,30,31].
Early studies have shown that Sox (SRY-related high mobility group box) genes are involved in a variety of early embryonic developmental processes such as blood cell production, sex determination, skeletal development, and nervous system and lens development [32,33]. Sox18 is a key gene for the growth and development of hair follicles in mice. The expression of Sox18 has been detected in DPCs, and it plays an important role in the development and function of DPCs [24,34,35]. Villani et al. constructed mouse models of Sox18 mutations, including Sox18−/−, Sox18+/Ra and Sox18Op/+, in which Sox18Op/+ mutants exhibited severe hair development defects [25]. The dominant negative mutation of Sox18 inhibited the formation and differentiation of DPCs, resulting in defective hair growth and development. Sox18 mutation also prevented newborn dermal cells or hair papillae form inducing hair formation in regeneration experiments. Further analysis using gene chips indicated that Sox18 may affect the Wnt signaling pathway in epidermal cells by regulating the expression of Wnt5a, which, in turn, affects the hair’s morphology [25]. Sox18 has the function of regulating the normal differentiation of DPCs in all hair types, and Sox18 acts as a mesenchymal molecular switch that is required for the formation and function of DPCs in all hair types [36]. Sox18 plays an important role in the growth and development of hair follicles, but the molecular mechanism by which the Sox18 affects wool curvature in sheep needs to be further studied.
Some growth factors secreted by DPCs can participate in the regulation of periodic changes in the hair follicles through autocrine or paracrine secretion. These growth factors mediate the signaling interaction between the dermal and epidermal parts of hair follicles, and they promote the proliferation and differentiation of hair follicle cells, thus controlling the growth and development of hair follicles [12]. ALP, which is secreted by DPCs, is a hydrolase that releases phosphate groups in a mild alkaline environment. The formation of hair follicles can be more effectively induced when DPCs with higher ALP activity are transplanted into a skin wound of a recipient [37]. Moreover, Iida M et al. also confirmed that the ALP activity of dermal papilla cells changed with the periodic growth of hair follicles, with the highest activity in the anagen phase and the lowest in the telogen phase [15]. The level of ALP activity in DPCs is related to the formation of hair follicles, so ALP is considered to be an index for evaluating the periodic growth activity of hair follicles induced by DPCs. The expression of Versican was detected in the dorsal hair follicles of mice from the early to mid-anagen phase, but it was found in only in a few hair follicles’ DPCs during the late anagen phaes, and none was found in hair papillae during the catagen and telogen phases [38]. This suggests that Versican is a key regulator in the anagen phase. In addition, Versican plays an important role in maintaining the processes of cell proliferation, differentiation and migration during the anagen phase [39]. BMP4 is a member of the BMPs family and acts mainly at the end of the anagen phase and in the process of entering the telogen phase [19]. BMP4 can inhibit the transformation of hair follicles from the telogen to the anagen phase, and regulates the shape, size and position of hair follicles [40]. Wnt inhibitory factor 1 (WIF1) is the suppressor gene of the Wnt/β-catenin signaling pathway, which blocks the downstream the Wnt signal pathway by directly binding to the Wnt ligand and preventing it from binding to the complex of the coiled-coil protein receptor and LRP5/6 [41]. WIF1 is considered to be the marker gene of dermal condensate, and its expression is significantly upregulated during the induction of primary hair follicles in Tibetan sheep, which may regulate the formation of primary hair follicles’ condensate in Tibetan sheep [42]. HHIP is considered to be a potential antagonist of SHH, which inhibits the activation of the SHH signaling pathway through a negative feedback mechanism, and SHH signaling transduction is very important for hair follicle development [43]. FGFR1 is a transmembrane receptor of some fibroblast growth factors that has tyrosine kinase activity and is located in the papilla of hair follicles to promote the growth and development of hair follicles [44]. The results of this study are consistent with the reported results.
The normal development and regular growth of hair follicles depend on the regulation of a complex network of signaling pathways between the dermis and keratinocytes, including the Wnt signal pathway, the BMP signal pathway, the SHH signal pathway and the Notch signal pathway [45,46,47,48,49,50]. The Wnt signal pathway is very important for controlling the number, size, growth and regeneration of hair follicles [51]. The Wnt signal pathway includes four branches, and the Wnt/β-catenin signal pathway is the one most closely related to the growth of hair follicles [52]. After human dermal papilla cells were treated with Wnt3a, the expression of β-catenin signaling was increased and β-catenin signaling was attenuated after treatment with Wnt5a. Moreover, transfection with Wnt5a-siRNA in cultured DPCs enhances β-catenin signaling [53]. In addition to Wnt protein, β-catenin can also regulate the hair growth cycle through the Wnt/β-catenin signal pathway. β-catenin protein can regulate the formation of hair follicle substrate [54], and β-catenin, FGF and IGF in the dermal papillae can mediate the induction of the dermal papillae [55]. The key function of the Wnt signal pathway in hair follicle formation and hair growth has been widely recognized, but the specific mechanism of the Wnt/β-catenin signal pathway involved in the growth and development of hair follicles needs to be further studied. In our study, we found that Sox18 could activate the Wnt/β-catenin signal pathway in DPCs and enhance the induction ability of DPCs. We speculated that Sox18 regulated the induction ability of DPCs through the Wnt/β-catenin signal pathway, but the specific molecular mechanism still needs further study.

