Effect of Long-Term Continuous Light Exposure and Western Diet on Adropin Expression, Lipid Metabolism, and Energy Homeostasis in Rats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Procedures
2.2. Indirect Calorimetry
2.3. Blood Sampling
2.4. Tissue Samples Preparation
2.5. Gene Expression Analysis
2.6. Hormones, Enzymes, and Substrates Measurements
2.7. Statistical Analysis
3. Results
3.1. Effects of Continuous Light Exposure
3.2. Effects of Western Diet Ingestion
3.3. Effects of Western Diet Added to Continuous Light Exposure
3.4. Circadian Rhythms of Plasma Adropin
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dauchy, R.T.; Dauchy, E.M.; Tirrell, R.P.; Hill, C.R.; Davidson, L.K.; Greene, M.W.; Tirrell, P.C.; Wu, J.; Sauer, L.A.; Blask, D.E. Dark-Phase Light Contamination Disrupts Circadian Rhythms in Plasma Measures of Endocrine Physiology and Metabolism in Rats. Comp. Med. 2010, 60, 348–356. [Google Scholar]
- Berson, D.M.; Dunn, F.A.; Takao, M. Phototransduction by retinal ganglion cells that set the circadian clock. Science 2002, 295, 1070–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fonken, L.K.; Nelson, R.J. The Effects of Light at Night on Circadian Clocks and Metabolism. Endocr. Rev. 2014, 35, 648–670. [Google Scholar] [CrossRef] [Scilit]
- Borniger, J.C.; Weil, Z.M.; Zhang, N.; Nelson, R.J. Dim light at night does not disrupt timing or quality of sleep in mice. Chronobiol. Int. 2013, 30, 1016–1023. [Google Scholar] [CrossRef] [Scilit]
- Kang, X.Z.; Jia, L.N.; Zhang, X.; Li, Y.M.; Chen, Y.; Shen, X.Y.; Wu, Y.C. Long-Term Continuous Light Exposure Affects Body Weight and Blood Glucose Associated with Inflammation in Female Rats. J. Biosci. Med. 2016, 4, 11–24. [Google Scholar] [CrossRef]
- Báez-Ruiz, A.; Guerrero-Vargas, N.N.; Cázarez-Márquez, F.; Sabath, E.; del Carmen Basualdo, M.; Salgado-Delgado, R.; Escobar, C.; Buijs, R.M. Food in synchrony with melatonin and corticosterone relieves constant light disturbed metabolism. J. Endocrinol. 2017, 235, 167–178. [Google Scholar] [CrossRef] [Scilit]
- Mustonen, A.-M.; Nieminen, P.; Hyvärinen, H. Effects of continuous light and melatonin treatment on energy metabolism of the rat. J. Endocrinol. Investig. 2002, 25, 716–723. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gale, J.E.; Cox, H.I.; Qian, J.; Block, G.D.; Colwell, C.S.; Matveyenko, A.V. Disruption of circadian rhythms accelerates development of diabetes through pancreatic beta-cell loss and dysfunction. J. Biol. Rhythm. 2011, 26, 423–433. [Google Scholar] [CrossRef] [Scilit]
- Qian, J.; Yeh, B.; Rakshit, K.; Colwell, C.S.; Matveyenko, A.V. Circadian disruption and diet-induced obesity synergize to promote development of β-cell failure and diabetes in male rats. Endocrinology 2015, 156, 4426–4436. [Google Scholar] [CrossRef] [Scilit]
