Comparative Toxicological Evaluation of Tattoo Inks on Two Model Organisms
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Product
2.2. PR170 Characterization
2.3. Dynamic Light Scattering (DLS)
2.4. Quantitative Analysis of PR170
2.5. Animals
2.5.1. Xenopus laevis
2.5.2. Daphnia magna
2.6. PR170 Exposure
2.6.1. Xenopus laevis
2.6.2. Daphnia magna
2.7. Xenopus laevis Phenotype Analysis and Histology
2.8. Real-Time PCR Analysis
2.9. ROS Production and Antioxidant Activity Analysis
2.10. Statistical Analysis
3. Results
3.1. PR170 Had Nanoparticles Dimensions
3.2. PR170 Changes the Mortality Rate of Xenopus laevis Embryos and Daphnia magna Nauplii
3.3. PR170 Does Not Change the Growth Rate but Causes Anomalies and Tachycardia in Xenopus laevis Embryos
3.4. PR170 Modifies the Expression of Genes Involved in Early Embryonic Development and of Pro-Inflammatory Cytokines of X. laevis
3.5. PR170 Modify the Activity of ATP-binding Cassette in Daphnia magna and Xenopus laevis
3.6. PR170 Induces Oxidative Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Høgsberg, T.; Loeschner, K.; Löf, D.; Serup, J. Tattoo inks in general usage contain nanoparticles. Br. J. Dermatol. 2011, 165, 1210–1218. [Google Scholar] [CrossRef] [Scilit]
- Arl, M.; Nogueira, D.J.; Köerich, S.J.; Justino, M.N.; Vicentini, D.S.; Matias, G.W. Tattoo inks: Characterization and in vivo and in vitro toxicological evaluation. J. Hazard. Mater. 2019, 364, 548–561. [Google Scholar] [CrossRef] [Scilit]
- Piccinini, P.; Pakalin, S.; Contor, L.; Bianchi, I.; Senaldi, C. Safety of Tattoos and Permanent Make-Up: Final Report. EUR 27947; Publications Office of the European Union: Luxembourg, 2016; JRC101601. [Google Scholar]
- Schreiver, I.; Hesse, B.; Seim, C.; Castillo-Michel, H.; Anklamm, L.; Villanova, J.; Dreiack, N.; Lagrange, A.; Penning, R.; Cuyper, C.; et al. Distribution of nickel and chromium containing particles from tattoo needle wear in humans and its possible impact on allergic reactions. Part. Fibre Toxicol. 2016, 16, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Schreiver, I.; Luch, A. Tattooing: Overriding the skin barrier and the journey into the unknown. Arch. Toxicol. 2020, 94, 647–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bäumler, W. Chemical hazard of tattoo colorants. Presse Med. 2020, 49, 104046. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laux, P.; Tralau, T.; Tentschert, J.; Blume, A.; Al Dahouk, S.; Bäumler, W.; Bernstein, E.; Bocca, B.; Alimonti, A.; Colebrook, H.; et al. A medical-toxicological view of tattooing. Lancet 2016, 387, 395–402. [Google Scholar] [CrossRef] [Scilit]
- Engel, E.; Spannberger, A.; Vasold, R.; König, B.; Landthaler, M.; Bäumler, W. Photochemical cleavage of a tattoo pigment by UVB radiation or natural sunlight. J. Der Dtsch. Dermatol. 2007, 5, 583–589. [Google Scholar] [CrossRef] [Scilit]
- Cui, Y.; Spann, A.P.; Couch, L.H.; Gopee, N.V.; Evans, F.E.; Churchwell, M.I.; Williams, L.D.; Doerge, D.R.; Howard, P.C. Photodecomposition of Pigment Yellow 74, a pigment used in tattoo inks. Photochem. Photobiol. 2004, 80, 175–184. [Google Scholar] [CrossRef] [Scilit]