5. Conclusions

To sum up, this study verified that Sox18 could improve the induction ability of DPCs in Hu sheep and did so through the Wnt/β-catenin signal pathway. These findings might help us to study the molecular mechanism of lambskin pattern formation in more depth.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biology12010065/s1, Figure S1: The pcDNA3.1(+)-Sox18 plasmid illustration; Figure S2: 1% agarose gel electrophoresis of amplification products of Hu sheep Sox18 CDS (1176bp); Figure S3: 1% agarose gel electrophoresis of double enzyme digestion products of pcDNA3.1(+)-Sox18 (1176bp and 5427bp); Figure S4: Western blot membrane of Sox18 (41kDa) protein from DPCs transfected with pcDNA3.1(+)-Sox18 and pcDNA3.1(+); Figure S5: Western blot membrane of Sox18 (41kDa) protein from DPCs transfected with siRNA-Sox18 and siRNA-NC; Figure S6: Western blot membrane of β-catenin (85kDa) protein from DPCs transfected with pcDNA3.1(+)-Sox18 and pcDNA3.1(+); Figure S7: Western blot membrane of β-catenin (85kDa) protein from DPCs transfected with siRNA-Sox18 and siRNA-NC; Figure S8: Western blot membrane of GAPDH (37kDa) protein from DPCs transfected with pcDNA3.1(+)-Sox18 and pcDNA3.1(+); Figure S9: Western blot membrane of GAPDH (37kDa) protein from DPCs transfected with siRNA-Sox18 and siRNA-NC.

Author Contributions

S.W. and W.S. designed this study; T.H. performed the experiments; T.H. and X.L. contributed to the collection of materials and data in this study; T.H. wrote the manuscript; T.G., J.M.M., A.H., K.Q. and Y.L. revised the final manuscript. All authors approved the final manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32172689), the Natural Science Foundation of Jiangsu Province (BK20210810), the National Natural Science Foundation of China (31872333), the National Natural Science Foundation of China-CGIAR (32061143036), the Major New Varieties of Agricultural Projects in Jiangsu Province (PZCZ201739), the High-end Foreign Expert Introduction Project (G2022014148L), the Jiangsu 333 Distinguished Talents Project Foundation [(2022) 2-323], the Natural Science Foundation of the Jiangsu Higher Education Institutions of China (22KJA230001, 22KJD230003), the Distinguished Talents Project Foundation of Yangzhou University and the General Project of Natural Science Research of Colleges and Universities in Jiangsu Province (20KJB230003).