- Rumanova, V.S.; Okuliarova, M.; Zeman, M. Differential Effects of Constant Light and Dim Light at Night on the Circadian Control of Metabolism and Behavior. Int. J. Mol. Sci. 2020, 21, 5478. [Google Scholar] [CrossRef] [Scilit]
- Fukuda, Y.; Morita, T. Effects of the light–dark cycle on diurnal rhythms of diet-induced thermogenesis in humans. Chronobiol. Int. 2017, 34, 1465–1472. [Google Scholar] [CrossRef] [Scilit]
- Kolben, Y.; Weksler-Zangen, S.; Ilan, Y. Adropin as a potential mediator of the metabolic system-autonomic nervous system-chronobiology axis: Implementing a personalized signature-based platform for chronotherapy. Obes. Rev. 2020, 22, e13108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yolbas, S.; Kara, M.; Kalayci, M.; Yildirim, A.; Gundogdu, B.; Aydin, S.; Koca, S.S. ENHO gene expression and serum adropin level in rheumatoid arthritis and systemic lupus erythematosus. Adv. Clin. Exp. Med. 2018, 27, 1637–1641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghoshal, S.; Stevens, J.R.; Billon, C.; Girardet, C.; Sitaula, S.; Leon, A.S.; Rao, D.C.; Skinner, J.S.; Rankinen, T.; Bouchard, C.; et al. Adropin: An endocrine link between the biological clock and cholesterol homeostasis. Mol. Metab. 2018, 8, 51–64. [Google Scholar] [CrossRef] [Scilit]
- Mazzoccoli, G.; Vinciguerra, M.; Oben, J.; Tarquini, R.; De Cosmo, S. Nonalcoholic fatty liver disease: The role of nuclear receptors and circadian rhythmicity. Liver Int. 2014, 34, 1133–1152. [Google Scholar] [CrossRef] [Scilit]
- Fang, B.; Everett, L.J.; Jager, J.; Briggs, E.; Armour, S.M.; Feng, D. Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo. Cell 2014, 159, 1140–1152. [Google Scholar] [CrossRef] [Scilit]
- Kojetin, D.J.; Burris, T.P. REV-ERB and ROR nuclear receptors as drug targets. Nat. Rev. Drug Discov. 2014, 13, 197–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lekkas, D.; Paschos, G.K. The circadian clock control of adipose tissue physiology and metabolism. Auton. Neurosci. 2019, 219, 66–70. [Google Scholar] [CrossRef] [Scilit]
- Collins, K.H.; Paul, H.A.; Hart, D.A.; Reimer, R.A.; Smith, L.C.; Rios, J.L.; Seerattan, R.A.; Herzog, W. A High-Fat High-Sucrose Diet Rapidly Alters Muscle Integrity, Inflammation and Gut Microbiota in Male Rats. Sci. Rep. 2016, 6, 37278. [Google Scholar] [CrossRef] [Scilit]
- Even, P.C.; Nadkarni, N.A. Indirect calorimetry in laboratory mice and rats: Principles, practical considerations, interpretation and perspectives. American Journal of Physiology. Regul. Integr. Comp. Physiol. 2012, 303, 459–476. [Google Scholar] [CrossRef] [Scilit]
- Abulmeaty, M.M.A.; Almajwal, A.M.; Alam, I.; Razak, S.; ElSadek, M.F.; Aljuraiban, G.S.; Hussein, K.S.; Malash, A.M. Relationship of Vitamin D-deficient Diet and Irisin, and Their Impact on Energy Homeostasis in Rats. Front. Physiol. 2020, 11, 25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, J.; Fitz, Y.; Li, Y.; Femandez, M.; Puch, I.C.; Wang, D.; Pazniokas, S.; Bucher, B.; Cui, X.; Solomon, S.B. Catheterization of the Carotid Artery and Jugular Vein to Perform Hemodynamic Measures, Infusions and Blood Sampling in a Conscious Rat Model. J. Vis. Exp. 2015, 95, e51881. [Google Scholar] [CrossRef] [Scilit]