- Bäumler, W. Absorption, distribution, metabolism and excretion of tattoo colorants and ingredients in mouse and man: The known and the unknown. Curr. Probl. Dermatol. 2015, 48, 176–184. [Google Scholar] [PubMed]
- Vasold, R.; Naarmann, N.; Ulrich, H.; Fischer, D.; König, B.; Landthaler, M.; Bäumler, W. Tattoo pigments are cleaved by laser light-the chemical analysis in vitro provide evidence for hazardous compounds. Photochem. Photobiol. 2004, 80, 185–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, H.; Kumada, T.; Nakano, S.; Kiriyama, S.; Sone, Y.; Honda, T.; Watanabe, K.; Nakano, I.; Fukuda, Y.; Hayakawa, T. Liver dysfunction among workers handling 5-nitro-o-toluidine. Gut 2002, 50, 266–270. [Google Scholar] [CrossRef] [Scilit]
- Huang, Q.G.; Kong, L.R.; Liu, Y.B.; Wang, L.S. Relationships between molecular structure and chromosomal aberrations in in vitro human lymphocytes induced by substituted nitrobenzenes. Bull. Environ. Contam. Toxicol. 1996, 57, 349–353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Toxicology Program. NTP Toxicology and Carcinogenesis Studies of 1,4-Dichlorobenzene (CAS No. 106-46-7) in F344/N Rats and B6C3F1 Mice (Gavage Studies); National Toxicology Program Technical Report Series; National Toxicology Program: Research Triangle Park, NC, USA, 1987; Volume 319, pp. 1–198. [Google Scholar]
- Lo, H.H.; Brown, P.I.; Rankin, G.O. Acute nephrotoxicity induced by isomeric dichloroanilines in Fischer 344 rats. Toxicology 1990, 63, 215–231. [Google Scholar] [CrossRef] [Scilit]
- Soran, A.; Kanbour-Shakir, A.; Bas, O.; Bonaventura, M. A tattoo pigmented node and breast cancer. Bratisl. Lek. Listy 2014, 115, 311–312. [Google Scholar] [CrossRef] [Scilit]
- Balasubramanian, I.; Burke, J.P.; Condon, E. Painful, pigmented lymphadenopathy secondary to decorative tattooing. Am. J. Emerg. Med. 2013, 31, 1001. [Google Scholar] [CrossRef] [Scilit]
- Sepehri, M.; Sejersen, T.; Qvortrup, K.; Lerche, C.M.; Serup, J. Tattoo pigments are observed in the kupffer cells of the liver indicating blood-borne distribution of tattoo ink. Dermatology 2017, 233, 86–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Islam, P.S.; Chang, C.; Selmi, C.; Generali, E.; Huntley, A.; Teuber, S.S.; Gershwin, M.E. Medical complications of tattoos: A comprehensive review. Clin. Rev. Allergy Immunol. 2016, 50, 273–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gopee, N.V.; Cui, Y.; Olson, G.; Warbritton, A.R.; Miller, B.J.; Couch, L.H.; Wamer, W.G.; Howard, P.C. Response of mouse skin to tattooing: Use of SKH-1 mice as a surrogate model for human tattooing. Toxicol. Appl. Pharmacol. 2005, 209, 145–158. [Google Scholar] [CrossRef] [Scilit]