Institutional Review Board Statement

The sample collection protocol was approved by the Animal Care and Use Committee at Yangzhou University (No: NSFC2020-NFY-1). All animal experimental procedures were implemented in strict accordance with the guidelines of the Animal Care and Use Committee of Yangzhou University to minimize the suffering of animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. The single-cell RNA sequencing data mentioned in this research have been deposited in the NCBI’s Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/ (accessed on 20 October 2021)) under accession number: GSE186204.

Conflicts of Interest

All the authors declare no competing interests.

References

  1. Lv, X.; Sun, W.; Yin, J.; Ni, R.; Su, R.; Wang, Q.; Gao, W.; Bao, J.; Yu, J.; Wang, L.; et al. An Integrated Analysis of MicroRNA and mRNA Expression Profiles to Identify RNA Expression Signatures in Lambskin Hair Follicles in Hu Sheep. PLoS ONE 2016, 11, e0157463. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Xu, T.; Guo, X.; Wang, H.; Hao, F.; Du, X.; Gao, X.; Liu, D. Differential gene expression analysis between anagen and telogen of Capra hircus skin based on the de novo assembled transcriptome sequence. Gene 2013, 520, 30–38. [Google Scholar] [CrossRef] [PubMed]
  3. Driskell, R.R.; Giangreco, A.; Jensen, K.B.; Mulder, K.W.; Watt, F.M. Sox2-positive dermal papilla cells specify hair follicle type in mammalian epidermis. Development 2009, 136, 2815–2823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Takahashi, R.; Grzenda, A.; Allison, T.F.; Rawnsley, J.; Balin, S.J.; Sabri, S.; Plath, K.; Lowry, W.E. Defining Transcriptional Signatures of Human Hair Follicle Cell States. J. Investig. Dermatol. 2020, 140, 764–773.e764. [Google Scholar] [CrossRef] [PubMed]
  5. Schneider, M.R.; Schmidt-Ullrich, R.; Paus, R. The hair follicle as a dynamic miniorgan. Curr. Biol. 2009, 19, R132–R142. [Google Scholar] [CrossRef] [Green Version]
  6. Feng, Z.; Sun, Y.; Song, Y.; Zhou, Y.; Zhang, L.; Li, S.; Yan, X.; Xu, Y. Research Progress on the Correlation between Wnt/β-catenin Signaling Pathway and Hair Follicle. Chin. J. Anim. Sci. 2021, 57, 88–95. [Google Scholar] [CrossRef]
  7. Chi, W.; Wu, E.; Morgan, B.A. Dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Development 2013, 140, 1676–1683. [Google Scholar] [CrossRef] [Green Version]
  8. Zhang, H.; Zhu, N.X.; Huang, K.; Cai, B.Z.; Zeng, Y.; Xu, Y.M.; Liu, Y.; Yuan, Y.P.; Lin, C.M. iTRAQ-Based Quantitative Proteomic Comparison of Early- and Late-Passage Human Dermal Papilla Cell Secretome in Relation to Inducing Hair Follicle Regeneration. PLoS ONE 2016, 11, e0167474. [Google Scholar] [CrossRef] [Green Version]
  9. Withers, A.P.; Jahoda, C.A.; Ryder, M.L.; Oliver, R.F. Culture of wool follicle dermal papilla cells from two breeds of sheep. Arch. Dermatol. Res. 1986, 279, 140–142. [Google Scholar] [CrossRef]
  10. Higgins, C.A.; Chen, J.C.; Cerise, J.E.; Jahoda, C.A.; Christiano, A.M. Microenvironmental reprogramming by three-dimensional culture enables dermal papilla cells to induce de novo human hair-follicle growth. Proc. Natl. Acad. Sci. USA 2013, 110, 19679–19688. [Google Scholar] [CrossRef]