- Ritschl, L.M.; Fichter, A.M.; Haberles, S.; Von-Bomhard, A.; Mitchell, D.A.; Wolff, K.D.; Mucke, T. Ketamine-Xylazine Anesthesia in Rats: Intraperitoneal versus Intravenous Administration Using a Microsurgical Femoral Vein Access. J. Reconstr. Microsurg. 2015, 31, 343–350. [Google Scholar] [CrossRef] [Scilit]
- Yamamoto, S.; Oshima, Y.; Saitou, T.; Watanabe, T.; Miyake, T.; Yoshida, O.; Tokumoto, Y.; Abe, M.; Matsuura, B.; Hiasa, Y.; et al. Quantitative imaging of fibrotic and morphological changes in liver of non-alcoholic steatohepatitis (NASH) model mice by second harmonic generation (SHG) and auto-fluorescence (AF) imaging using two-photon excitation microscopy (TPEM). Biochem. Biophys. Rep. 2016, 8, 277–283. [Google Scholar] [CrossRef] [Scilit]
- Gao, S.; McMillan, R.P.; Zhu, Q.; Lopaschuk, G.D.; Hulver, M.W.; Butler, A.A. Therapeutic effects of adropin on glucose tolerance and substrate utilization in diet-induced obese mice with insulin resistance. Mol. Metab. 2015, 4, 310–324. [Google Scholar] [CrossRef] [Scilit]
- Jing, J.-N.; Wu, Z.-T.; Li, M.-L.; Wang, Y.-K.; Tan, X.; Wang, W.-Z. Constant Light Exerted Detrimental Cardiovascular Effects Through Sympathetic Hyperactivity in Normal and Heart Failure Rats. Front. Neurosci. 2020, 14, 248. [Google Scholar] [CrossRef] [Scilit]
- Bartness, T.J.; Liu, Y.; Shrestha, Y.B.; Ryu, V. Neural innervation of white adipose tissue and the control of lipolysis. Front Neuroendocr. 2014, 35, 473–493. [Google Scholar] [CrossRef] [Scilit]
- Benca, R.; Duncan, M.J.; Frank, E.; McClung, C.; Nelson, R.J.; Vicentic, A. Biological rhythms, higher brain function, and behavior: Gaps, opportunities, and challenges. Brain Res. Rev. 2009, 62, 57–70. [Google Scholar] [CrossRef] [Scilit]
- Fung, T.T.; Hu, F.B.; Yu, J.; Chu, N.-F.; Spiegelman, D.; Tofler, G.H.; Willett, W.C.; Rimm, E.B. Leisure-Time Physical Activity, Television Watching, and Plasma Biomarkers of Obesity and Cardiovascular Disease Risk. Am. J. Epidemiol. 2000, 152, 1171–1178. [Google Scholar] [CrossRef] [Scilit]
- Fonken, L.K.; Meléndez-Fernández, O.H.; Weil, Z.M.; Nelson, R.J. Exercise attenuates the metabolic effects of dim light at night. Physiol. Behav. 2014, 124, 33–36. [Google Scholar] [CrossRef] [Scilit]
- Melanson, E.L.; Ritchie, H.K.; Dear, T.B.; Catenacci, V.; Shea, K.; Connick, E.; Moehlman, T.M.; Stothard, E.R.; Higgins, J.; McHill, A.W.; et al. Daytime bright light exposure, metabolism, and individual differences in wake and sleep energy expenditure during circadian entrainment and misalignment. Neurobiol. Sleep Circadian Rhythm. 2018, 4, 49–56. [Google Scholar] [CrossRef] [Scilit]