- Falconi, M.; Teti, G.; Zago, M.; Galanzi, A.; Breschi, L.; Pelotti, S.; Ruggeri, A.; Mazzotti, G. Influence of a commercial tattoo ink on protein production in human fibroblasts. Arch. Dermatol. Res. 2009, 301, 539–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Høgsberg, T.; Jacobsen, N.R.; Clausen, P.A.; Serup, J. Black tattoo inks induce reactive oxygen species production correlating with aggregation of pigment nanoparticles and product brand but not with the polycyclic aromatic hydrocarbon content. Exp. Dermatol. 2013, 22, 464–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tussellino, M.; Ronca, R.; Carotenuto, R.; Pallotta, M.M.; Furia, M.; Capriglione, T. Chlorpyrifos exposure affects fgf8, sox9, and bmp4 expression required for cranial neural crest morphogenesis and chondrogenesis in Xenopus laevis embryos. Environ. Mol. Mutagen. 2016, 57, 630–640. [Google Scholar] [CrossRef] [Scilit]
- Mouche, I.; Malésic, L.; Gillardeaux, O. FETAX assay for evaluation of developmental toxicity. Methods Mol. Biol. 2017, 1641, 311–324. [Google Scholar] [PubMed]
- Fort, D.J.; Mathis, M. Frog embryo teratogenesis assay-Xenopus (FETAX): Use in alternative preclinical safety assessment. Cold Spring Harb. Protoc. 2018, 8, pdb-prot098319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galdiero, E.; Carotenuto, R.; Siciliano, A.; Libralato, G.; Race, M.; Lofrano, G.; Fabbricino, M.; Guida, M. Cerium and erbium effects on Daphnia magna generations: A multiple endpoints approach. Environ. Pollut. 2019, 254, 112985. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bonfanti, P.; Colombo, A.; Camatini, M. Identification of multixenobiotic resistance mechanism in Xenopuslaevis embryos. Chemosphere 1995, 37, 2751–2760. [Google Scholar] [CrossRef] [Scilit]
- Castillo, G.; Shen, H.-J.; Horwitz, S.B. A homologue of the mammalian multidrug resistance gene (mdr) is functionally expressed in the intestine of Xenopuslaevis. BBA 1998, 1262, 113–123. [Google Scholar]
- Gallucci, N.; Vitiello, G.; di Girolamo, R.; Imbimbo, P.; Monti, D.M.; Tarallo, O.; Vergara, A.; Russo Krauss, I.; Paduano, L. Towards the development of antioxidant cerium oxide nanoparticles for biomedical application: Controlling the properties by tuning synthesis conditions. Nanomaterials 2021, 11, 542. [Google Scholar] [CrossRef] [Scilit]
- Perfetti, M.; Gallucci, N.; Russo Krauss, I.; Radulescu, A.; Pasini, S.; Holderer, O.; d’Errico, G.; Vitiello, G.; Bianchetti, G.O.; Paduano, L. Revealing the aggregation mechanism, structure, and internal dynamic of poly(vinyl alcohol) microgel prepared through liquid-liquid phase separation. Macromolecules 2020, 53, 852–861. [Google Scholar] [CrossRef] [Scilit]
- Luchini, A.; Irace, C.; Santamaria, R.; Montesarchio, D.; Heenan, R.K.; Sxekely, N.; Flori, A.; Menichetti, L.; Paduano, L. Phosphocholine-decorated superparamagnetic iron oxide nanoparticles:Defining the structure and probing in vivo applications. Nanoscale 2016, 8, 10078–10086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Porto, R.; De Tommaso, G.; Furia, E. The second acidic constant of salicylic acid. Annali di Chimica 2005, 95, 551–558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, J.; Miller, J.C. Statistics and Chemometrics for Analytical Chemistry, 4th ed.; Pearson Education: Harlow, UK, 2018; ISBN 0-131-29192-0. [Google Scholar]