  11. Lin, C.M.; Liu, Y.; Huang, K.; Chen, X.C.; Cai, B.Z.; Li, H.H.; Yuan, Y.P.; Zhang, H.; Li, Y. Long noncoding RNA expression in dermal papilla cells contributes to hairy gene regulation. Biochem. Biophys. Res. Commun. 2014, 453, 508–514. [Google Scholar] [CrossRef] [PubMed]
  12. Geng, R.; Yuan, C.; Chen, Y. Exploring differentially expressed genes by RNA-Seq in cashmere goat (Capra hircus) skin during hair follicle development and cycling. PLoS ONE 2013, 8, e62704. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Liu, B.; Gao, F.; Guo, J.; Wu, D.; Hao, B.; Li, Y.; Zhao, C. A Microarray-Based Analysis Reveals that a Short Photoperiod Promotes Hair Growth in the Arbas Cashmere Goat. PLoS ONE 2016, 11, e0147124. [Google Scholar] [CrossRef] [Green Version]
  14. Zheng, Y.; Wang, Z.; Zhu, Y.; Wang, W.; Bai, M.; Jiao, Q.; Wang, Y.; Zhao, S.; Yin, X.; Guo, D.; et al. LncRNA-000133 from secondary hair follicle of Cashmere goat: Identification, regulatory network and its effects on inductive property of dermal papilla cells. Anim. Biotechnol. 2020, 31, 122–134. [Google Scholar] [CrossRef] [PubMed]
  15. Iida, M.; Ihara, S.; Matsuzaki, T. Hair cycle-dependent changes of alkaline phosphatase activity in the mesenchyme and epithelium in mouse vibrissal follicles. Dev. Growth Differ. 2007, 49, 185–195. [Google Scholar] [CrossRef]
  16. Yang, Y.; Li, Y.; Wang, Y.; Wu, J.; Yang, G.; Yang, T.; Gao, Y.; Lu, Y. Versican gene: Regulation by the beta-catenin signaling pathway plays a significant role in dermal papilla cell aggregative growth. J. Dermatol. Sci. 2012, 68, 157–163. [Google Scholar] [CrossRef]
  17. Stewart, C.E.R.P. Growth, differentiation, and survival: Multiple physiological functions for insulin-like growth factors. Physiol Rev. 1996, 76, 1005–1026. [Google Scholar] [CrossRef]
  18. Ota, Y.; Saitoh, Y.; Suzuki, S.; Ozawa, K.; Kawano, M.; Imamura, T. Fibroblast growth factor 5 inhibits hair growth by blocking dermal papilla cell activation. Biochem. Biophys. Res. Commun. 2002, 290, 169–176. [Google Scholar] [CrossRef]
  19. Botchkarev, V.A.; Botchkareva, N.V.; Sharov, A.A.; Funa, K.; Huber, O.; Gilchrest, B.A. Modulation of BMP signaling by noggin is required for induction of the secondary (nontylotrich) hair follicles. J. Investig. Dermatol. 2002, 118, 3–10. [Google Scholar] [CrossRef] [Green Version]
  20. Chen, M.; Do, H. Wnt Signaling in Neurogenesis during Aging and Physical Activity. Brain Sci. 2012, 2, 745–768. [Google Scholar] [CrossRef]
  21. Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [PubMed]
  22. Shimizu, H.; Morgan, B.A. Wnt signaling through the beta-catenin pathway is sufficient to maintain, but not restore, anagen-phase characteristics of dermal papilla cells. J. Investig. Dermatol. 2004, 122, 239–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Wang, S.; Wu, T.; Sun, J.; Li, Y.; Yuan, Z.; Sun, W. Single-Cell Transcriptomics Reveals the Molecular Anatomy of Sheep Hair Follicle Heterogeneity and Wool Curvature. Front. Cell Dev. Biol. 2021, 9, 800157. [Google Scholar] [CrossRef] [PubMed]
  24. Pennisi, D.; Gardner, J.; Chambers, D.; Hosking, B.; Peters, J.; Muscat, G.; Abbott, C.; Koopman, P. Mutations in Sox18 underlie cardiovascular and hair follicle defects in ragged mice. Nat. Genet. 2000, 24, 434–437. [Google Scholar] [CrossRef]