- Brainard, G.C.; Rollag, M.D.; Hanifin, J.P. Photic regulation of melatonin in humans: Ocular and neural signal transduction. J. Biol. Rhythm. 1997, 12, 537–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, W.P.; Cao, J.; Tian, M.; Cui, M.H.; Han, H.L.; Yang, Y.-X.; Xu, L. Exposure to chronic constant light impairs spatial memory and influences long-term depression in rats. Neurosci. Res. 2007, 59, 224–230. [Google Scholar] [CrossRef] [Scilit]
- Fonken, L.K.; Workman, J.L.; Walton, J.C.; Weil, Z.M.; Morris, J.S.; Haim, A.; Nelson, R.J. Light at night increases body mass by shifting the time of food intake. Proc. Natl. Acad. Sci. USA 2010, 107, 18664–18669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, R.; Kumar, S.; Ali, M.; Kumar, A.; Nath, A.; Lawrence, K.; Singh, J.K. Impact of stress on histology and biochemical parameters of liver and kidney of mice. Innov. J. Med. Health Sci. 2012, 2, 63–66. [Google Scholar]
- Prakash Babu, B.; Hemalatha, B.; Henry, T. Effect of stress induced by exposure to short and long term foot shock on liver, spleen and kidney in aged mice. J. Anat. Soc. India 2018, 67, 148–152. [Google Scholar] [CrossRef] [Scilit]
- Badin, P.M.; Louche, K.; Mairal, A.; Liebisch, G.; Schmitz, G.; Rustan, A.C.; Smith, S.R.; Langin, D.; Moro, C. Altered skeletal muscle lipase expression and activity contribute to insulin resistance in humans. Diabetes 2011, 60, 1734–1742. [Google Scholar] [CrossRef] [Scilit]
- Rasool, S.; Geetha, T.; Broderick, T.L.; Babu, J.R. High Fat with High Sucrose Diet Leads to Obesity and Induces Myodegeneration. Front. Physiol. 2018, 9, 1054. [Google Scholar] [CrossRef] [Scilit]
- Romestaing, C.; Piquet, M.A.; Bedu, E.; Rouleau, V.; Dautresme, M.; Hourmand-Ollivier, I.; Filippi, C.; Duchamp, C.; Sibille, B. Long term highly saturated fat diet does not induce NASH in Wistar rats. Nutr. Metab. 2007, 4, 4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Butler, A.A.; Tam, C.S.; Stanhope, K.L.; Wolfe, B.M.; Ali, M.R.; O’Keeffe, M.; St-Onge, M.-P.; Ravussin, E.; Havel, P.J. Low circulating adropin concentrations with obesity and aging correlate with risk factors for metabolic disease and increase after gastric bypass surgery in humans. J. Clin. Endocrinol. Metab. 2012, 97, 3783–3791. [Google Scholar] [CrossRef] [Scilit]
- Kumar, K.G.; Trevaskis, J.L.; Lam, D.D.; Sutton, G.M.; Koza, R.A.; Chouljenko, V.N.; Kousoulas, K.G.; Rogers, P.M.; Kesterson, R.A.; Thearle, M.; et al. Identification of Adropin as a Secreted Factor Linking Dietary Macronutrient Intake with Energy Homeostasis and Lipid Metabolism. Cell Metab. 2009, 8, 468–481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kutlu, O.; Altun, Ö.; Dikker, O.; Aktaş, Ş.; Özsoy, N.; Arman, Y.; Çil, E.Ö.; Özcan, M.; Yoldemir, Ş.A.; Akarsu, M.; et al. Serum Adropin Levels Are Reduced in Adult Patients with Nonalcoholic Fatty Liver Disease. Med. Princ. Pract. 2019, 28, 463–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saran, A.R.; Dave, S.; Zarrinpar, A. Circadian Rhythms in the Pathogenesis and Treatment of Fatty Liver Disease. Gastroenterology 2020, 158, 1948–1966. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Le Martelot, G.; Claudel, T.; Gatfield, D.; Schaad, O.; Kornmann, B.; Sasso, G.L.; Moschetta, A.; Schibler, U. REV-ERBα Participates in Circadian SREBP Signaling and Bile Acid Homeostasis. PLoS Biol. 2009, 7, e1000181. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Zhao, Z.; Xia, J.; Xin, L.; Chen, Y.; Yang, S.; Li, K. A Long-Term High-Fat/High-Sucrose Diet Promotes Kidney Lipid Deposition and Causes Apoptosis and Glomerular Hypertrophy in Bama Minipigs. PLoS ONE 2015, 10, e0142884. [Google Scholar] [CrossRef] [Scilit]
- Coomans, C.P.; van den Berg, S.A.A.; Houben, T.; van Klinken, J.-B.; van den Berg, R.; Pronk, A.C.M.; Havekes, L.M.; Romijn, J.A.; van Dijk, K.W.; Biermasz, N.R.; et al. Detrimental effects of constant light exposure and high-fat diet on circadian energy metabolism and insulin sensitivity. FASEB J. 2013, 27, 1721–1732. [Google Scholar] [CrossRef] [Scilit]
- Butler, A.A.; Zhang, J.; Price, C.A.; Stevens, J.R.; Graham, J.L.; Stanhope, K.L.; King, S.; Krauss, R.M.; Bremer, A.A.; Havel, P.J. Low plasma adropin concentrations increase risks of weight gain and metabolic dysregulation in response to a high-sugar diet in male nonhuman primates. J. Biol. Chem. 2019, 294, 9706–9719. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Reverse Primer | Forward Primer | Gene |
|---|---|---|
| R: 5TGGCTGTCCTGTCCACACAC 3′ | F: 5′ ACCGGGCTCAACTCAGGC 3′ | Enho (Adropin) |
| R: 5′GAGCGATCCGCTGACATCA 3′ | F: 5′ GCACCTGACCGAAGACGAAA 3′ | RAR-related orphan receptor alpha |
| R: 5′ TGCCATTGGAGCTGTCACTGTAG 3′ | F: 5′ GTGAAGACATGACGACCCTGGA 3′ | Rev-erb-α |
| R: 5′ GGGCAACATAGCACAGCTTCT 3′ | F: 5′ TGACCGAGCGTGGCTACAG 3′ | B-actine |
| Variables | NC Group Mean ± SD (n = 8) | CL Group Mean ± SD (n = 8) | WD Group Mean ± SD (n = 8) | CL + WD Group Mean ± SD (n = 8) | p-Value |
|---|---|---|---|---|---|
| Basal Weight (g) | 256.17 ± 7.88 a | 265.00 ± 27.07 a | 262.00 ± 22.24 a | 267.17 ± 25.27 a | 0.837 |
| Final Weight (g) | 360.00 ± 15.8 a | 343.83 ± 44.70 a | 357.00 ± 22.70 a | 335.33 ± 22.78 b | 0.426 |
| Adropin Level (ng/mL) | 21.39 ± 1.17 a | 33.04 ± 2.34 b | 18.81 ± 1.86 b | 17.67 ± 2.04 b | 0.000 |
| HSL Level (pg/mL) | 112.59 ± 9.57 a | 120.60 ± 6.92 a | 106.62 ± 13.5 a | 110.40 ± 12.42 a | 0.188 |
| ATGL (ng/mL) | 11.14 ± 1.62 a | 12.39 ± 2.20 a | 40.67 ± 1.85 b | 41.83 ± 1.56 b | 0.000 |
| FFA Level (ng/dL) | 562.12 ± 16.08 a | 490.51 ± 7.80 b | 654.04 ± 64.9 b | 439.68 ± 2.55 b | 0.000 |