- Salvatore, M.M.; Elvetico, A.; Gallo, M.; Salvatore, F.; DellaGreca, M.; Naviglio, D.; Andolfi, A. Fatty acids from Ganoderma lucidum spores: Extraction, identification and quantification. Appl. Sci. 2020, 10, 3907. [Google Scholar] [CrossRef] [Scilit]
- Carotenuto, R.; Capriello, T.; Cofone, R.; Galdiero, G.; Fogliano, C.; Ferrandino, I. Impact of copper in Xenopus laevis liver: Histological damages and atp7b downregulation. Ecotoxicol. Environ. Saf. 2020, 188, 109940. [Google Scholar] [CrossRef] [Scilit]
- Takagi, C.; Sakamaki, K.; Morita, H.; Hara, Y.; Suzuki, M.; Kinoshita, N.; Ueno, N. Transgenic Xenopus laevis for live imaging in cell and developmental biology. Dev. Growth Differ. 2013, 55, 422–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tandon, P.; Conlon, F.; Furlow, J.D.; Horb, M.E. Expanding the genetic toolkit in Xenopus: Approaches and opportunities for human disease modeling. Dev. Biol. 2017, 426, 325–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Session, A.M.; Uno, Y.; Kwon, T.; Chapman, J.A.; Toyoda, A.; Takahashi, S.; Fukui, A.; Hikosaka, A.; Suzuki, A.; Kondo, M.; et al. Genome evolution in the allotetraploid frog Xenopus laevis. Nature 2016, 538, 336–343. [Google Scholar] [CrossRef] [Scilit]
- Tussellino, M.; Ronca, R.; Formiggini, F.; de Marco, N.; Fusco, S.; Netti, P.A.; Carotenuto, R. Polystyrene nanoparticles affect Xenopus laevis development. J. Nanopart. Res. 2015, 17, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Nieuwkoop, P.D.; Faber, J. Normal Table of Xenopus laevis (Daudin): A Systematical and Chronologica Survey of the Development from the Fertilized Egg Till the End of Metamorphosis; Garland Science: New York, NY, USA, 1956. [Google Scholar]
- ISO. ISO Water Quality. Determination of the Inhibition of the Mobility of Daphnia magna Straus (Cladocera, Crustacea)—Acute Toxicity Test—ISO 6341; ISO: Geneva, Switzerland, 2012. [Google Scholar]
- Galdiero, E.; Siciliano, A.; Maselli, V.; Gesuele, R.; Guida, M.; Fulgione, D.; Galdiero, S.; Lombardi, L.; Falanga, A. An integrated study on antimicrobial activity and ecotoxicity of quantum dots and quantum dots coated with the antimicrobial peptide indolicidin. Int. J. Nanomed. 2016, 11, 4199–4211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carotenuto, R.; Tussellino, M.; Mettivier, G.; Russo, P. Survival fraction and phenotype alterations of Xenopus laevis embryos at 3 Gy, 150 kV X-ray irradiation. Biochem. Biophys. Res. Commun. 2016, 480, 580–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Campos, B.; Altenburger, R.; Gómez, C.; Lacorte, S.; Piña, B.; Barata, C.; Luckenbach, T. First evidence for toxic defense based on the multixenobiotic resistance (MXR) mechanism in Daphnia magna. Aquat. Toxicol. 2014, 148, 139–151. [Google Scholar] [CrossRef] [Scilit]
- Bacchetta, R.; Santo, N.; Fascio, U.; Moschini, E.; Freddi, S.; Chirico, G.; Camatini, M.; Mantecca, P. Nano-sized CuO, TiO2 and ZnO affect Xenopuslaevis development. Nanotoxicology 2012, 6, 381–398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heasman, J. Patterning the early Xenopus embryo. Development 2006, 133, 1205–1217. [Google Scholar] [CrossRef] [Scilit]
- Hong, C.S.; Park, B.Y.; Saint-Jeannet, J.P. Fgf8a induces neural crest indirectly through the activation of Wnt8 in the paraxial mesoderm. Development 2008, 135, 3903–3910. [Google Scholar] [CrossRef] [Scilit]
- Dorey, K.; Amaya, E. FGF signalling: Diverse roles during early vertebrate embryogenesis. Development 2010, 137, 3731–3742. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gawdzik, J.C.; Yue, M.S.; Martin, N.R.; Elemans, L.M.H.; Lanham, K.A.; Heideman, W.; Rezendes, R.; Baker, T.R.; Taylor, M.R.; Plavicki, J.S. Sox9b is required in cardiomyocytes for cardiac morphogenesis and function. Sci. Rep. 2018, 8, 13906. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.H.; Aoki, Y.; Hong, C.S.; Saint-Germain, N.; Credidio, C.; Saint-Jeannet, J.P. Early requirement of the transcriptional activator Sox9 for neural crest specification in Xenopus. Dev. Biol. 2004, 275, 93–103. [Google Scholar] [CrossRef] [Scilit]
- Ohkubo, Y.; Chiang, C.; Rubenstein, J.L. Coordinate regulation and synergistic actions of BMP4, SHH and FGF8 in the rostral prosencephalon regulate morphogenesis of the telencephalic and optic vesicles. Neuroscience 2002, 111, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Hirsch, N.; Harris, W.A. Xenopus Pax-6 and retinal development. J. Neurobiol. 1997, 32, 45–61. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.; Liu, C.; Yang, D.; Zhang, H.; Xi, Z. Comparative study of cytotoxicity, oxidative stress and genotoxicity induced by four typical nanomaterials: The role of particle size, shape and composition. J. Appl. Toxicol. 2009, 29, 69–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nations, S.; Long, M.; Wages, M.; Maul, J.D.; Theodorakis, C.W.; Cobb, G.P. Subchronic and chronic developmental effects of copper oxide (CuO) nanoparticles on Xenopus laevis. Chemosphere 2015, 135, 166–174. [Google Scholar] [CrossRef] [Scilit]
- Morgan, M.J.; Liu, Z.G. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011, 21, 103–115. [Google Scholar] [CrossRef] [Scilit]
- Gupta, S.C.; Tyagi, A.K.; Deshmukh-Taskar, P.; Hinojosa, M.; Prasad, S.; Aggarwal, B.B. Downregulation of tumor necrosis factor and other proinflammatory biomarkers by polyphenols. Arch. Biochem. Biophys. 2014, 559, 91–99. [Google Scholar] [CrossRef] [Scilit]
- Greten, F.R.; Arkan, M.C.; Bollrath, J.; Hsu, L.C.; Goode, J.; Miething, C.; Göktuna, S.I.; Neuenhahn, M.; Fierer, J.; Paxian, S.; et al. NF-kappaB is a negative regulator of IL-1β secretion as revealed by genetic and pharmacological inhibition of IL-1β. Cell 2007, 130, 918–931. [Google Scholar] [CrossRef] [Scilit]








| Gene Name | Oligo Forward Sequence | Oligo Reverse Sequence |
|---|---|---|
| bmp4—bone morphogenetic protein 4 | CCTCAGCAGCATTCCAGAGAA | TCCGGTGGAAACCCTCATCC |
| egr2—early growth response 2 | AGTAAGACCCCAGTCCACGA | GCAGTAATCGCAGGCAAAGG |
| fgf8—fibroblast growth factor 8 | CGTTTGGAAGCAGAGTTCGC | GTTGCCTTGTCTTCGACCCT |
| odc1—ornithine decarboxylase | GTGGCAAGGAATCACCCGAA | TCAAAGACACATCGTGCATC |
| pax6—paired box protein pax-6 | CAGAACATCTTTTACCCAGGA | GAATGTGGCTGGGTGTGTTA |
| rax1—retinal homeobox protein Rx1 | GGAAAGACCTCAAGCGAGTG | ATACCTGCACCCTGACCTCG |
| sox9—sex determining region Y-box 9 | ACGGCGCAGAAAGTCTGTTA | GACATCTGTCTTGGGGGTGG |
| ATPbc—ATP binding cassette, subfamily B member 1 | GGCTGTTGCTGAAGAGGTTC | ACCATACCAAAAGGCGAGTG |
| TNFa—tumor necrosis factor alfa | CAAGCAATGAAAGGGGAAAA | TGCAGTCAGGACCTGTGAAG |
| IL1B—interleukin 1 beta | TGTGCAGATAACCCATGGAA | TGCAGAGCAACAGAAGATGG |
| p65—Nf-kB transcription factor family | TGGCTATTGTCTTCCGAACC | ATATGGTGGGGGTCTCCTTC |
| β—actin daphnia | TTATGAAGGTTACGCCCTGC | GCTGTAACCGCTTCAGTCAA |
| abcb1- ATP Binding Cassette Subfamily B Member 1 | GTATCCAGTGCGGAAGTGGC | ACAGCGTATCGCTATTGCCC |
| abcc1/3—ATP Binding Cassette Subfamily C Member 1 | TAGCTCGCGCTCTACTGAGAA | GATCGTCGGTCTCCAGATCG |
| abcc4—ATP Binding Cassette Subfamily C Member 4 | CCCGATCCCTTTACGTCGAT | GGTGGCGTCCTACATGAGTGT |
| abcc5—ATP Binding Cassette Subfamily C Member 5 | CAGTCCAGTCATCGAGAACGG | TGACGCAACAGAGCTCGG |
| Nominal Concentration before Treatment (mg/L) | Concentration (from UV-Vis Analysis) before Treatment (mg/L) ± SD | Concentration (from UV-Vis Analysis) after Treatment (mg/L) ± SD | Uptake (%) |
|---|---|---|---|
| Xenopus laevis | |||
| 10.0 | 9.2 ± 0.2 | 4.1 ± 0.4 | 55.4 |
| 20.0 | 17.3 ± 0.3 | 2.1 ± 0.2 | 87.9 |
| Daphnia magna | |||
| 10.0 | 9.9 ± 0.4 | 8.1 ± 0.5 | 18.2 |
| 20.0 | 19.8 ± 0.3 | 15.2 ± 0.6 | 23.2 |
| Mortality | Malformations | ||||
|---|---|---|---|---|---|
| Utilized (n) | Dead (n) | Living (n) | Mortality (%) | n (%) | |
| Untreated | 135 | 40 | 95 | 29.63 b | 12 (12.63) b |
| 10 mg/L | 135 | 47 | 88 | 34.81 b | 18 (20.45) b |
| 20 mg/L | 135 | 64 | 71 | 47.41 a | 18 (25.35) b |
| 40 mg/L | 135 | 44 | 91 | 32.59 b | 21 (23.08) b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Carotenuto, R.; Fogliano, C.; Rienzi, M.; Siciliano, A.; Salvatore, M.M.; De Tommaso, G.; Benvenuto, G.; Galdiero, E.; Guida, M. Comparative Toxicological Evaluation of Tattoo Inks on Two Model Organisms. Biology 2021, 10, 1308. https://doi.org/10.3390/biology10121308
Carotenuto R, Fogliano C, Rienzi M, Siciliano A, Salvatore MM, De Tommaso G, Benvenuto G, Galdiero E, Guida M. Comparative Toxicological Evaluation of Tattoo Inks on Two Model Organisms. Biology. 2021; 10(12):1308. https://doi.org/10.3390/biology10121308
Chicago/Turabian StyleCarotenuto, Rosa, Chiara Fogliano, Mariangela Rienzi, Antonietta Siciliano, Maria Michela Salvatore, Gaetano De Tommaso, Giovanna Benvenuto, Emilia Galdiero, and Marco Guida. 2021. "Comparative Toxicological Evaluation of Tattoo Inks on Two Model Organisms" Biology 10, no. 12: 1308. https://doi.org/10.3390/biology10121308
APA StyleCarotenuto, R., Fogliano, C., Rienzi, M., Siciliano, A., Salvatore, M. M., De Tommaso, G., Benvenuto, G., Galdiero, E., & Guida, M. (2021). Comparative Toxicological Evaluation of Tattoo Inks on Two Model Organisms. Biology, 10(12), 1308. https://doi.org/10.3390/biology10121308