  25. Villani, R.; Hodgson, S.; Legrand, J.; Greaney, J.; Wong, H.Y.; Pichol-Thievend, C.; Adolphe, C.; Wainwight, B.; Francois, M.; Khosrotehrani, K. Dominant-negative Sox18 function inhibits dermal papilla maturation and differentiation in all murine hair types. Development 2017, 144, 1887–1895. [Google Scholar] [CrossRef] [Green Version]
  26. Hu, T.; Huang, S.; Lv, X.; Wang, S.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Sun, W. miR-143 Targeting CUX1 to Regulate Proliferation of Dermal Papilla Cells in Hu Sheep. Genes 2021, 12, 2017. [Google Scholar] [CrossRef]
  27. Gwak, J.; Hwang, S.G.; Park, H.S.; Choi, S.R.; Park, S.H.; Kim, H.; Ha, N.C.; Bae, S.J.; Han, J.K.; Kim, D.E.; et al. Small molecule-based disruption of the Axin/beta-catenin protein complex regulates mesenchymal stem cell differentiation. Cell Res. 2012, 22, 237–247. [Google Scholar] [CrossRef] [Green Version]
  28. Chen, B.; Dodge, M.E.; Tang, W.; Lu, J.; Ma, Z.; Fan, C.W.; Wei, S.; Hao, W.; Kilgore, J.; Williams, N.S.; et al. Small molecule-mediated disruption of Wnt-dependent signaling in tissue regeneration and cancer. Nat. Chem. Biol. 2009, 5, 100–107. [Google Scholar] [CrossRef] [Green Version]
  29. Jahoda, C.A.; Reynolds, A.J.; Oliver, R.F. Induction of hair growth in ear wounds by cultured dermal papilla cells. J. Investig. Dermatol. 1993, 101, 584–590. [Google Scholar] [CrossRef] [Green Version]
  30. Luo, Y.; Du, H.; Ju, Y.; Wang, J.; Long, C.; Gao, J.; Liu, H. Isolation and cultivation of Tibet miniature pig dermal papilla cells in vitro. J. Pract. Dermatol. 2013, 6, 1–2. [Google Scholar] [CrossRef]
  31. Bai, L.; Sun, H.; Hu, H.; Yang, L.; Gao, S.; Jiang, W. Study on isolation, culture, identification and growth characteristics of dermal papilla cells in angora rabbit. J. Domest. Anim. Ecol. 2017, 38, 20–26. [Google Scholar] [CrossRef]
  32. She, Z.Y.; Yang, W.X. SOX family transcription factors involved in diverse cellular events during development. Eur. J. Cell Biol. 2015, 94, 547–563. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, Z.; Luo, Y. Research progress of transcription factor SOXF family regulating endothelial cells. Jiangxi Med. J. 2021, 56, 448–450. [Google Scholar] [CrossRef]
  34. Pennisi, D.; Bowles, J.; Nagy, A.; Muscat, G.; Koopman, P. Mice null for Sox18 are viable and display a mild coat defect. Mol. Cell Biol. 2000, 20, 9331–9336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. James, K.; Hosking, B.; Gardner, J.; Muscat, G.E.O.; Koopman, P. Sox18 mutations in theragged mouse allelesragged-like andopossum. Genesis 2003, 36, 1–6. [Google Scholar] [CrossRef] [PubMed]
  36. Woo, W.M.; Zhen, H.H.; Oro, A.E. Shh maintains dermal papilla identity and hair morphogenesis via a Noggin-Shh regulatory loop. Genes Dev. 2012, 26, 1235–1246. [Google Scholar] [CrossRef] [Green Version]
  37. Yuan, C.; Wang, X.; Geng, R.; He, X.; Qu, L.; Chen, Y. Discovery of cashmere goat (Capra hircus) microRNAs in skin and hair follicles by Solexa sequencing. BMC Genom. 2013, 14, 511. [Google Scholar] [CrossRef] [Green Version]
  38. Soma, T.; Tsuji, Y.; Hibino, T. Involvement of transforming growth factor-beta2 in catagen induction during the human hair cycle. J. Investig. Dermatol. 2002, 118, 993–997. [Google Scholar] [CrossRef] [Green Version]
