Quinolone Resistance Genes and Their Contribution to Resistance in Vibrio cholerae Serogroup O139
Abstract
1. Introduction
2. Results
2.1. Prevalence of Quinolone Resistance Related Genes
2.2. Characterization of Plasmids Containing qnrVC9
2.3. Effect of qnrVC on Quinolone Resistance
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains
4.2. Antibiotic Susceptibility Testing
4.3. PCR and DNA Sequencing
4.4. Plasmid Extraction, Electroporation and Sequencing
4.5. Cloning and Expression of qnrVC
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lippi, D.; Gotuzzo, E.; Caini, S. Cholera. Microbiol. Spectr. 2016, 4, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Ali, M.; Lopez, A.L.; You, Y.A.; Kim, Y.E.; Sah, B.; Maskery, B.; Clemens, J. The global burden of cholera. Bull. World Health Organ. 2012, 90, 209–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, M.; Xu, J.; Ding, Y.; Wang, R.; Liu, P.; Kan, B.; Qi, G.; Liu, Y.; Gao, S. Molecular epidemiology of Vibrio cholerae O139 in China: Polymorphism of ribotypes and CTX elements. J. Clin. Microbiol. 2003, 41, 2306–2310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, L.; Zhou, Y.; Wang, R.; Lou, J.; Zhang, L.; Li, J.; Bi, Z.; Kan, B. Multiple antibiotic resistance of Vibrio cholerae serogroup O139 in China from 1993 to 2009. PLoS ONE 2012, 7, e38633. [Google Scholar] [CrossRef] [Scilit]
- Dutta, D.; Kaushik, A.; Kumar, D.; Bag, S. Foodborne Pathogenic Vibrios: Antimicrobial Resistance. Front. Microbiol. 2021, 12, 638331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piarroux, R.; Rebaudet, S. Cholera. Rev. Prat. 2017, 67, 1117–1121. [Google Scholar]
- Pham, T.D.M.; Ziora, Z.M.; Blaskovich, M.A.T. Quinolone antibiotics. Med. Chem. Comm. 2019, 10, 1719–1739. [Google Scholar] [CrossRef] [Scilit]
- Cabello, F.C. Heavy use of prophylactic antibiotics in aquaculture: A growing problem for human and animal health and for the environment. Environ. Microbiol. 2006, 8, 1137–1144. [Google Scholar] [CrossRef] [Scilit]
- Hooper, D.C.; Jacoby, G.A. Mechanisms of drug resistance: Quinolone resistance. Ann. N. Y. Acad. Sci. 2015, 1354, 12–31. [Google Scholar] [CrossRef] [Scilit]
- Robicsek, A.; Strahilevitz, J.; Jacoby, G.A.; Macielag, M.; Abbanat, D.; Park, C.H.; Bush, K.; Hooper, D.C. Fluoroquinolone-modifying enzyme: A new adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 2006, 12, 83–88. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Yu, L.; Li, J.; Zhang, L.; Tong, Y.; Kan, B. Accumulation of mutations in DNA gyrase and topoisomerase IV genes contributes to fluoroquinolone resistance in Vibrio cholerae O139 strains. Int. J. Antimicrob. Agents 2013, 42, 72–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vinothkumar, K.; Kumar, G.N.; Bhardwaj, A.K. Characterization of Vibrio fluvialis qnrVC5 Gene in Native and Heterologous Hosts: Synergy of qnrVC5 with other Determinants in Conferring Quinolone Resistance. Front. Microbiol. 2016, 7, 146. [Google Scholar] [CrossRef] [Scilit]
- Martinez-Martinez, L.; Pascual, A.; Jacoby, G.A. Quinolone resistance from a transferable plasmid. Lancet 1998, 351, 797–799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miranda, C.D.; Concha, C.; Godoy, F.A.; Lee, M.R. Aquatic Environments as Hotspots of Transferable Low-Level Quinolone Resistance and Their Potential Contribution to High-Level Quinolone Resistance. Antibiotics 2022, 11, 1487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fonseca, E.L.; Dos Santos Freitas, F.; Vieira, V.V.; Vicente, A.C. New qnr gene cassettes associated with superintegron repeats in Vibrio cholerae O1. Emerg. Infect. Dis. 2008, 14, 1129–1131. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.B.; Park, C.H.; Kim, C.J.; Kim, E.C.; Jacoby, G.A.; Hooper, D.C. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob. Agents Chemother. 2009, 53, 639–645. [Google Scholar] [CrossRef] [Scilit]