| Variables | NC Group Mean ± SD (n = 8) | CL Group Mean ± SD (n = 8) | WD Group Mean ± SD (n = 8) | CL + WD Group Mean ± SD (n = 8) | p-Value |
|---|---|---|---|---|---|
| VO2 (ML/H/kg) | 1256.23 ± 112.52 a | 1397.65 ± 140.47 b | 1189.34 ± 52.58 a | 1454.18 ± 115.05 b | 0.002 |
| VO2 (ML/H/kg LBM) | 948.41 ± 83.40 a | 1065.50 ± 79.04 b | 919.55 ± 29.96 a | 1109.80 ± 78.75 b | 0.000 |
| VO2 (ML/H/RAT) | 409.16 ± 47.38 a | 474.60 ± 32.95 b | 425.54 ± 17.38 a | 494.56 ± 41.68 b | 0.002 |
| VCO2 (ML/H/kg) | 1112.74 ± 175.68 a | 1096.95 ± 140.75 a | 1009.06 ± 48.27 a | 979.59 ± 47.60 a | 0.231 |
| VCO2 (ML/H/kg LBM) | 840.16 ± 131.32 a | 815.99 ± 94.50 a | 780.21 ± 30.64 a | 747.87 ± 33.35 a | 0.274 |
| VCO2 (ML/H/RAT) | 362.60 ± 62.85 a | 363.89 ± 45.32 a | 361.15 ± 18.55 a | 333.71 ± 28.61 a | 0.563 |
| RQ | 0.88 ± 0.07 a | 0.76 ± 0.05 b | 0.85 ± 0.03 a | 0.67 ± 0.04 b | 0.000 |
| TEE (KCAL/H/kg) | 6.18 ± 0.63 a | 6.69 ± 0.70 a | 5.80 ± 0.25 a | 6.81 ± 0.50 a | 0.016 |
| TEE (KCAL/H/kg LBM) | 4.67 ± 0.47 a | 5.10 ± 0.40 b | 4.49 ± 0.14 a | 5.20 ± 0.34 b | 0.007 |
| TEE (KCAL/H/RAT) | 2.01 ± 0.25 a | 2.27 ± 0.18 b | 2.08 ± 0.08 a | 2.32 ± 0.19 b | 0.029 |
| Food Intake (G/RAT) | 49.50 ± 15.18 a | 24.17 ± 10.07 b | 22.58 ± 4.37 b | 15.51 ± 7.94 b | 0.000 |
| Water Intake (ML/kg/DAY) | 82.00 ± 4.00 | 84.17 ± 10.42 | 86.33 ± 7.10 | 86.2 ± 8.33 | 0.750 |
| Weight Gain (G) | 103.33 ± 21.68 a | 78.83 ± 34.02 a | 95.00 ± 33.80 a | 68.17 ± 31.54 a | 0.214 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abulmeaty, M.M.A.; Almajwal, A.M.; Alnumair, K.S.; Razak, S.; Hasan, M.M.; Fawzy, A.; Farraj, A.I.; Abudawood, M.; Aljuraiban, G.S. Effect of Long-Term Continuous Light Exposure and Western Diet on Adropin Expression, Lipid Metabolism, and Energy Homeostasis in Rats. Biology 2021, 10, 413. https://doi.org/10.3390/biology10050413
Abulmeaty MMA, Almajwal AM, Alnumair KS, Razak S, Hasan MM, Fawzy A, Farraj AI, Abudawood M, Aljuraiban GS. Effect of Long-Term Continuous Light Exposure and Western Diet on Adropin Expression, Lipid Metabolism, and Energy Homeostasis in Rats. Biology. 2021; 10(5):413. https://doi.org/10.3390/biology10050413
Chicago/Turabian StyleAbulmeaty, Mahmoud Mustafa Ali, Ali Madi Almajwal, Khalid S. Alnumair, Suhail Razak, Mai Mohammed Hasan, Amal Fawzy, Abdullah Ibrahim Farraj, Manal Abudawood, and Ghadeer S. Aljuraiban. 2021. "Effect of Long-Term Continuous Light Exposure and Western Diet on Adropin Expression, Lipid Metabolism, and Energy Homeostasis in Rats" Biology 10, no. 5: 413. https://doi.org/10.3390/biology10050413
APA StyleAbulmeaty, M. M. A., Almajwal, A. M., Alnumair, K. S., Razak, S., Hasan, M. M., Fawzy, A., Farraj, A. I., Abudawood, M., & Aljuraiban, G. S. (2021). Effect of Long-Term Continuous Light Exposure and Western Diet on Adropin Expression, Lipid Metabolism, and Energy Homeostasis in Rats. Biology, 10(5), 413. https://doi.org/10.3390/biology10050413