  39. Lynn, A.K.; Yannas, I.V.; Bonfield, W. Antigenicity and immunogenicity of collagen. J. Biomed. Mater. Res. B Appl. Biomater. 2004, 71, 343–354. [Google Scholar] [CrossRef]
  40. Plikus, M.V.; Mayer, J.A.; de la Cruz, D.; Baker, R.E.; Maini, P.K.; Maxson, R.; Chuong, C.M. Cyclic dermal BMP signalling regulates stem cell activation during hair regeneration. Nature 2008, 451, 340–344. [Google Scholar] [CrossRef]
  41. Hu, Y.A.; Zhao, C.J. Research progress of Wif1 in development of nervous system. Zhejiang Da Xue Xue Bao Yi Xue Ban 2010, 39, 93–96. [Google Scholar] [CrossRef] [PubMed]
  42. Hsieh, J.C.; Kodjabachian, L.; Rebbert, M.L.; Rattner, A.; Smallwood, P.M.; Samos, C.H.; Nusse, R.; Dawid, I.B.; Nathans, J. A new secreted protein that binds to Wnt proteins and inhibits their activities. Nature 1999, 398, 431–436. [Google Scholar] [CrossRef] [PubMed]
  43. Wei, H.; Li, J.; Shi, S.; Zhang, L.; Xiang, A.; Shi, X.; Yang, G.; Chu, G. Hhip inhibits proliferation and promotes differentiation of adipocytes through suppressing hedgehog signaling pathway. Biochem. Biophys. Res. Commun. 2019, 514, 148–156. [Google Scholar] [CrossRef]
  44. Tsuboi, R.; Yamazaki, M.; Matsuda, Y.; Uchida, K.; Ueki, R.; Ogawa, H. Antisense oligonucleotide targeting fibroblast growth factor receptor (FGFR)-1 stimulates cellular activity of hair follicles in an in vitro organ culture system. Int. J. Dermatol. 2007, 46, 259–263. [Google Scholar] [CrossRef]
  45. Huntzicker, E.G.; Oro, A.E. Controlling hair follicle signaling pathways through polyubiquitination. J. Investig. Dermatol. 2008, 128, 1081–1087. [Google Scholar] [CrossRef] [Green Version]
  46. Lin, C.M.; Yuan, Y.P.; Chen, X.C.; Li, H.H.; Cai, B.Z.; Liu, Y.; Zhang, H.; Li, Y.; Huang, K. Expression of Wnt/beta-catenin signaling, stem-cell markers and proliferating cell markers in rat whisker hair follicles. J. Mol. Histol. 2015, 46, 233–240. [Google Scholar] [CrossRef]
  47. Rendl, M.; Polak, L.; Fuchs, E. BMP signaling in dermal papilla cells is required for their hair follicle-inductive properties. Genes Dev. 2008, 22, 543–557. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Andersson, E.R.; Sandberg, R.; Lendahl, U. Notch signaling: Simplicity in design, versatility in function. Development 2011, 138, 3593–3612. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Wang, L.C.; Liu, Z.Y.; Gambardella, L.; Delacour, A.; Shapiro, R.; Yang, J.; Sizing, I.; Rayhorn, P.; Garber, E.A.; Benjamin, C.D.; et al. Regular articles: Conditional disruption of hedgehog signaling pathway defines its critical role in hair development and regeneration. J. Investig. Dermatol. 2000, 114, 901–908. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Liu, G.Y.; Bai, L.Y.; Li, F.C. Progress in research on the regulatory signaling pathway of hair follicle development and periodic growth. Anim. Husb. Vet. Med. 2021, 53, 125–129. [Google Scholar]
  51. Ma, Y.; You, Y.; Shen, H.; Sun, Z.; Zeng, L.; Fa, Y. Effect of Noggin silencing on the BMP and Wnt signaling pathways. Acta Lab. Anim. Sci. Sin. 2016, 24, 475–480. [Google Scholar] [CrossRef]