- Cavaco, L.M.; Hasman, H.; Xia, S.; Aarestrup, F.M. qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin. Antimicrob. Agents Chemother. 2009, 53, 603–608. [Google Scholar] [CrossRef] [Scilit]
- Albornoz, E.; Tijet, N.; De Belder, D.; Gomez, S.; Martino, F.; Corso, A.; Melano, R.G.; Petroni, A. qnrE1, a Member of a New Family of Plasmid-Located Quinolone Resistance Genes, Originated from the Chromosome of Enterobacter Species. Antimicrob. Agents Chemother. 2017, 61, e02555-16. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Zheng, Z.; Chan, E.W.; Dong, N.; Xia, X.; Chen, S. Molecular Characterization of qnrVCGenes Their Novel Alleles in Vibrio spp Isolated from Food Products in China. Antimicrob. Agents Chemother. 2018, 62, e00529-18. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Wong, M.H.; Chen, S. Molecular characterisation of a multidrug resistance conjugative plasmid from Vibrio parahaemolyticus. Int. J. Antimicrob. Agents 2013, 42, 575–579. [Google Scholar] [CrossRef] [Scilit]
- Rajpara, N.; Patel, A.; Tiwari, N.; Bahuguna, J.; Antony, A.; Choudhury, I.; Ghosh, A.; Jain, R.; Ghosh, A.; Bhardwaj, A.K. Mechanism of drug resistance in a clinical isolate of Vibrio fluvialis: Involvement of multiple plasmids and integrons. Int. J. Antimicrob. Agents 2009, 34, 220–225. [Google Scholar] [CrossRef] [Scilit]
- Pons, M.J.; Gomes, C.; Ruiz, J. QnrVC, a new transferable Qnr-like family. Enferm. Infecc. Y Microbiol. Clin. 2013, 31, 191–192. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, E.L.; Vicente, A.C.P. Epidemiology of qnrVC alleles and emergence out of the Vibrionaceae family. J. Med. Microbiol. 2013, 62, 1628–1630. [Google Scholar] [CrossRef] [Scilit]
- Kraychete, G.B.; Botelho, L.A.B.; Monteiro-Dias, P.V.; de Araujo, W.J.; Oliveira, C.J.B.; Carvalho-Assef, A.P.D.; Albano, R.M.; Picao, R.C.; Bonelli, R.R. qnrVC occurs in different genetic contexts in Klebsiella and Enterobacter strains isolated from Brazilian coastal waters. J. Glob. Antimicrob. Resist. 2022, 31, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Nabilou, M.; Babaeekhou, L.; Ghane, M. Fluoroquinolone resistance contributing mechanisms and genotypes of ciprofloxacin- unsusceptible Pseudomonas aeruginosa strains in Iran: Emergence of isolates carrying qnr/aac(6)-Ib genes. International microbiology. Off. J. Span. Soc. Microbiol. 2022, 25, 405–415. [Google Scholar]
- Deku, J.G.; Duedu, K.O.; Ativi, E.; Kpene, G.E.; Feglo, P.K. Burden of Fluoroquinolone Resistance in Clinical Isolates of Escherichia coli at the Ho Teaching Hospital, Ghana. Ethiop. J. Health Sci. 2022, 32, 93–102. [Google Scholar] [PubMed]
- Redgrave, L.S.; Sutton, S.B.; Webber, M.A.; Piddock, L.J. Fluoroquinolone resistance: Mechanisms, impact on bacteria, and role in evolutionary success. Trends Microbiol. 2014, 22, 438–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tran, J.H.; Jacoby, G.A.; Hooper, D.C. Interaction of the plasmid-encoded quinolone resistance protein QnrA with Escherichia coli topoisomerase IV. Antimicrob. Agents Chemother. 2005, 49, 3050–3052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.B.; Wang, M.; Ahmed, S.; Park, C.H.; LaRocque, R.C.; Faruque, A.S.; Salam, M.A.; Khan, W.A.; Qadri, F.; Calderwood, S.B.; et al. Transferable quinolone resistance in Vibrio cholerae. Antimicrob. Agents Chemother. 2010, 54, 799–803. [Google Scholar] [CrossRef] [Scilit]
- Kotb, D.N.; Mahdy, W.K.; Mahmoud, M.S.; Khairy, R.M.M. Impact of co-existence of PMQR genes and QRDR mutations on fluoroquinolones resistance in Enterobacteriaceae strains isolated from community and hospital acquired UTIs. BMC Infect. Dis. 2019, 19, 979. [Google Scholar] [CrossRef] [Scilit]
- Nohejl, T.; Valcek, A.; Papousek, I.; Palkovicova, J.; Wailan, A.M.; Pratova, H.; Minoia, M.; Dolejska, M. Genomic analysis of qnr-harbouring IncX plasmids and their transferability within different hosts under induced stress. BMC Microbiol. 2022, 22, 136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Doorslaer, X.; Dewulf, J.; Van Langenhove, H.; Demeestere, K. Fluoroquinolone antibiotics: An emerging class of environmental micropollutants. Sci. Total Environ. 2014, 500–501, 250–269. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, M.; Achmon, Y.; Cao, Y.; Liang, X.; Chen, L.; Wang, H.; Siame, B.A.; Leung, K.Y. Distribution of antibiotic resistance genes in the environment. Environ. Pollut. 2021, 285, 117402. [Google Scholar] [CrossRef] [Scilit]
- Brunton, L.A.; Desbois, A.P.; Garza, M.; Wieland, B.; Mohan, C.V.; Hasler, B.; Tam, C.C.; Le, P.N.T.; Phuong, N.T.; Van, P.T.; et al. Identifying hotspots for antibiotic resistance emergence and selection, and elucidating pathways to human exposure: Application of a systems-thinking approach to aquaculture systems. Sci. Total Environ. 2019, 687, 1344–1356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belotti, P.T.; Thabet, L.; Laffargue, A.; Andre, C.; Coulange-Mayonnove, L.; Arpin, C.; Messadi, A.; M’Zali, F.; Quentin, C.; Dubois, V. Description of an original integron encompassing blaVIM-2, qnrVC1 and genes encoding bacterial group II intron proteins in Pseudomonas aeruginosa. J. Antimicrob. Chemother. 2015, 70, 2237–2240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hegde, S.S.; Vetting, M.W.; Mitchenall, L.A.; Maxwell, A.; Blanchard, J.S. Structural and biochemical analysis of the pentapeptide repeat protein EfsQnr, a potent DNA gyrase inhibitor. Antimicrob. Agents Chemother. 2011, 55, 110–117. [Google Scholar] [CrossRef] [Scilit]
- Jacoby, G.A.; Corcoran, M.A.; Mills, D.M.; Griffin, C.M.; Hooper, D.C. Mutational analysis of quinolone resistance protein QnrB1. Antimicrob. Agents Chemother. 2013, 57, 5733–5736. [Google Scholar] [CrossRef] [Scilit]
- Po, K.H.; Chan, E.W.; Chen, S. Mutational Analysis of Quinolone Resistance Protein QnrVC7 Provides Novel Insights into the Structure-Activity Relationship of Qnr Proteins. Antimicrob. Agents Chemother. 2016, 60, 1939–1942. [Google Scholar] [CrossRef] [Scilit]
- Yamane, K.; Wachino, J.; Suzuki, S.; Kimura, K.; Shibata, N.; Kato, H.; Shibayama, K.; Konda, T.; Arakawa, Y. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob. Agents Chemother. 2007, 51, 3354–3360. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]



| Strain | Year | Province | MIC (μg/mL) to CIP | ctxAB b | Qnr | Mutation a | Source | |||
|---|---|---|---|---|---|---|---|---|---|---|
| GyrA | ParC | |||||||||
| S83 | D87 | A171 | S85 | |||||||
| VC422 | 2002 | Jiangxi | 0.03 | - | QnrVC1 | N | - | - | - | Environment c |
| VC1435 | 2003 | Zhejiang | 0.25 | + | QnrVC12 | - | - | S | - | Patient |
| VC707 | 2004 | Sichuan | 0.03 | - | QnrVC1 | N | N | S | - | Environment |
| VC454 | 2004 | Jiangxi | 0.12 | + | QnrVC5 | - | - | S | - | Animal d |
| VC319 | 2004 | Liaoning | 0.06 | + | QnrVC5 | - | - | S | - | Patient |
| VC515 | 2005 | Sichuan | 0.03 | - | QnrVC1 | - | - | S | - | Animal |
| VC1692 | 2006 | Jiangxi | 0.12 | + | QnrVC5 | - | - | S | - | Environment |
| VC1699 | 2006 | Jiangxi | 4/6 | + | QnrVC9 | I | - | - | L | Patient |
| Conjugated Strains | CIP MIC (µg/mL) | QRDR Mutation | qnr | ||
|---|---|---|---|---|---|
| 0% Ara | 0.1% Ara | GyrA | ParC | ||
| VC1699 | 4/6 | 4/6 | S83I | S85L | QnrVC9 |
| VC401 | 0.375 | 0.375 | S83I | S85L | - |
| VC401/pBAD24-qnrVC1 | 0.375 | 1.5 | S83I | S85L | QnrVC1 |
| VC401/pBAD24-qnrVC5 | 0.375 | 2 | S83I | S85L | QnrVC5 |
| VC401/pBAD24-qnrVC12 | 0.375 | 2 | S83I | S085L | QnrVC12 |
| VC401/pBAD24-qnrVC9 | 0.375 | 3/4 | S83I | S85L | QnrVC9 |
| VC401/pVC1699 | 4/6 | 4/6 | S83I | S85L | QnrVC9 |
| VC1891 | 0.03 | 0.03 | A171S | - | |
| VC1891/pBAD24-qnrVC9 | 0.03 | 0.125/0.25 | A171S | - | QnrVC9 |
| N16961 | 0.015 | 0.015 | - | - | - |
| N16961/pBAD24-qnrVC9 | 0.015 | 0.125 | - | - | QnrVC9 |
| Primer | Sequence (5′–3′) | Amplicon | Reference |
|---|---|---|---|
| qnrAF | ATTTCTCACGCCAGGATTTG | qnrA | [16] |
| qnrAR | GATCGGCAAAGGTTAGGTCA | ||
| qnrBF | GATCGTGAAAGCCAGAAAGG | qnrB | [16] |
| qnrBR2 | ATGAGCAACGATGCCTGGTA | ||
| qnrCF | GGGTTGTACATTTATTGAATCG | qnrC | [16] |
| qnrCR | CACCTACCCATTTATTTTCA | ||
| qnrSmF | GCAAGTTCATTGAACAGGGT | qnrS | [16] |
| qnrSmR | TCTAAACCGTCGAGTTCGGCG | ||
| aacIbF | TTGCGATGCTCTATGAGTGGCTA | aac(6′)-Ib | [16] |
| aacIbR | CTCGAATGCCTGGCGTGTTT | ||
| qepAF | AACTGCTTGAGCCCGTAGAT | qepAF | [16] |
| qepAR | GTCTACGCCATGGACCTCAC | ||
| qnrVCF | AATTTTAAGCGCTCAAACCTCCG | qnrVC | [27] |
| qnrVCR | TCCTGTTGCCACGAGCATATTTT | ||
| qnrVC3F | GCCATGGAAAAATCAAAGCAAT | qnrVC3 | [27] |
| qnrVC3R | GCGGATCCGTCAGGAACAATGATTA | ||
| qnrF * | CGGAATTCCGAAAATGGATAAAACAGACCAGT | qnrVC | This study |
| qnrR | CCCAAGCTTGGGTTAGTCAGGTACTACTATTAAACCTAAT | ||
| 2qnrF | CGGAATTCCGATGGAAAAATCAAAGCAATTATATAATCAA | qnrVC | This study |
| 2qnrR | CCCAAGCTTGGGTTAGTCAGGAACAATGATTACCCCTAAT | ||
| qnrF2 | ATTTGCCCCCTTTAAATCGCACTC | qnrVC | This study |
| qnrR2 | TAGATTGTTCTTTCATTGAACGAG | ||
| recAF | AAGATTGGTGTGATGTTTGGTA | recA | This study |
| recAR | CACTTCTTCGCCTTCTTTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, Y.-Y.; Ma, L.-Y.; Yu, L.; Lu, X.; Liang, W.-L.; Kan, B.; Su, J.-R. Quinolone Resistance Genes and Their Contribution to Resistance in Vibrio cholerae Serogroup O139. Antibiotics 2023, 12, 416. https://doi.org/10.3390/antibiotics12020416
Zhou Y-Y, Ma L-Y, Yu L, Lu X, Liang W-L, Kan B, Su J-R. Quinolone Resistance Genes and Their Contribution to Resistance in Vibrio cholerae Serogroup O139. Antibiotics. 2023; 12(2):416. https://doi.org/10.3390/antibiotics12020416
Chicago/Turabian StyleZhou, Yan-Yan, Li-Yan Ma, Li Yu, Xin Lu, Wei-Li Liang, Biao Kan, and Jian-Rong Su. 2023. "Quinolone Resistance Genes and Their Contribution to Resistance in Vibrio cholerae Serogroup O139" Antibiotics 12, no. 2: 416. https://doi.org/10.3390/antibiotics12020416
APA StyleZhou, Y.-Y., Ma, L.-Y., Yu, L., Lu, X., Liang, W.-L., Kan, B., & Su, J.-R. (2023). Quinolone Resistance Genes and Their Contribution to Resistance in Vibrio cholerae Serogroup O139. Antibiotics, 12(2), 416. https://doi.org/10.3390/antibiotics12020416
