Hybrid Surface Nanostructures Using Chemical Vapor Deposition and Colloidal Self-Assembled Patterns for Human Mesenchymal Stem Cell Culture—A Preliminary Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. CVD and GlyCVD Fabrication
2.2. BCC and the Hybrid Surface Fabrication
2.3. Surface Characterization
2.4. Cell Culture and Activity Test
2.5. Immunofluorescence Staining
2.6. Real-Time PCR
2.7. Statistical Analysis
3. Results and Discussion
3.1. New Hybrid CVD-BCC and GlyCVD-BCC Structures
3.2. Cell Morphology and Growth of hBMSCs on the Hybrid Structures
3.3. Gene Expression of hBMSCs on the Hybrid Nanostructures
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, F.M.; Liu, X.H. Advancing biomaterials of human origin for tissue engineering. Prog. Polym. Sci. 2016, 53, 86–168. [Google Scholar] [CrossRef] [Green Version]
- Bose, S.; Robertson, S.F.; Bandyopadhyay, A. Surface modification of biomaterials and biomedical devices using additive manufacturing. Acta Biomater. 2018, 66, 6–22. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.-Y.; Chang, C.-W.; Yuan, R.-H.; Chiang, Y.-C.; Chen, J.-T.; Kang, D.-Y.; Chen, H.-Y. Multifunctional nanoparticles with controllable dimensions and tripled orthogonal reactivity. Nanoscale 2017, 9, 14787–14791. [Google Scholar] [CrossRef] [PubMed]
- Tung, H.-Y.; Guan, Z.-Y.; Liu, T.-Y.; Chen, H.-Y. Vapor sublimation and deposition to build porous particles and composites. Nat. Commun. 2018, 9, 2564. [Google Scholar] [CrossRef]
- Alf, M.E.; Asatekin, A.; Barr, M.C.; Baxamusa, S.H.; Chelawat, H.; Ince, G.O.; Petruczok, C.D.; Sreenivasan, R.; Tenhaeff, W.; Trujillo, N.J.; et al. Chemical Vapor Deposition of Conformal, Functional, and Responsive Polymer Films. Adv. Mater. 2009, 22, 1993–2027. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Asatekin, A.; Gleason, K.K. Design of conformal, substrate-independent surface modification for controlled proteinadsorption by chemical vapor deposition (CVD). Soft Matter 2012, 8, 31–43. [Google Scholar] [CrossRef]
- Xu, H.; Akbari, M.K.; Zhuiykov, S. 2D Semiconductor Nanomaterials and Heterostructures: Controlled Synthesis and Functional Applications. Nanoscale Res. Lett. 2021, 16, 1–38. [Google Scholar] [CrossRef]
- Woo, H.-S.; Na, C.W.; Lee, J.-H. Design of Highly Selective Gas Sensors via Physicochemical Modification of Oxide Nanowires: Overview. Sensors 2016, 16, 1531. [Google Scholar] [CrossRef]
- Gorham, W.F. A New, General Synthetic Method for the Preparation of Linear Poly-p-xylylenes. J. Polym. Sci. Part A-1 Polym. Chem. 1966, 4, 3027–3039. [Google Scholar] [CrossRef]
- Moss, T.; Greiner, A. Functionalization of Poly(para-xylylene)s—Opportunities and Challenges as Coating Material. Adv. Mater. Interfaces 2020, 7, 1901858. [Google Scholar] [CrossRef]
- Lahann, J. Vapor-based polymer coatings for potential biomedical applications. Polym. Int. 2006, 55, 1361–1370. [Google Scholar] [CrossRef] [Green Version]
- Chen, P.-R.; Wang, T.-C.; Chen, S.-T.; Chen, H.-Y.; Tsai, W.-B. Development of Antifouling Hyperbranched Polyglycerol Layers on Hydroxyl Poly-p-xylylene Coatings. Langmuir 2017, 33, 14657–14662. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.-Y. Micro- and nano-surface structures based on vapor-deposited polymers. Beilstein J. Nanotechnol. 2017, 8, 1366–1374. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, P.-Y.; Pingle, H.; Koegler, P.; Thissen, H.; Kingshott, P. Self-assembled binary colloidal crystal monolayers as cell culture substrates. J. Mater. Chem. B 2015, 3, 2545–2552. [Google Scholar] [CrossRef] [PubMed]
- Diba, F.S.; Boden, A.; Thissen, H.; Bhave, M.; Kingshott, P.; Wang, P.-Y. Binary colloidal crystals (BCCs): Interactions, fabrication, and applications. Adv. Colloid Interface Sci. 2018, 261, 102–127. [Google Scholar] [CrossRef]
- Shi, Y.; Lin, J.; Tao, X.; Qu, J.; Liao, S.; Li, M.; Deng, K.; Du, P.; Liu, K.; Thissen, H.; et al. Harnessing Colloidal Self-Assembled Patterns (cSAPs) to Regulate Bacterial and Human Stem Cell Response at Biointerfaces In Vitro and In Vivo. ACS Appl. Mater. Interfaces 2021, 13, 20982–20994. [Google Scholar] [CrossRef]
- Cui, C.; Wang, J.; Qian, D.; Huang, J.; Lin, J.; Kingshott, P.; Wang, P.-Y.; Chen, M. Binary Colloidal Crystals Drive Spheroid Formation and Accelerate Maturation of Human-Induced Pluripotent Stem Cell-Derived Cardiomyocytes. ACS Appl. Mater. Interfaces 2019, 11, 3679–3689. [Google Scholar] [CrossRef]
- Diba, F.S.; Reynolds, N.; Thissen, H.; Wang, P.; Kingshott, P. Tunable Chemical and Topographic Patterns Based on Binary Colloidal Crystals (BCCs) to Modulate MG63 Cell Growth. Adv. Funct. Mater. 2019, 29, 1904262. [Google Scholar] [CrossRef]
- Boden, A.; Bhave, M.; Wang, P.-Y.; Jadhav, S.R.; Kingshott, P. Binary Colloidal Crystal Layers as Platforms for Surface Patterning of Puroindoline-Based Antimicrobial Peptides. ACS Appl. Mater. Interfaces 2018, 10, 2264–2274. [Google Scholar] [CrossRef]
- Pingle, H.; Wang, P.; Thissen, H.; Kingshott, P. Controlled Attachment of Pseudomonas aeruginosa with Binary Colloidal Crystal-Based Topographies. Small 2018, 14, e1703574. [Google Scholar] [CrossRef]
- Deng, K.; Du, P.; Liu, K.; Tao, X.; Harati, J.; Jhang, J.-W.; Kim, J.; Wang, P.-Y. Programming Colloidal Self-Assembled Patterns (cSAPs) into Thermo-Responsible Hybrid Surfaces for Controlling Human Stem Cells and Macrophages. ACS Appl. Mater. Interfaces 2021, 13, 18563–18580. [Google Scholar] [CrossRef]
- Wang, P.-Y.; Thissen, H.; Kingshott, P. Stimulation of Early Osteochondral Differentiation of Human Mesenchymal Stem Cells Using Binary Colloidal Crystals (BCCs). ACS Appl. Mater. Interfaces 2016, 8, 4477–4488. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.-Y.; Hung, S.S.-C.; Thissen, H.; Kingshott, P.; Wong, R.C.-B. Binary colloidal crystals (BCCs) as a feeder-free system to generate human induced pluripotent stem cells (hiPSCs). Sci. Rep. 2016, 6, 36845. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiang, Y.-C.; Ho, C.-P.; Wang, Y.-L.; Chen, P.-C.; Wang, P.-Y.; Chen, H.-Y. Vapor-Deposited Reactive Coating with Chemically and Topographically Erasable Properties. Polym. 2019, 11, 1595. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lm, S.J.; Kim, D.; Kim, Y.; Jeong, S.; Pang, C.; Ryu, S.; Weon, B.M. Hydrophobicity Evolution on Rough Surfaces. Langmuir 2020, 36, 689–696. [Google Scholar] [CrossRef]
- Niu, Y.; Yu, M.; Meka, A.; Liu, Y.; Zhang, J.; Yang, Y.; Yu, C. Understanding the contribution of surface roughness and hydrophobic modification of silica nanoparticles to enhanced therapeutic protein delivery. J. Mater. Chem. B 2016, 4, 212–219. [Google Scholar] [CrossRef]
- Tung, H.-Y.; Sun, T.-P.; Sun, H.-Y.; Guan, Z.-Y.; Hu, S.-K.; Chao, L.; Chen, H.-Y. Construction and control of 3D porous structure based on vapor deposition on sublimation solids. Appl. Mater. Today 2017, 7, 77–81. [Google Scholar] [CrossRef]
- Chiu, Y.-R.; Hsu, Y.-T.; Wu, C.-Y.; Lin, T.-H.; Yang, Y.-Z.; Chen, H.-Y. Fabrication of Asymmetrical and Gradient Hierarchy Structures of Poly-p-xylylenes on Multiscale Regimes Based on a Vapor-Phase Sublimation and Deposition Process. Chem. Mater. 2020, 32, 1120–1130. [Google Scholar] [CrossRef]
- Zhong, Y.; Meng, F.; Deng, C.; Zhong, Z. Ligand-Directed Active Tumor-Targeting Polymeric Nanoparticles for Cancer Chemotherapy. Biomacromolecules 2014, 15, 1955–1969. [Google Scholar] [CrossRef]
- Wang, P.-Y.; Clements, L.R.; Thissen, H.; Jane, A.; Tsai, W.-B.; Voelcker, N.H. Screening Mesenchymal Stem Cell Attachment and Differentiation on Porous Silicon Gradients. Adv. Funct. Mater. 2012, 22, 3414–3423. [Google Scholar] [CrossRef]
- Wang, P.-Y.; Thissen, H.; Kingshott, P. Modulation of human multipotent and pluripotent stem cells using surface nanotopographies and surface-immobilised bioactive signals: A review. Acta Biomater. 2016, 45, 31–59. [Google Scholar] [CrossRef] [PubMed]
- Dalby, M.J.; Gadegaard, N.; Oreffo, R.O.C. Harnessing nanotopography and integrin–matrix interactions to influence stem cell fate. Nat. Mater. 2014, 13, 558–569. [Google Scholar] [CrossRef] [PubMed]
- Olsen, L.A.; Nicoll, J.; Fry, A.C. The skeletal muscle fiber: A mechanically sensitive cell. Graefe’s Archive for Clinical and Experimental Ophthalmology 2019, 119, 333–349. [Google Scholar] [CrossRef]
- Fruleux, A.; Hawkins, R.J. Physical role for the nucleus in cell migration. J. Phys. Condens. Matter 2016, 28, 363002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, R.; Yan, Q.; Kingshott, P.; Tsai, W.-B.; Wang, P.-Y. Harnessing the perinuclear actin cap (pnAC) to influence nanocarrier trafficking and gene transfection efficiency in skeletal myoblasts using nanopillars. Acta Biomater. 2020, 111, 221–231. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.-C.; Liu, Y.-C.; Shen, C.-N.; Chang, Y.-C.; Tsai, H. Promoting the Selection and Maintenance of Fetal Liver Stem/Progenitor Cell Colonies by Layer-by-Layer Polypeptide Tethered Supported Lipid Bilayer. ACS Appl. Mater. Interfaces 2014, 6, 20654–20663. [Google Scholar] [CrossRef]
- Dufour, S.; Mege, R.M.; Thiery, J.P. Alpha-Catenin, Vinculin, and F-Actin in Strengthening E-Cadherin Cell-Cell Adhesions and Mechanosensing. Cell Adh. Migr. 2013, 7, 345–350. [Google Scholar] [CrossRef] [Green Version]
- Biggs, M.J.P.; Richards, R.G.; Dalby, M.J. Nanotopographical modification: A regulator of cellular function through focal adhesions. Nanomed. Nanotechnol. Biol. Med. 2010, 6, 619–633. [Google Scholar] [CrossRef] [Green Version]
- Kolind, K.; Dolatshahi-Pirouz, A.; Lovmand, J.; Pedersen, F.S.; Foss, M.; Besenbacher, F. A combinatorial screening of human fibroblast responses on micro-structured surfaces. Biomaterials 2010, 31, 9182–9191. [Google Scholar] [CrossRef]
- Nematollahi, M.; Hamilton, D.; Jaeger, N.; Brunette, D. Hexagonal micron scale pillars influence epithelial cell adhesion, morphology, proliferation, migration, and cytoskeletal arrangement. J. Biomed. Mater. Res. Part A 2009, 91A, 149–157. [Google Scholar] [CrossRef]
- Deng, Y.; Tan, X.-T.; Wu, Q.; Wang, X. Correlations BetweenCOL2AandAggrecanGenetic Polymorphisms and the Risk and Clinicopathological Features of Intervertebral Disc Degeneration in a Chinese Han Population: A Case–Control Study. Genet. Test. Mol. Biomark. 2017, 21, 108–115. [Google Scholar] [CrossRef] [PubMed]
- Jokoji, G.; Maeda, S.; Oishi, K.; Ijuin, T.; Nakajima, M.; Tawaratsumida, H.; Kawamura, I.; Tominaga, H.; Taketomi, E.; Ikegawa, S.; et al. Cdc5l Promotes Early Chondrocyte Differentiation and Proliferation by Modulating Pre-Mrna Splicing of Sox9, Col2a1, and Wee1. J. Biol. Chem. 2021, 297, 100994. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Stockl, S.; Lukas, C.; Gotz, J.; Herrmann, M.; Federlin, M.; Grassel, S. Hbmsc-Derived Extracellular Vesicles Attenuate Il-1beta-Induced Catabolic Effects on Oa-Chondrocytes by Regulating Pro-Inflammatory Signaling Pathways. Front. Bioeng. Biotechnol. 2020, 8, 603598. [Google Scholar] [CrossRef] [PubMed]
- Weng, J.-J.; Su, Y. Nuclear matrix-targeting of the osteogenic factor Runx2 is essential for its recognition and activation of the alkaline phosphatase gene. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2012, 1830, 2839–2852. [Google Scholar] [CrossRef] [PubMed]
- Arufe, M.; De la Fuente, A.; Fuentes-Boquete, I.; De Toro, F.J.; Blanco, F.J. Differentiation of synovial CD-105+human mesenchymal stem cells into chondrocyte-like cells through spheroid formation. J. Cell. Biochem. 2009, 108, 145–155. [Google Scholar] [CrossRef] [Green Version]
- Mennan, C.; García, J.; McCarthy, H.; Owen, S.; Perry, J.; Wright, K.; Banerjee, R.; Richardson, J.B.; Roberts, S. Human Articular Chondrocytes Retain Their Phenotype in Sustained Hypoxia While Normoxia Promotes Their Immunomodulatory Potential. Cartil. 2018, 10, 467–479. [Google Scholar] [CrossRef] [Green Version]
- Du, P.; Tao, X.; Liu, K.; Lin, J.; Shi, Y.; Park, K.; Chen, H.-Y.; Lin, C.-P.; Chang, J.; Wong, R.C.; et al. Human platelet lysate (hPL) alters the lineage commitment and paracrine functions of human mesenchymal stem cells via mitochondrial metabolism. Appl. Mater. Today 2021, 26, 101264. [Google Scholar] [CrossRef]
- Le, H.T.-N.; Ngoc, B.V.; Phuc, D.-N.N.; Thuy, T.-T.D.; Xuan, H.-V.T.; Phuc, V.P. Production of Engineered Cartilage from Mesenchymal Stem Cell Spheroids. Front. Biosci.-Landmark 2021, 26, 266–285. [Google Scholar]
- Soteriou, D.; Iskender, B.; Byron, A.; Humphries, J.D.; Borg-Bartolo, S.; Haddock, M.-C.; Baxter, M.A.; Knight, D.; Humphries, M.J.; Kimber, S.J. Comparative Proteomic Analysis of Supportive and Unsupportive Extracellular Matrix Substrates for Human Embryonic Stem Cell Maintenance. J. Biol. Chem. 2013, 288, 18716–18731. [Google Scholar] [CrossRef] [Green Version]
- Tan, Q.; Lui, P.P.Y.; Rui, Y.F. Effect of In Vitro Passaging on the Stem Cell-Related Properties of Tendon-Derived Stem Cells—Implications in Tissue Engineering. Stem Cells Dev. 2012, 21, 790–800. [Google Scholar] [CrossRef] [Green Version]
- Saha, S.; Ghosh, P.; Mitra, D.; Mukherjee, S.; Bhattacharya, S.; Roy, S. Localization and Thyroid Hormone Influenced Expression of Collagen II in Ovarian Tissue. Cell. Physiol. Biochem. 2007, 19, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Llontop, P.; Santana-Rodríguez, N.; Clavo, B.; Quintana, A.; Fiuza, M.D.; Camacho, R.; Santana-Rodríguez, A.; Santana, C.; Ruíz-Caballero, J.A. Stem Cells Protect the Bronchial Stump in Rat, Increasing Sox6, Col2a1, and Agc1 Expression. Lung 2014, 192, 441–448. [Google Scholar] [CrossRef] [PubMed]
- Horton, E.R.; Vallmajo-Martin, Q.; Martin, I.; Snedeker, J.; Ehrbar, M.; Blache, U. Extracellular Matrix Production by Mesenchymal Stromal Cells in Hydrogels Facilitates Cell Spreading and Is Inhibited by FGF-2. Adv. Healthc. Mater. 2020, 9, e1901669. [Google Scholar] [CrossRef] [PubMed]
- Ding, S.; Kingshott, P.; Thissen, H.; Pera, M.; Wang, P.-Y. Modulation of human mesenchymal and pluripotent stem cell behavior using biophysical and biochemical cues: A review. Biotechnol. Bioeng. 2017, 114, 260–280. [Google Scholar] [CrossRef]
- Zhang, H.; Zheng, X.; Ahmed, W.; Yao, Y.; Bai, J.; Chen, Y.; Gao, C. Design and Applications of Cell-Selective Surfaces and Interfaces. Biomacromolecules 2018, 19, 1746–1763. [Google Scholar] [CrossRef] [PubMed]
- Karimi, F.; O’Connor, A.J.; Qiao, G.G.; Heath, D.E. Integrin Clustering Matters: A Review of Biomaterials Functionalized with Multivalent Integrin-Binding Ligands to Improve Cell Adhesion, Migration, Differentiation, Angiogenesis, and Biomedical Device Integration. Adv. Healthc. Mater. 2018, 7, e1701324. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Liu, K.; Zhang, Z.; Tao, X.; Chen, H.-Y.; Kingshott, P.; Wang, P.-Y. Decoration of Material Surfaces with Complex Physicochemical Signals for Biointerface Applications. ACS Biomater. Sci. Eng. 2020, 6, 1836–1851. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
ALP | 5′- CCACGTCTTCACATTTGGTG -3′ | 5′- CAGACTGCGCCTGGTAGTTG -3′ |
RUNX2 | 5′- TGCACTGGGTCATGTGTTTG -3′ | 5′- TGGCTGCATTGAAAAGACTG -3′ |
COL2A1 | 5′- AAGGCTCCCAGAACATCACC -3′ | 5′- ATCCTTCAGGGCAGTGTACG -3′ |
ACAN | 5′- TCTGTAACCCAGGCTCCAAC -3′ | 5′- TGGAGTACCTGGTGGCTCTC -3′ |
PPARG | 5′- AGCCTCATGAAGAGCCTTCCA -3′ | 5′- TCCGGAAGAAACCCTTGCA -3′ |
CIDEC | 5′- CAGCAGCTCCTCGATGCTAC -3′ | 5′- TCAGACAGGTCGGGATAAGGG -3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.-C.; Jhang, J.-W.; Liu, K.; Pan, H.; Chen, H.-Y.; Wang, P.-Y. Hybrid Surface Nanostructures Using Chemical Vapor Deposition and Colloidal Self-Assembled Patterns for Human Mesenchymal Stem Cell Culture—A Preliminary Study. Coatings 2022, 12, 311. https://doi.org/10.3390/coatings12030311
Liu Y-C, Jhang J-W, Liu K, Pan H, Chen H-Y, Wang P-Y. Hybrid Surface Nanostructures Using Chemical Vapor Deposition and Colloidal Self-Assembled Patterns for Human Mesenchymal Stem Cell Culture—A Preliminary Study. Coatings. 2022; 12(3):311. https://doi.org/10.3390/coatings12030311
Chicago/Turabian StyleLiu, Yung-Chiang, Jhe-Wei Jhang, Kun Liu, Haobo Pan, Hsien-Yeh Chen, and Peng-Yuan Wang. 2022. "Hybrid Surface Nanostructures Using Chemical Vapor Deposition and Colloidal Self-Assembled Patterns for Human Mesenchymal Stem Cell Culture—A Preliminary Study" Coatings 12, no. 3: 311. https://doi.org/10.3390/coatings12030311