  52. Lan, X.; Yang, X. Wnt/β-catenin signaling pathways and hair follicle morphogenesis. J. Pract. Dermatol. 2015, 8, 205–207. [Google Scholar] [CrossRef]
  53. Kwack, M.H.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Wnt5a attenuates Wnt/beta-catenin signalling in human dermal papilla cells. Exp. Dermatol. 2013, 22, 229–231. [Google Scholar] [CrossRef] [PubMed]
  54. Huelsken, J.; Vogel, R.; Erdmann, B.; Cotsarelis, G.; Birchmeier, W. β-Catenin Controls Hair Follicle Morphogenesis and Stem Cell Differentiation in the Skin. Cell 2001, 105, 533–545. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Enshell-Seijffers, D.; Lindon, C.; Kashiwagi, M.; Morgan, B.A. beta-catenin activity in the dermal papilla regulates morphogenesis and regeneration of hair. Dev. Cell 2010, 18, 633–642. [Google Scholar] [CrossRef] [PubMed]
Biology 12 00065 g001 550
Figure 1. Immunofluorescence analysis of the expression of VIM, Versican and Sox18 in the isolated DPCs. Scale bars, 100 μm. Red fluorescence indicates the nuclear expression pattern of the target protein. The nucleus was stained with blue Hoechst dye.
Figure 1. Immunofluorescence analysis of the expression of VIM, Versican and Sox18 in the isolated DPCs. Scale bars, 100 μm. Red fluorescence indicates the nuclear expression pattern of the target protein. The nucleus was stained with blue Hoechst dye.
Biology 12 00065 g001
Biology 12 00065 g002 550
Figure 2. Construction of pcDNA3.1(+)-Sox18. (A) Full-length amplification of Sox18 CDS from Hu sheep. Lane M is the DL2,000 marker; Lanes 1–3 are the PCR products. (B) Double restriction endonuclease digestion of pcDNA3.1(+)-Sox18. Lane M is the DL10,000 marker; Lanes 1–3 are the PCR products. (C) The transfection efficiency of pcDNA3.1(+)-Sox18 and siRNA-Sox18 in DPCs from Hu sheep. Scale bars, 500 μm.
Figure 2. Construction of pcDNA3.1(+)-Sox18. (A) Full-length amplification of Sox18 CDS from Hu sheep. Lane M is the DL2,000 marker; Lanes 1–3 are the PCR products. (B) Double restriction endonuclease digestion of pcDNA3.1(+)-Sox18. Lane M is the DL10,000 marker; Lanes 1–3 are the PCR products. (C) The transfection efficiency of pcDNA3.1(+)-Sox18 and siRNA-Sox18 in DPCs from Hu sheep. Scale bars, 500 μm.
Biology 12 00065 g002
Biology 12 00065 g003 550
Figure 3. The alkaline phosphatase activity of DPCs. (A) The primary DPCs and the third-generation DPCs. (B) The third-generation DPCs transfected with pcDNA3.1(+)-Sox18, pcDNA3.1(+), siRNA-Sox18 and siRNA-NC for 24 h. (C) The alkaline phosphatase staining area. (D) The agglutination of DPCs. Scale bars, 500 μm.
Figure 3. The alkaline phosphatase activity of DPCs. (A) The primary DPCs and the third-generation DPCs. (B) The third-generation DPCs transfected with pcDNA3.1(+)-Sox18, pcDNA3.1(+), siRNA-Sox18 and siRNA-NC for 24 h. (C) The alkaline phosphatase staining area. (D) The agglutination of DPCs. Scale bars, 500 μm.
Biology 12 00065 g003
Biology 12 00065 g004 550
Figure 4. Effect of Sox18 on the induction ability of DPCs. (A–D) The relative mRNA expression of Sox18, Versican, BMP4, WIF1, HHIP and FGFRI. (E,F) Detection of Sox18 protein expression levels. “*” indicates a significant difference (p < 0.05) and “**” indicates a highly significant difference (p < 0.01).
Figure 4. Effect of Sox18 on the induction ability of DPCs. (A–D) The relative mRNA expression of Sox18, Versican, BMP4, WIF1, HHIP and FGFRI. (E,F) Detection of Sox18 protein expression levels. “*” indicates a significant difference (p < 0.05) and “**” indicates a highly significant difference (p < 0.01).
Biology 12 00065 g004
Biology 12 00065 g005 550
Figure 5. Effect of Sox18 on the Wnt/β-catenin signal pathway in DPCs. (A)The relative mRNA expression of β-catenin. (B) Detection of the expression levels of β-catenin protein. (C) Immunofluorescence analysis of the expression of β-catenin in DPCs. (D) The alkaline phosphatase activity of DPCs. (E) The alkaline phosphatase staining area. (F) The agglutination of DPCs. “**” indicates a highly significant difference (p < 0.01). Scale bars, 100 μm or 500 μm.
Figure 5. Effect of Sox18 on the Wnt/β-catenin signal pathway in DPCs. (A)The relative mRNA expression of β-catenin. (B) Detection of the expression levels of β-catenin protein. (C) Immunofluorescence analysis of the expression of β-catenin in DPCs. (D) The alkaline phosphatase activity of DPCs. (E) The alkaline phosphatase staining area. (F) The agglutination of DPCs. “**” indicates a highly significant difference (p < 0.01). Scale bars, 100 μm or 500 μm.
Biology 12 00065 g005
Table
Table 1. Sequences of Sox18 siRNA and NC.
Table 1. Sequences of Sox18 siRNA and NC.
NameSequences (5′→3′)
siRNA-Sox18Sense:ACCAGUACCUCAACUGCAGTT
Antisense:CUGCAGUUGAGGUACUGGUTT
siRNA-NCSense:UUCUCCGAACGUGUCACGUTT
Antisense:ACGUGACACGUUCGGAGAATT
Table
Table 2. The information of the primers used for RT-PCR.
Table 2. The information of the primers used for RT-PCR.
NameForward Primer (5′-3′)Reverse Primer (5′-3′)Product Length
(bp)
Sox18TGTGGGCGAAGGACGAGCGCCAAGCCTGGGAGGAGGAG253
VersicanTACAAAGGGAGGGTGTCGGTAAGCCTTCTGTGCCATCTCA226
β-cateninTGAGTGGGAACAGGGGTTTTTGAGCAGCATCGAACTGTGT162
BMP4TAGCAAGAGCGCAGTCATCCAGCAGAGTTTTCGCTGGTCC196
WIF1AAGCCTGTACCTGTGGATCGCTGGCATTCTCTGCTGTGCT134
HHIPGTGGCCTGTGCTTTCCTGATAGAATGAAGAGGCGGTGGGA208
FGFR1CCCGGAGATGTTGCCATCAAGCCCTGTTCCTCTTTGCCAT135
GAPDHTCTCAAGGGCATTCTAGGCTACGCCGAATTCATTGTCGTACCAG151
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, T.; Lv, X.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Quan, K.; Li, Y.; Wang, S.; Sun, W. Effect of Sox18 on the Induction Ability of Dermal Papilla Cells in Hu Sheep. Biology 2023, 12, 65. https://doi.org/10.3390/biology12010065

AMA Style

Hu T, Lv X, Getachew T, Mwacharo JM, Haile A, Quan K, Li Y, Wang S, Sun W. Effect of Sox18 on the Induction Ability of Dermal Papilla Cells in Hu Sheep. Biology. 2023; 12(1):65. https://doi.org/10.3390/biology12010065

Chicago/Turabian Style

Hu, Tingyan, Xiaoyang Lv, Tesfaye Getachew, Joram M. Mwacharo, Aynalem Haile, Kai Quan, Yutao Li, Shanhe Wang, and Wei Sun. 2023. "Effect of Sox18 on the Induction Ability of Dermal Papilla Cells in Hu Sheep" Biology 12, no. 1: 65. https://doi.org/10.3390/biology12010065

APA Style

Hu, T., Lv, X., Getachew, T., Mwacharo, J. M., Haile, A., Quan, K., Li, Y., Wang, S., & Sun, W. (2023). Effect of Sox18 on the Induction Ability of Dermal Papilla Cells in Hu Sheep. Biology, 12(1), 65. https://doi.org/10.3390/biology12010065

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop