Next Article in Journal
Applications of Romanian Propolis in Phyto-Inhibitory Activity and Antimicrobial Protection: A Comparative Study
Next Article in Special Issue
From Epidemiology of Community-Onset Bloodstream Infections to the Development of Empirical Antimicrobial Treatment-Decision Algorithm in a Region with High Burden of Antimicrobial Resistance
Previous Article in Journal
Antibiotic Resistance in Metal-Tolerant Microorganisms from Treatment Facilities
Previous Article in Special Issue
Multi-Model Strategies for Prevention of Infection Caused by Certain Multi-Drug Resistant Organisms in A Rehabilitation Unit: A Semi-Experimental Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 12
10.3390/antibiotics12121681
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus among Patients Diagnosed with Surgical Site Infection at Four Hospitals in Ethiopia

by
Seble Worku
1,2,3,*,
Tamrat Abebe
1,
Berhanu Seyoum
3,
Ashenafi Alemu
3,
Yidenek Shimelash
4,
Marechign Yimer
3,
Alemseged Abdissa
3,
Getachew Tesfaye Beyene
3,
Göte Swedberg
5 and
Adane Mihret
1,3
1
Department of Microbiology, Immunology and Parasitology, School of Medicine, College of Health Sciences, Addis Ababa University, Addis Ababa 1165, Ethiopia
2
Department of Medical Laboratory Science, College of Health Sciences, Debre Tabor University, Debre Tabor P.O. Box 272, Ethiopia
3
Bacterial and Viral Diseases Research Directorate, Armauer Hansen Research Institute, Addis Ababa 1165, Ethiopia
4
Debre Tabor Comprehensive Specialized Hospital, Debre Tabor P.O. Box 272, Ethiopia
5
Department of Medical Biochemistry and Microbiology, Uppsala University, 750 08 Uppsala, Sweden
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(12), 1681; https://doi.org/10.3390/antibiotics12121681
Submission received: 31 October 2023 / Revised: 22 November 2023 / Accepted: 23 November 2023 / Published: 29 November 2023
(This article belongs to the Special Issue Antimicrobial Resistance and Hospital- and Community-Associated Infections)
Browse Figures
Review Reports Versions Notes

Abstract

:
Methicillin-resistant Staphylococcus aureus (MRSA) is a common cause of severe surgical site infections (SSI). The molecular epidemiology of MRSA is poorly documented in Ethiopia. This study is designed to determine the prevalence of MRSA and associated factors among patients diagnosed with SSI. A multicenter study was conducted at four hospitals in Ethiopia. A wound culture was performed among 752 SSI patients. This study isolated S. aureus and identified MRSA using standard bacteriology, Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS), and cefoxitin disk diffusion test. The genes mecA, femA, vanA, and vanB were detected through PCR tests. S. aureus was identified in 21.6% of participants, with 24.5% of these being methicillin-resistant Staphylococci and 0.6% showing vancomycin resistance. Using MALDI-TOF MS for the 40 methicillin-resistant Staphylococci, we confirmed that 31 (77.5%) were S. aureus, 6 (15%) were Mammaliicoccus sciuri, and the other 3 (2.5%) were Staphylococcus warneri, Staphylococcus epidermidis, and Staphylococcus haemolyticus. The gene mecA was detected from 27.5% (11/40) of Staphylococci through PCR. Only 36.4% (4/11) were detected in S. aureus, and no vanA or vanB genes were identified. Out of 11 mecA-gene-positive Staphylococci, 8 (72.7%) were detected in Debre Tabor Comprehensive Specialized Hospital. Methicillin-resistant staphylococcal infections were associated with the following risk factors: age ≥ 61 years, prolonged duration of hospital stay, and history of previous antibiotic use, p-values < 0.05. Hospitals should strengthen infection prevention and control strategies and start antimicrobial stewardship programs.

1. Introduction

Staphylococcus aureus (S. aureus) is a Gram-positive coccus that causes significant infections worldwide, including bacteremia, endocarditis, osteomyelitis, and skin and soft tissue infections, due to its easy transmission and commensal nature [1]. Not only S. aureus but also coagulase-negative Staphylococci (CoNS), which currently are defined as more than 40 species, are frequently associated with opportunistic human infections. S. epidermidis and S. haemolyticus are the major species of CoNS frequently isolated from clinical specimens [2]. Furthermore, Mammaliicoccus sciuri (previously called S. sciuri) is part of the normal flora of goats and camels, and it is a rare opportunistic pathogen in humans [3]. S. aureus possesses a unique set of virulence factors, including toxins, enzymes, and metallophores, which enable it to survive extreme conditions, promote tissue colonization, cause systemic infection, and evade the host’s immunity [4]. By utilizing metallophores, this bacterium can sequester metal ions from its environment [5]. S. aureus infections have previously been treated with beta-lactams, including penicillin and, later, methicillin, as well as sulfonamides, tetracyclines, and macrolides [6]. However, antibiotic-resistant strains of S. aureus have developed due to repeated exposure to antibiotics, leading to an increase in methicillin-resistant S. aureus (MRSA) infections globally. MRSA is one of the most causative pathogens of surgical site infections (SSIs), and it is a prevalent bacterium that frequently colonizes hospital environments and causes hospital-acquired infections [6] and community-acquired infections [7].
MRSA is characterized by resistance to penicillins, cephalosporins, and carbapenems, with the exception of the new anti-MRSA cephalosporins ceftaroline and ceftobiprole antimicrobial agents [6,8]. The main mechanism of resistance is an altered penicillin-binding protein (PBP2a/c) encoded by the mecA gene [1]. The mecA gene is regarded as the gold standard for identifying isolates of MRSA, and it is a helpful marker. It is highly conserved in staphylococcal strains and acquired through horizontal gene transfer. mecA is carried/located on the mobile genetic element staphylococcal cassette chromosome (SCC) mec, and it codes for the low-affinity PBP2a [9]. Other chromosomal factors, such as the high-level expression of femA and femB, also seem to be essential for high-level methicillin resistance [10]. The current treatment options for more serious MRSA infections requiring hospitalization include parenteral antimicrobials, such as teicoplanin, tigecycline, linezolid [8], trimethoprim–sulfamethoxazole, doxycycline, daptomycin [6], and vancomycin [8]. However, the majority of MRSA strains are capable of evolution and have acquired resistance to a variety of antibiotics, including those listed above [9,11].
Vancomycin resistance in MRSA was first discovered in 1996 in Japan following a few years of commercializing the antibiotic [12]. Vancomycin resistance is acquired through mutations and cell wall modification [12,13] mediated by a vanA gene cluster that can be acquired from vancomycin-resistant enterococcus (VRE) [11] through mobile genetic elements like transposonTn1546 [14]. Vancomycin-resistant S. aureus (VRSA) infections are treated with antibiotics like tigecycline, quinupristin, daptomycin, ceftobiprole, iclaprim, linezolid, and new glycopeptides (telavancin, oritavancin, and dabavancin) [15].
Globally, the prevalence of VRSA was 16% in Africa, 1% in Europe, 3% in South America, 4% in North America, and 5% in Asia [16]. A systematic review and meta-analysis revealed a highly variable prevalence of VRSA and MRSA in Ethiopian S. aureus isolates. The MRSA prevalence ranged from 8.3% to 77.3% (with a pooled prevalence of 32.5%) [17]. In the same way, there was a 5.1% to 44.3% variation in VRSA prevalence. [18]. These days, MRSA is considered a serious threat to public health, and it is one of the pathogens that needs to be treated with high priority. However, the molecular epidemiology of MRSA and VRSA is less well documented in Ethiopia, and published reports on MRSA- and VRSA-causing SSIs are scarce. Furthermore, almost all earlier reports depend on phenotypic laboratory methods. Therefore, in this study, we used the Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS) technique for the confirmation of bacterial isolates and multiplex polymerase chain reaction (PCR) for the detection of mecA, femA, vanA, and vanB.

2. Results

In this study, a total of 752 participants were included. S. aureus was isolated from 21.7% (163) of these participants. Following that, a cefoxitin disc diffusion test was used as a substitute marker for oxacillin and other penicillinase-resistant penicillins to ascertain the percentage of MRSA.
Of all participants, 5.3% (40/752) carried bacteria characterized as MRSA, while among isolates of S. aureus, the frequency of MRSA was 24.5% (Table 1). All methicillin-resistant isolates were also tested for vancomycin susceptibility. Except for one isolate (2.5%), all tested isolates for vancomycin were sensitive.
The age of study participants with MRSA ranged from 8 days to 85 years, with a mean age (±standard deviation) of 35 ± 28.3 years and a median of 30 years, and 58.3% (95) were males. Fifty-nine (36.2%) of the participants received antimicrobial prophylaxis before the procedure, and 47.2% (63) underwent surgeries lasting longer than an hour (Table 2).
The likelihood of MRSA SSI occurrence was about 3.7 times higher among patients aged ≥ 61 (AOR = 3.729 (1.179–11.791)) compared to those aged ≤ 60. Similarly, the relative risk of MRSA SSI occurrence was about 1.9 times more likely among patients who had a hospital stay ≥ 7 days (AOR = 1.856 (0.688–5.311)). Also, those who had a history of antibiotic use had a 3.7 times higher risk of developing methicillin-resistant Staphylococci infections (AOR = 3.692 (1.059–2.800)) than methicillin-sensitive S. aureus (MSSA) SSI. The likelihood of SSI occurrence was about 3.16 times more likely among patients who had antimicrobial prophylaxis during the operation (AOR = 3.066 (1.101–9.392)) than those who had antimicrobial prophylaxis before the operation. All p-value < 0.05 (Table 3).

2.1. MALDI-TOF MS Identification of Methicillin-Resistant Staphylococcus Isolates

Of the 40 phenotypic MRSA bacterial isolates, MALDI-TOF MS only identified 77.5% (31/40) as S. aureus, while 6 were identified as M. sciuri, and the other three as S. warneri, S. epidermidis, and S. haemolyticus (Figure 1). The majority (70%) of methicillin-resistant Staphylococcus isolates were identified from Debre Tabor Comprehensive Specialized Hospital (Figure 2) with 47.5% as S. aureus, 15% as M. sciuri, 2.5% as S. warneri, 2.5% as S. epidermidis and 2.5% as S. haemolyticus.

2.2. PCR amplification of mecA, femA, van A, and vanB

Detection of mecA, femA, van A, and vanB was performed for all MRSA and methicillin-resistant Staphylococci other than S. aureus (MRSOSA). The PCR tests revealed that 27.5% (11/40) contained the mecA gene, 25% (10/40) were both mecA- and femA- positive, and 92.5% (37/40) showed the femA gene (Figure 3). On the other hand, from all eleven isolates that contained the mecA gene only, four were S. aureus, whereas five were M. sciuri, one was S. warneri, and one was S. haemolyticus, respectively (Figure 4 and Table 4). Among S. aureus isolates, only 12.9% (4/31) carried the mecA gene (MRSA), whereas 83.3% (5/6) of M. sciuri and both S. warneri and S. haemolyticus isolates carried mecA (Figure 3).
The 11 isolates that contained the mecA gene, as shown in Figure 4A,B, were S. aureus (lanes 1, 5, 18, and 19), M. sciuri (lanes 7, 23, 24, 29, and 31), S. hemolyticus (lane 11), and S. warneri (lane 12). These were analyzed for vanA and vanB, and none of these isolates showed vanA or vanB in the gel electrophoresis (Table 5).
Most of the isolates carrying both the mecA and femA gene were reported from Debre Tabor (Figure 5). At Debre Tabor Comprehensive Specialized Hospital, 72.7% of mecA-positive, 70% of cefoxitin-resistant, and 67.7% of femA-positive Staphylococci were discovered (Figure 5).

3. Discussion

MRSA is one of the primary bacteria responsible for surgical site infections [19]. The bacteria are human commensals [20], and they can cause a variety of infections, including simple skin and wound infections; they can also infect visceral organs. If not diagnosed and treated properly, many of these illnesses can quickly become life-threatening diseases [1].
In our study, among the 752 wound swab samples processed, we detected 21.7% (163/752) of S. aureus phenotypically. The present finding is similar to previous studies reported from Jimma Ethiopia (23.6%) [21] and Brazil (20%) [22]. On the other hand, this finding is lower than those of studies conducted in other parts of Ethiopia, such as Dessie (34.5%) [23] and Debre Markos (39.7%) [24]. The variation in prevalence between studies might be due to variations in the study subjects, the conducted time, and the method employed for the detection of S. aureus [25].
The proportion of MRSA among the isolates based on disc diffusions was 24.5% (40/163). This study’s findings were similar to a previous study conducted in an Indian Hospital (21.7%) [26]. On the other hand, the finding showed higher frequency than earlier studies in Ethiopia from Dessie (9.8%) [23] and Debre Markos (13.2%) [24], but it was below the national pooled prevalence estimate of Ethiopia (32.5%) [17], Addis Ababa (68.4%) [27], Arba Minch (82.3%) [28], and Nigeria (44%) [29]. Variations in MRSA prevalence across countries are influenced by demographics, antibiotic prescription policies, infection prevention and control programs, staff and elderly hygiene education, healthcare system structure, and MRSA diagnostic facilities [30,31].
From those tested for vancomycin resistance, one isolate had a minimum inhibitory concentration for vancomycin greater than 8 µg/mL, and it was identified as a vancomycin-resistant Staphylococcus. This result was consistent with Pournajaf et al.’s [32] finding that vancomycin resistance was 2.5%, and this figure was lower than that from a review from Ethiopia, where the pooled prevalence of VRSA was 5.3% [17], as well as the findings from Debre Markos (14.1%) [33] and elsewhere (29.4%) [34].
From all methicillin-resistant Staphylococci, the mecA gene was carried by 27.5% of the isolates. This finding was comparable with a study from Nigeria, where 30.5% of the isolates carried the mecA gene [29]. In the present study, 12.9% of S. aureus carried the mecA gene, which is lower than studies reported in Ethiopia (20%) [35], Bangladesh (25%) [36], Nigeria (38%) [29], and Iran (45.1%) [32]. It should be noted that the majority of isolates exhibiting the mecA gene were discovered in Debre Tabor. Eight (72.7%) of the ten mecA-positive isolates were detected at Debre Tabor Hospital. The reason might be poor socioeconomic status, personal demographics, antibiotic prescription practice, and infection control practices, which are associated with increased MRSA infection rates [30,31].
In our present study, the femA gene was detected in all S. aureus isolates, except two cefoxitin-resistant strains (6.7%). This finding was comparable with a study from China [37]. Additionally, in the present study, the femA gene was found in S. haemolyticus, S. warneri, and 83.3% of M. sciuri cefoxitin-resistant strains. On the other hand, neither mecA nor femA were detected in S. epidermidis [37]. The primers used should be specific to S. aureus; therefore, it is somewhat surprising that the two S. aureus lack the gene and that several other non-aureus isolates carry the gene. The explanation could be mutational changes in S. aureus and gene transfer to other species. All of these isolates have been sent for whole genome sequencing, and this matter will be analyzed further when the results are ready.
It is interesting that a significantly higher proportion of CoNS isolates harbour methicillin resistance genes, where 83.3% of M. sciuri and 50% of S. haemolyticus carried the mecA gene. This is in agreement with early reports that CoNS were the most common species in nosocomial infections and exhibit higher antibiotic resistance rates than S. aureus. This may be explained by the high prevalence of methicillin resistance linked with staphylococcal cassette chromosome (SCCmec) elements in CoNS [38], and they are considered a major reservoir of SCCmec [39]. For instance, Berglund et al. described the likely transfer of a type V SCCmec from methicillin-resistant S. haemolyticus to MSSA, thus transforming into MRSA [9,40]. Another study revealed that the mecA homologue in M. sciuri may be an evolutionary precursor to MRSA pathogenic strains, highlighting the main routes of antibiotic resistance gene transfer [41]. Furthermore, the report demonstrated that MSSA become MRSA by acquiring SCCmec from S. epidermidis through horizontal transfer [42]. These accounts suggest that horizontal interspecies transfer of mobile genetic elements could be a crucial element for MRSA global dissemination [40,41,43].
The absence of the mecA and vanA genes in the MRSA and VRSA samples does not imply the absence of resistance, as resistance may be due to other mutations or cassette-containing resistance genes [44]. Globally, resistant staphylococcal isolates lacking the mecA gene show the possibility for additional mechanisms to compete with mecA in the establishment of MRSA [45,46]. MRSA’s resistance against beta-lactams and methicillin is further complicated by its ability to develop resistance to vancomycin through accidental transmission of the vanA gene from Enterococcal strains [47]. Vancomycin is a glycopeptide antibiotic that prevents the formation of the peptidoglycan layer by binding to the peptide precursor. Antibiotic overuse leads to bacterial resistance, thus prompting the search for new antimicrobial strategies [48]. Genomics can identify antibiotic targets, and live non-multiplying bacteria can be targeted for new antibacterials, potentially resulting in new antibacterials that shorten therapy microorganisms, reduce adverse effects, and potentially reduce antibacterial resistance [49]. Preclinical research explores metal uptake via bacterial metallophores [48]. Bacteriophages have been demonstrated to be antibacterial in animals that are susceptible to certain infectious diseases [49].
In the present study, the likelihood of methicillin-resistant staphylococcus SSI increased among patients aged ≥ 61 years (p = 0.025, AOR = 3.729 (1.179–11.791)). Similar findings have been reported in Brazil [22]. Previous studies have suggested that patients on antibiotics (p = 0. 017), who had a previous wound infection (p = 0.006), and with a hospital stay > 72 h showed an association with MRSA infection [33]. Similarly to our finding, previous use of antibiotics (p = 0.025, AOR = 3.066 (1.101–9.392)) and preoperative hospital stays > 7 days (p = 0.000, AOR = 1.856 (0.688–5.311)) demonstrated an association with methicillin-resistant Staphylococci for SSI. Unlike our study, a report by X. Yang et al. [50] showed that long, invasive procedures used in the ICU, such as tracheal intubation and ventilator usage, along with patients with cerebral infarction and other embolisms increase the likelihood of developing MRSA colonization and further infections.

4. Materials and Methods

4.1. Study Area and Design

A cross-sectional study was conducted in four purposively selected University Teaching Hospitals, including Debre Tabor Comprehensive Specialized Hospital (DTCSH), Tikur Anbessa Specialized Hospital (TASH), Hawassa University Teaching Hospital (HUTH), and Jimma University Teaching Hospital (JUTH) in Ethiopia. These hospitals provide a range of services in both outpatient and inpatient units under different wards, such as general surgical, gynecology, obstetric/maternity, and orthopedics, and they all have microbiology laboratories for culture and antimicrobial sensitivity testing. This study was conducted between July 2020 and August 2021.

4.2. Variables

The variables in this study were MRSA and VRSA infections, socio-demographic characteristics, clinical data, and risk factor variables, such as age, sex, surgical site, length of hospital stay, history of hospital admission, previous use of antibiotics, smoking history, alcohol consumption, type and nature of the surgery, type of antimicrobial prophylaxis, history of previous antibiotic use, surgical procedure performed, and duration of the operation.

4.3. Study Population and Sampling

The study population consisted of patients admitted for elective and emergency surgery in general surgery, gynecology/obstetric, and orthopedics wards. All surgical patients, regardless of their age, who underwent surgery during the study period and developed signs and symptoms of surgical site infection (SSI) within 30 days were included in this study. Consent and/or assent was secured from each participant before the commencement of data collection. Patients who developed SSIs after 30 days following the operation, those who refused to participate, patients with infected burn wounds, and those on treatment were excluded from this study.

4.4. Sample Size and Sampling Technique

A total of 752 clinically diagnosed cases of SSI from different wards were enrolled in this study. The sample size was calculated based on a single population proportion sample size estimation formula (n = Z2 P (1 − P)/d2) using a proportion (P) of 20% [51]. As this was a multicenter study, to increase the sample size, a precision (d) of 0.03 was used, where Z stands for Z statistic with a confidence level of 95% and a Z value of 1.96. Considering a 10% non-response rate, the final total sample size was estimated at 752. Enrollments continued until the necessary sample size was achieved, with proportional allocation among the different hospitals based on patient flow.

4.5. Specimen Collection, Isolation, and Identification of S. aureus

Wound swabs or aspirates were collected based on standard operation procedure (SOP). Conventional bacteriological techniques, such as morphological, cultural, and biochemical characterization, were used to identify strains of S. aureus [52]. The specimens were inoculated on blood agar plates (BAP) (Oxoid, UK), and mannitol salt agar (MSA) (Oxoid) and then incubated at 35 °C for 24 h. The S. aureus isolates were identified through Gram staining, catalase and coagulase tests, including golden yellow colonies on MSA, which were considered phenotypic identification tests.

4.6. Identification Confirmation of the Species of Bacteria Strain Using Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS)

All phenotypically cefoxitin-resistant S. aureus isolates were re-identified using MALDI-TOF MS [53] at the Clinical Microbiology Department, Uppsala University Hospital in Sweden. A single colony of bacteria from fresh cultures was smeared onto a MALDI-TOF plate, air-dried, treated with formic acid and MALDI matrix solution, and again air-dried before reading. MALDI-TOF identification scores were automatically generated by the system software [54], and isolates with scores of two and above were accepted, while those with scores below 1.7 and flagged red were rejected. Samples with scores between 1.7 and 2 and flagged yellow were re-analyzed.

4.7. Antimicrobial Susceptibility Testing

Antimicrobial susceptibility testing (AST) was carried out using the cefoxitin disc diffusion test, which is a surrogate marker test for oxacillin resistance following the clinical and laboratory standard institute (CLSI) protocol [55], and the minimum inhibitory concentration (MIC) of the vancomycin strip was determined using the E-test method on MHA. The reference strain S. aureus (ATCC® 25923, Seattle, DC, USA) was used as a quality control. Evidence showed that MRSA is a requisite for VISA [56]. Hence, we screened VRSA/VISA from MRSA isolates.

4.8. Identification of Methicillin-Resistant S. aureus Strains

4.8.1. DNA Extraction

DNA was extracted from all cefoxitin-resistant S. aureus isolates through the boiling method, as described previously [57]. Briefly, each isolate was grown overnight on nutrient agar (Oxoid, UK), and 3 to 5 colonies of that culture were suspended in 300 µL of 1× Tris EDTA buffer. The suspension was subjected to 10 min of boiling at 94 °C in a water bath (Thermo Fisher Scientific, CA, USA), followed by 10 minutes of freezing at −20 °C, 1 min at room temperature, and 5 min of centrifugation at 14,000× g. Finally, 150 µL of the supernatant was transferred into a nuclease-free Eppendorf tube and measured using Nanodrop (Thermo Scientific) for the quality and quantity of DNA prior to storage at −20 °C until analysis.

4.8.2. Standardization of Multiplex PCR for the Detection of Staphylococci mecA, femA, vanA, and vanB

Multiplex PCR was used to amplify different genes that are associated with methicillin resistance from Staphylococci. The primers and annealing temperatures were standardized for the detection of S. aureus mecA, vanA, vanB, and femA. The PCR products were analyzed through gel electrophoresis. Positive and negative control strains were included in all amplification reactions to ensure accuracy of the test results.
First, PCR was standardized using a range of annealing temperatures to establish the optimum annealing reaction condition for all of the primers. All PCR primers are described in Table 5. The reaction mixture contained 12.5 μL of hot star master mix (Qiagen, Hilden, Germany), 0.5 μL each of the forward and reverse primers, 9 μL of molecular-grade water, and 2.5 μL of the template, with a final volume of 25 μL. Amplification for mecA and femA was carried out over 40 cycles of initial heat activation at 95 °C for 15 min, denaturation at 94 °C for 30 s, followed by annealing at 52 °C for 45 s, extension at 72 °C for 1 min, and final extension at 72 °C for 10 min. Amplification for vanA and vanB was carried out over 40 cycles of initial heat activation at 95 °C for 15 min, denaturation at 94 °C for 30 s, followed by annealing at 56 °C for 90 s, extension at 72 °C for 90 min, and final extension at 72 °C for 10 min. The PCR products were analyzed through electrophoresis on a 2% agarose gel and detected through staining in ethidium bromide with the aid of a gel imaging system, GelDoc (Bio-Rad). The following controls were included in all amplification reactions: ATCC 33591 (mecA-positive S. aureus) and ATCC 25923 (mecA-negative S. aureus).
Table 5. Primers used in multiplex PCR for the detection of the mecA, vanA, vanB, and femA genes.
Table 5. Primers used in multiplex PCR for the detection of the mecA, vanA, vanB, and femA genes.
Target Gene Primer NamePrimer Sequence (5′-3′)Size bp References
mecAMFGTAGAAATGACTGAACGTCCGATAA310[58]
MRCCAATTCCACATTGTTTCGGTCTAA
vanAVFGGGAAAACGACAATTGC732[59]
VRGTACAATGCGGCCGTTA
vanBVFACCTACCCTGTCTTTGTGAA300
VRAATGTCTGCTGGAACGATA
femAFFAAAAAAGCACATAACAAGCG132[60]
FRGATAAAGAAGAAACCAGCAG

4.9. Quality Assurance

Specimens were collected according to the recommended standard operating procedures (SOPs). The performance of all prepared culture media (BAP and MSA) was also checked by inoculating control strains, S. aureus (ATCC® 25923), for each new batch of agar plates prepared. In addition, the sterility of culture media was checked by incubating 5% of the prepared media at 37 °C for 24–48 h. In addition, reagents for Gram stain and biochemical tests were checked against control strains of S. aureus. The 0.5 McFarland standard was used to standardize the bacterial suspension inoculum density for the susceptibility test. Each MALDI-TOF run also included S. aureus (ATCC® 25923) as a quality control strain. Furthermore, the performance of the antibiotic disks was evaluated using American-type cell culture (ATCC) controls. As such, S. aureus ATCC® 25923 (cefoxitin zone 21–29 mm) and S. aureus ATCC® 43300 (zone ≤ 21 mm) were used as control strains to determine the performance of the cefoxitin disc diffusion test. S. aureus ATCC® 29213 MIC of vancomycin broth value 0.5–2.0 µg/mL was used as a control strain to measure the performance of vancomycin [55].

4.10. Data Entry and Analysis

The data were checked for completeness, missing values, and coding of questionnaires entered into the Research Electronic Data Capture (RED-Cap). A double data entry method was used to ensure the accuracy of the data, and data were analyzed using STATA version 25. Descriptive statistics were used to present antimicrobial susceptibility patterns. Frequencies and cross-tabulations were used to summarize descriptive statistics. Logistic regression was used to study the effect of independent variables on the dependent variables. p-values less than 0.05 were considered statistically significant.

4.11. Ethical Considerations

The Department of Medical Microbiology, Immunology, and Parasitology (DMIP) and the AHRI/ALERT Research Ethics Committee (AAREC) reviewed and approved this study. Institutional review board (IRB) approval was also obtained from Addis Ababa University’s College of Health Sciences, AAUMF03-008/2020. Selected hospitals received a formal letter from the AHRI and DMIP, and each hospital’s medical directors gave their consent. Written consent/assent was taken from each study participant before initiation of the actual data collection.
Patient information was kept confidential by sharing the laboratory results of research participants only with the designated accountable clinicians. Patients who experienced SSIs were managed according to hospital policy. In general, this study was conducted in accordance with the Declaration of Helsinki.

5. Conclusions

A multicenter study identified 11 mecA-positive Staphylococci species, with 36.4% being MRSA, but no VRSA was found among these MRSA. What is more captivating in this study is a significantly high prevalence of mecA carriage among CoNS, suggesting difficulties in the treatment of patients with CoNS infections. Furthermore, this signifies a huge potential of MSSA conversion to MRSA through horizontal gene transfer, which would make things more complicated. In terms of geographic distribution, out of 11 mecA-gene-positive Staphylococci, 8 (72.7%) were detected in DTCSH, with significant variations between hospitals, suggesting that strategies to control methicillin-resistant Staphylococci should be tailored to specific hospitals. The presence of staphylococcal isolates was linked to factors like older age, hospital stay, antibiotic history, and prophylaxis. Prompt prevention and control measures for MRSA-high-risk populations, including strict adherence to infection prevention methods, periodic surveillance, and antibiotic stewardship programs, are crucial for effective treatment and prevention strategies.

Author Contributions

S.W., conceptualization, data collection, laboratory investigation, drafting the manuscript, and write-up. Y.S., M.Y. and A.A. (Ashenafi Alemu) substantially participated in laboratory investigation. T.A., B.S., A.A. (Alemseged Abdissa), G.T.B., G.S. and A.M. substantially participated in the design of this study, reviewed the manuscript and provided critical intellectual content. S.W. and G.S. participated in the analysis and interpretation of the findings. All authors have read and agreed to the published version of the manuscript.

Funding

Collection of samples and laboratory work in Ethiopia was covered by grants from Addis Ababa University, and Armauer Hansen Research Institute. For work in Sweden, grants from SIDA/SAREC bilateral research cooperation with Ethiopia (5108013506) and the Centre for Innovative Drug Development and Therapeutic Trials for Africa (CDT-Africa) were used to cover travel and subsistence for SW during a three-month visit. Laboratory work in Sweden was done without external grants.

Institutional Review Board Statement

Ethical clearance and approval were obtained from Addis Ababa University’s College of Health Sciences and AAREC. Institutional Review Board Statement: The research was granted approval by the Institutional Review Board (AAUMF 03-008-2020) of Addis Abeba University’s College of Health Sciences and the Department of Microbiology, Immunology, and Parasitology Ethical Review Committee (DEREC002/2020). This study was also approved by the AHRI/ALERT Ethics Review Committee (protocol number: PO/29/19) of the Armauer Hansen Research Institute.

Informed Consent Statement

Data were collected only when written consent or assent was obtained from each participant or guardian.

Data Availability Statement

The data sets generated during and/or analyzed during the current study are available from the corresponding authors upon reasonable request. The data are not publicly available due to privacy restrictions.

Acknowledgments

The authors would like to extend our gratitude to The Centre for Innovative Drug Development and Therapeutic Trials for Africa (CDT-Africa) for supporting this study (cover Sweden travel cost and subsistence for SW). We would like to thank the Debre Tabor Compressive Specialized Hospital, Tikur Anbessa Specialized Hospital, Hawassa University Teaching Hospital, and Jimma University Teaching Specialized Hospital for allowing us to conduct this study. We appreciate all of the research sites’ doctors, nurses, and microbiologists who assisted us in conducting this investigation. And, lastly, we would like to thank everyone who took part in this study.

Conflicts of Interest

The authors declare no competing interest. The funders had no role in the design of this study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

Abbreviations

CLSI, Clinical and Laboratory Standards Institute; CoNS, Coagulase Negative Staphylococcous; MALDI-TOF MS, Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry; MHA, Muller–Hinton agar; MIC, Minimum Inhibitory Concentration; MRSA, Methicillin-Resistant S. aureus; MSSA, Methicillin-Sensitive S. aureus; SSI, Surgical Site Infection; SCCmec, Staphylococcal Cassette Chromosome mec; VISA, Vancomycin-Intermediate S. aureus; VRSA, Vancomycin-Resistant S. aureus; VSSA, Vancomycin-Sensitive S. aureus.

References

  1. Turner, N.A.; Sharma-Kuinkel, B.K.; Maskarinec, S.A.; Eichenberger, E.M.; Shah, P.P.; Carugati, M.; Holland, T.L.; Fowler, V.G. Methicillin-resistant Staphylococcus aureus: An overview of basic and clinical research. Nat. Rev. Microbiol. 2019, 17, 203–218. [Google Scholar] [CrossRef]
  2. Martínez-Meléndez, A.; Morfín-Otero, R.; Villarreal-Treviño, L.; González-González, G.; Llaca-Díaz, J.; Rodríguez-Noriega, E.; Camacho-Ortíz, A.; Garza-González, E. Staphylococcal cassette chromosome mec (SCCmec) in coagulase negative staphylococci. Med. Univ. 2015, 17, 229–233. [Google Scholar] [CrossRef]
  3. Beims, H.; Overmann, A.; Fulde, M.; Steinert, M.; Bergmann, S. Isolation of Staphylococcus sciuri from horse skin infection. Open Vet. J. 2016, 6, 242–246. [Google Scholar] [CrossRef]
  4. Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef] [PubMed]
  5. Ghssein, G.; Ezzeddine, Z. The Key Element Role of Metallophores in the Pathogenicity and Virulence of Staphylococcus aureus: A Review. Biology 2022, 11, 1525. [Google Scholar] [CrossRef] [PubMed]
  6. David, M.Z.; Daum, R.S. Treatment of Staphylococcus aureus Infections. Curr. Top. Microbiol. Immunol. 2017, 409, 325–383. [Google Scholar]
  7. Hiramatsu, K.; Katayama, Y.; Matsuo, M.; Sasaki, T.; Morimoto, Y.; Sekiguchi, A.; Baba, T. Multi-drug-resistant Staphylococcus aureus and future chemotherapy. J. Infect. Chemother. 2014, 20, 593–601. [Google Scholar] [CrossRef] [PubMed]
  8. Mahjabeen, F.; Saha, U.; Mostafa, M.N.; Siddique, F.; Ahsan, E.; Fathma, S.; Tasnim, A.; Rahman, T.; Faruq, R.; Sakibuzzaman, M.; et al. An Update on Treatment Options for Methicillin-Resistant Staphylococcus aureus (MRSA) Bacteremia: A Systematic Review. Cureus 2022, 14, e31486. [Google Scholar] [CrossRef]
  9. Vestergaard, M.; Frees, D.; Ingmer, H. Antibiotic Resistance and the MRSA Problem. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef]
  10. Li, X.; Xiong, Y.; Fan, X.; Feng, P.; Tang, H.; Zhou, T. The role of femA regulating gene on methicillin-resistant Staphylococcus aureus clinical isolates. Med. Mal. Infect. 2012, 42, 218–225. [Google Scholar] [CrossRef]
  11. Cong, Y.; Yang, S.; Rao, X. Vancomycin resistant Staphylococcus aureus infections: A review of case updating and clinical features. J. Adv. Res. 2020, 21, 169–176. [Google Scholar] [CrossRef]
  12. Stogios, P.J.; Savchenko, A. Molecular mechanisms of vancomycin resistance. Protein Sci. 2020, 29, 654–669. [Google Scholar] [CrossRef]
  13. Li, G.; Walker, M.J.; De Oliveira, D.M.P. Vancomycin Resistance in Enterococcus and Staphylococcus aureus. Microorganisms 2022, 11, 24. [Google Scholar] [CrossRef]
  14. Arredondo-Alonso, S.; Top, J.; Corander, J.; Willems, R.J.L.; Schürch, A.C. Mode and dynamics of vanA-type vancomycin resistance dissemination in Dutch hospitals. Genome Med. 2021, 13, 9. [Google Scholar]
  15. Micek, S.T. Alternatives to vancomycin for the treatment of methicillin-resistant Staphylococcus aureus infections. Clin. Infect. Dis. 2007, 45 (Suppl. S3), S184–S190. [Google Scholar] [CrossRef] [PubMed]
  16. Wu, Q.; Sabokroo, N.; Wang, Y.; Hashemian, M.; Karamollahi, S.; Kouhsari, E. Systematic review and meta-analysis of the epidemiology of vancomycin-resistance Staphylococcus aureus isolates. Antimicrob. Resist. Infect. Control 2021, 10, 101. [Google Scholar] [CrossRef] [PubMed]
  17. Eshetie, S.; Tarekegn, F.; Moges, F.; Amsalu, A.; Birhan, W.; Huruy, K. Methicillin resistant Staphylococcus aureus in Ethiopia: A meta-analysis. BMC Infect. Dis. 2016, 16, 689. [Google Scholar] [CrossRef]
  18. Anagaw, B.; Shiferaw, Y.; Anagaw, B.; Biadglegne, F.; Moges, F.; Kassu, A.; Unakal, C.; Mulu, A. Frequency of methicillin-resistant Staphylococcus aureus isolates from clinical specimens in Gondar University Hospital, Northwest Ethiopia. Asian J. Med. Sci. 2013, 5, 59–64. [Google Scholar] [CrossRef]
  19. Pal, S.; Sayana, A.; Joshi, A.; Juyal, D. Staphylococcus aureus: A predominant cause of surgical site infections in a rural healthcare setup of Uttarakhand. J. Fam. Med. Prim. Care 2019, 8, 3600–3606. [Google Scholar]
  20. Haaber, J.; Penadés, J.R.; Ingmer, H. Transfer of antibiotic resistance in Staphylococcus aureus. Trends Microbiol. 2017, 25, 893–905. [Google Scholar] [CrossRef] [PubMed]
  21. Godebo, G.; Kibru, G.; Tassew, H. Multidrug-resistant bacterial isolates in infected wounds at Jimma University Specialized Hospital, Ethiopia. Ann. Clin. Microbiol. Antimicrob. 2013, 12, 17. [Google Scholar] [CrossRef]
  22. Almeida, G.C.; dos Santos, M.M.; Lima, N.G.; Cidral, T.A.; Melo, M.C.; Lima, K.C. Prevalence and factors associated with wound colonization by Staphylococcus spp. and Staphylococcus aureus in hospitalized patients in inland northeastern Brazil: A cross-sectional study. BMC Infect. Dis. 2014, 14, 328. [Google Scholar] [CrossRef]
  23. Tsige, Y.; Tadesse, S.; G/Eyesus, T.; Tefera, M.M.; Amsalu, A.; Menberu, M.A.; Gelaw, B. Prevalence of Methicillin-Resistant Staphylococcus aureus and Associated Risk Factors among Patients with Wound Infection at Referral Hospital, Northeast Ethiopia. J. Pathog. 2020, 2020, 3168325. [Google Scholar] [CrossRef] [PubMed]
  24. Kahsay, A.; Mihret, A.; Abebe, T.; Andualem, T. Isolation and antimicrobial susceptibility pattern of Staphylococcus aureus in patients with surgical site infection at Debre Markos Referral Hospital, Amhara Region, Ethiopia. Arch. Public Health 2014, 72, 16. [Google Scholar] [CrossRef] [PubMed]
  25. Congdon, S.T.; Guaglione, J.A.; Ricketts, O.M.A.; Murphy, K.V.; Anderson, M.G.; Trowbridge, D.A.; Abduladheem, Y.A.; Phillips, A.M.; Beausoleil, A.M.; Stanley, A.J.; et al. Prevalence and antibiotic resistance of Staphylococcus aureus associated with a college-aged cohort: Life-style factors that contribute to nasal carriage. Front. Cell. Infect. Microbiol. 2023, 13, 1195758. [Google Scholar] [CrossRef] [PubMed]
  26. Kownhar, H.; Shankar, E.M.; Vignesh, R.; Sekar, R.; Velu, V.; Rao, U.A. High isolation rate of Staphylococcus aureus from surgical site infections in an Indian hospital. J. Antimicrob. Chemother. 2008, 61, 758–760. [Google Scholar] [CrossRef] [PubMed]
  27. Tadesse, S.; Alemayehu, H.; Tenna, A.; Tadesse, G.; Tessema, T.S.; Shibeshi, W.; Eguale, T. Antimicrobial resistance profile of Staphylococcus aureus isolated from patients with infection at Tikur Anbessa Specialized Hospital, Addis Ababa, Ethiopia. BMC Pharmacol. Toxicol. 2018, 19, 24. [Google Scholar] [CrossRef] [PubMed]
  28. Mama, M.; Aklilu, A.; Misgna, K.; Tadesse, M.; Alemayehu, E. Methicillin-and inducible clindamycin-resistant Staphylococcus aureus among patients with wound infection attending Arba Minch Hospital, South Ethiopia. Int. J. Microbiol. 2019, 2019, 2965490. [Google Scholar] [CrossRef] [PubMed]
  29. Ibadin, E.E.; Enabulele, I.O.; Muinah, F. Prevalence of mecA gene among staphylococci from clinical samples of a tertiary hospital in Benin City, Nigeria. Afr. Health Sci. 2017, 17, 1000–1010. [Google Scholar] [CrossRef]
  30. Kavanagh, K.T. Control of MSSA and MRSA in the United States: Protocols, policies, risk adjustment and excuses. Antimicrob. Resist. Infect. Control 2019, 8, 103. [Google Scholar] [CrossRef]
  31. Al-Orphaly, M.; Hadi, H.A.; Eltayeb, F.K.; Al-Hail, H.; Samuel, B.G.; Sultan, A.A.; Skariah, S. Epidemiology of multidrug-resistant Pseudomonas aeruginosa in the Middle East and North Africa Region. mSphere 2021, 6, e00202–e00221. [Google Scholar] [CrossRef]
  32. Pournajaf, A.; Ardebili, A.; Goudarzi, L.; Khodabandeh, M.; Narimani, T.; Abbaszadeh, H. PCR-based identification of methicillin–resistant Staphylococcus aureus strains and their antibiotic resistance profiles. Asian Pac. J. Trop. Biomed. 2014, 4, S293–S297. [Google Scholar] [CrossRef] [PubMed]
  33. Tefera, S.; Awoke, T.; Mekonnen, D. Methicillin and vancomycin resistant Staphylococcus aureus and associated factors from surgical ward inpatients at Debre Markos Referral Hospital, Northwest Ethiopia. Infect. Drug Resist. 2021, 14, 3053–3062. [Google Scholar] [CrossRef] [PubMed]
  34. Alani, H.A.; Hassawi, D.S.; Flayih, M.T. Patterns of antibiotic resistance in Staphylococcus aureus isolates and detection the heteroresistance to vancomycin by population analysis method. JUAPS 2017, 11, 26–33. [Google Scholar] [CrossRef]
  35. Moges, F.; Tamiru, T.; Amare, A.; Mengistu, G.; Eshetie, S.; Dagnew, M.; Feleke, T.; Gizachew, M.; Abebe, W. Prevalence of Methicillin-Resistant Staphylococcus aureus and Multidrug-Resistant Strains from Patients Attending the Referral Hospitals of Amhara Regional State, Ethiopia. Int. J. Microbiol. 2023, 2023, 3848073. [Google Scholar] [CrossRef]
  36. Zahan, N.A.; Hossain, M.A.; Musa, A.K.; Shamsuzzaman, A.K.; Mahamud, M.C.; Mamun, A.A.; Paul, S.K.; Ahmed, S.; Sumona, A.A.; Begum, Z.; et al. PCR for mecA gene of methicillin resistant Staphylococcus aureus. Mymensingh Med. J. 2009, 18, 21–26. [Google Scholar] [PubMed]
  37. Kobayashi, N.; Wu, H.; Kojima, K.; Taniguchi, K.; Urasawa, S.; Uehara, N.; Omizu, Y.; Kishi, Y.; Yagihashi, A.; Kurokawa, I. Detection of mecA, femA, and femB genes in clinical strains of using polymerase chain reaction. Epidemiol. Infect. 1994, 113, 259–266. [Google Scholar] [CrossRef]
  38. Garza-Gonzalez, E.; Morfin-Otero, R.; Llaca-Diaz, J.M.; Rodriguez-Noriega, E. Staphylococcal cassette chromosome mec (SCCmec) in methicillin-resistant coagulase-negative staphylococci. Epidemiol. Infect. 2010, 138, 645–654. [Google Scholar] [CrossRef]
  39. Zong, Z.; Peng, C.; Lü, X. Diversity of SCC mec elements in methicillin-resistant coagulase-negative staphylococci clinical isolates. PLoS ONE 2011, 6, e20191. [Google Scholar] [CrossRef]
  40. Berglund, C.; Söderquist, B. The origin of a methicillin-resistant Staphylococcus aureus isolate at a neonatal ward in Sweden—Possible horizontal transfer of a staphylococcal cassette chromosome mec between methicillin-resistant Staphylococcus haemolyticus and Staphylococcus aureus. Clin. Microbiol. Infect. 2008, 14, 1048–1056. [Google Scholar] [CrossRef]
  41. Wu, S.W.; de Lencastre, H.; Tomasz, A. Recruitment of the mecA gene homologue of Staphylococcus sciuri into a resistance determinant and expression of the resistant phenotype in Staphylococcus aureus. J. Bacteriol. 2001, 183, 2417–2424. [Google Scholar] [CrossRef]
  42. Bloemendaal, A.L.A.; Brouwer, E.C.; Fluit, A.C. Methicillin resistance transfer from Staphylocccus epidermidis to methicillin-susceptible Staphylococcus aureus in a patient during antibiotic therapy. PLoS ONE 2010, 5, e11841. [Google Scholar] [CrossRef] [PubMed]
  43. Miragaia, M. Factors Contributing to the Evolution of mecA-Mediated β-lactam Resistance in Staphylococci: Update and New Insights From Whole Genome Sequencing (WGS). Front. Microbiol. 2018, 9, 2723. [Google Scholar] [CrossRef]
  44. Sun, J.; Deng, Z.; Yan, A. Bacterial multidrug efflux pumps: Mechanisms, physiology and pharmacological exploitations. Biochem. Biophys. Res. 2014, 453, 254–267. [Google Scholar] [CrossRef] [PubMed]
  45. Zong, Z. Characterization of a complex context containing mecA but lacking genes encoding cassette chromosome recombinases in Staphylococcus haemolyticus. BMC Microbiol. 2013, 13, 64. [Google Scholar] [CrossRef] [PubMed]
  46. Elhassan, M.M.; Ozbak, H.A.; Hemeg, H.A.; Elmekki, M.A.; Ahmed, L.M. Absence of the mecA gene in methicillin resistant Staphylococcus aureus isolated from different clinical specimens in Shendi city, Sudan. BioMed. Res. Int. 2015, 2015, 895860. [Google Scholar] [CrossRef] [PubMed]
  47. McGuinness, W.A.; Malachowa, N.; DeLeo, F.R. Vancomycin Resistance in Staphylococcus aureus. Yale J. Biol. Med. 2017, 90, 269–281. [Google Scholar]
  48. Ezzeddine, Z.; Ghssein, G. Towards new antibiotics classes targeting bacterial metallophores. Microb. Pathog. 2023, 182, 106221. [Google Scholar] [CrossRef]
  49. Coates, A.R.; Hu, Y. Novel approaches to developing new antibiotics for bacterial infections. Br. J. Pharmacol. 2007, 152, 1147–1154. [Google Scholar] [CrossRef]
  50. Yang, X.; Zhao, J.; Wang, Y.; Wu, J.; Wang, X.; Wang, Y.; Zhang, Y.; Li, H. Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus in Hospitalized Patients in Eastern Heilongjiang Province, China. Infect. Drug Resist. 2021, 14, 1635–1643. [Google Scholar] [CrossRef]
  51. Mengesha, R.E.; Kasa, B.G.; Saravanan, M.; Berhe, D.F.; Wasihun, A.G. Aerobic bacteria in post surgical wound infections and pattern of their antimicrobial susceptibility in Ayder Teaching and Referral Hospital, Mekelle, Ethiopia. BMC Res. Notes 2014, 7, 575. [Google Scholar] [CrossRef]
  52. Bendary, M.M.; Solyman, S.M.; Azab, M.M.; Mahmoud, N.F.; Hanora, A.M. Genetic diversity of multidrug resistant Staphylococcus aureus isolated from clinical and non clinical samples in Egypt. Cell. Mol. Biol. 2016, 62, 55–61. [Google Scholar] [PubMed]
  53. Torres-Sangiao, E.; Leal Rodriguez, C.; García-Riestra, C. Application and Perspectives of MALDI–TOF Mass Spectrometry in Clinical Microbiology Laboratories. Microorganisms 2021, 9, 1539. [Google Scholar] [CrossRef] [PubMed]
  54. Hou, T.-Y.; Chiang-Ni, C.; Teng, S.-H. Current status of MALDI-TOF mass spectrometry in clinical microbiology. J. Food Drug Anal. 2019, 27, 404–414. [Google Scholar] [CrossRef] [PubMed]
  55. Clinical Laboratory Standard Institute. Performans Standards for Antimicrobial Susceptablity Testing, CLSI Supplement M100, 30th ed.; Clinical and Laboratory Standared Institiute: Wayne, PA, USA, 2021. [Google Scholar]
  56. Centers for Disease Control and Prevention. Laboratory Detection of Vancomycin-Intermediate/Resistant Staphylococcus aureus (VISA/VRSA); Centers for Disease Control and Prevention: Atlanta, GA, USA, 2006.
  57. Yamagishi, J.; Sato, Y.; Shinozaki, N.; Ye, B.; Tsuboi, A.; Nagasaki, M.; Yamashita, R. Comparison of boiling and robotics automation method in DNA extraction for metagenomic sequencing of human oral microbes. PLoS ONE 2016, 11, e0154389. [Google Scholar] [CrossRef]
  58. Perez-Roth, E.; Claverie-Martın, F.; Villar, J.; Mendez-Alvarez, S. Multiplex PCR for simultaneous identification of Staphylococcus aureus and detection of methicillin and mupirocin resistance. J. Clin. Microbiol. 2001, 39, 4037–4041. [Google Scholar] [CrossRef]
  59. Emamie, A.; Zolfaghari, P.; Zarei, A.; Ghorbani, M. Prevalence and antibiotic resistance of ESKAPE pathogens isolated from patients with bacteremia in Tehran, Iran. Indian J. Med. Spec. 2023, 14, 97. [Google Scholar]
  60. Al-Marzoqi, A.; Azize, H.; Al Dulaimi, T.; Ahmed, N. Phenotypic detection of resistance in Staphylococcus aureus isolates: Detection of (mec A and fem A) gene in methicillin resistant Staphylococcus aureus (MRSA) by Polymerase Chain Reaction. J. Nat. Sci. Res. 2014, 4, 112–118. [Google Scholar]
Antibiotics 12 01681 g001
Figure 1. Frequency of methicillin-resistant Staphylococci isolates from patients diagnosed with surgical site infection at four different hospitals in Ethiopia using MALDI-TOF MS between July 2020 and August 2021.
Figure 1. Frequency of methicillin-resistant Staphylococci isolates from patients diagnosed with surgical site infection at four different hospitals in Ethiopia using MALDI-TOF MS between July 2020 and August 2021.
Antibiotics 12 01681 g001
Antibiotics 12 01681 g002
Figure 2. Frequencies of MALDI-TOF MS identification and distribution of phenotypic methicillin-resistant Staphylococci and M. sciuri isolates at each hospital between July 2020 and August 2021. DTCSH: Debre Tabor Comprehensive Specialized Hospital; HUCSH: Hawassa University Comprehensive Specialized Hospital; JUTSH: Jimma University Teaching Specialized Hospital; TASH: Tikur Anbessa Specialized Hospital.
Figure 2. Frequencies of MALDI-TOF MS identification and distribution of phenotypic methicillin-resistant Staphylococci and M. sciuri isolates at each hospital between July 2020 and August 2021. DTCSH: Debre Tabor Comprehensive Specialized Hospital; HUCSH: Hawassa University Comprehensive Specialized Hospital; JUTSH: Jimma University Teaching Specialized Hospital; TASH: Tikur Anbessa Specialized Hospital.
Antibiotics 12 01681 g002
Antibiotics 12 01681 g003
Figure 3. Frequency and distribution of cefoxitin resistance and PCR-confirmed gene among each Staphylococci isolate in patient diagnosed with surgical site infection between July 2020 and August 2021.
Figure 3. Frequency and distribution of cefoxitin resistance and PCR-confirmed gene among each Staphylococci isolate in patient diagnosed with surgical site infection between July 2020 and August 2021.
Antibiotics 12 01681 g003
Antibiotics 12 01681 g004
Figure 4. (A,B) Agarose gel electrophoresis showing bands of femA and mecA genes of methicillin-resistant Staphylococcic strains from patients diagnosed with surgical site infection at four different hospitals in Ethiopia; lane M1: 100 bp molecular weight ladder; lane PC: positive control; lanes 1–40 are tested isolates, and positive amplification of femA and mecA is indicated by 132 bp and 310 bp PCR amplicons, respectively.
Figure 4. (A,B) Agarose gel electrophoresis showing bands of femA and mecA genes of methicillin-resistant Staphylococcic strains from patients diagnosed with surgical site infection at four different hospitals in Ethiopia; lane M1: 100 bp molecular weight ladder; lane PC: positive control; lanes 1–40 are tested isolates, and positive amplification of femA and mecA is indicated by 132 bp and 310 bp PCR amplicons, respectively.
Antibiotics 12 01681 g004
Antibiotics 12 01681 g005
Figure 5. Frequency and distribution of cefoxitin-resistant isolates and mecA and femA genes from the total number of Staphylococci and M. sciuri isolates at each hospital between July 2020 and August 2021. DTCSH: Debre Tabor Comprehensive Specialized Hospital; HUCSH: Hawassa University Comprehensive Specialized Hospital; JUTSH: Jimma University Teaching Specialized Hospital; TASH: Tikur Anbessa Specialized Hospital.
Figure 5. Frequency and distribution of cefoxitin-resistant isolates and mecA and femA genes from the total number of Staphylococci and M. sciuri isolates at each hospital between July 2020 and August 2021. DTCSH: Debre Tabor Comprehensive Specialized Hospital; HUCSH: Hawassa University Comprehensive Specialized Hospital; JUTSH: Jimma University Teaching Specialized Hospital; TASH: Tikur Anbessa Specialized Hospital.
Antibiotics 12 01681 g005
Table 1. Antibiotic resistance pattern of S. aureus isolates from patients diagnosed with surgical site infection at four different hospitals in Ethiopia between July 2020 and August 2021.
Table 1. Antibiotic resistance pattern of S. aureus isolates from patients diagnosed with surgical site infection at four different hospitals in Ethiopia between July 2020 and August 2021.
AntibioticsMethods N (%), % = N/752N (%), % = N/163AST Results Strain
CefoxitinI-Z ≥ 22 mm123 (16.4)123 (75.5)SMSSA
≤21 mm40 (5.3)40 (24.5)RMRSA
Abbreviations: S, susceptible; R, resistant; I, intermediate; I-Z, inhibition zone; MSSA, methicillin-sensitive S. aureus; MRSA, methicillin-resistant S. aureus; AST, antimicrobial susceptibility test.
Table 2. Socio-demographic characteristics and clinical data of S. aureus among patients diagnosed with SSI at four different hospitals in Ethiopia from July 2020 to August 2021.
Table 2. Socio-demographic characteristics and clinical data of S. aureus among patients diagnosed with SSI at four different hospitals in Ethiopia from July 2020 to August 2021.
Variables/CharacteristicsFrequency of S. aureus (%)
GenderMale 95 (58.3)
Female68 (41.7)
Age in (years)≤1825 (20.9)
19–4077 (54)
41–6019 (13.5)
≥6142 (11.7)
Surgical site infectionSuperficial79 (48.5)
Deep 84 (51.5)
Preoperative hospital stays<777 (47.2)
≥786 (52.8)
Previous use of antibioticsYes 79 (48.5)
No 84 (51.5)
SmokingYes 16 (9.8)
No 147 (90.1)
AlcoholicYes 48 (29.4)
No 115 (70.6)
Nature of surgeryEmergency
Elective		55 (68.1)
108 (31.9)
Type of surgeryClean/Clean contaminated surgery148 (90.8)
Contaminated surgery 15 (9.2)
Timing of surgical antimicrobial prophylaxisBefore the operation59 (36.2)
During the operation104 (63.8)
Duration of operation<1 h100 (52.8)
≥1 h63 (47.2)
Table 3. Bivariate and multivariate analysis for identification of methicillin resistance Staphylococci predictors among patients diagnosed with surgical site infection at four different hospitals in Ethiopia from July 2020 to August 2021.
Table 3. Bivariate and multivariate analysis for identification of methicillin resistance Staphylococci predictors among patients diagnosed with surgical site infection at four different hospitals in Ethiopia from July 2020 to August 2021.
CharacteristicsBacterial Growthp-ValueCrude-OR (95%CI)Adjusted-OR (95%CI)p-Value
MRSAMSSA
GenderMale29 (17.8)66 (40.5)0.0392.276 (1.0444–4.9633)1.638 (0.597–4.489)0.337
Female11 (6.7)57 (35) 1
Age in (years)≤182 (1.2)23 (14.1)0.0002.788 (1.8716–4.154)0.556 (0.1014–3.046)0.499
19–4011 (6.7)66 (40.5) 1
41–602 (1.2)17 (10.4) 1.556 (0.259–9.328)0.628
≥6125 (15.3)17 (10.4) 3.729 (1.179–11.791)0.025
Preoperative hospital stays≤713 (8)64 (39.3)0.0342.253 (1.064–4.771)1
>727 (16.7)59 (36.2) 1.856 (0.688–5.311)0.000
Previous use of antibioticsYes26 (16)53 (32.5) 3.692 (1.059–2.800)0.025
No14 (8.9)70 (42.9)0.0013.256 (1.724–7.634)1
History of alcohol intakeYes18 (11)30 (18.4) 1.075 (0.1331–8.6925)0.945
No22 (13.5)93 (57.1)0.0152.536 (1.202–5.351)1
Nature of surgeryElective16 (9.8)92 (56.4) 1
Emergency24 (14.7)31 (19)0.0004.452 (2.098–9.445)1.962 (0.0619–6.224)0.000
Timing of surgical antimicrobial prophylaxisBefore the operation7 (4.3)57 (35) 1
After the operation33 (20.2)71(43.6)0.0063.453 (2.098–9.445)3.066 (1.001–9.392)0.05
Duration of operation≤1 h19 (11.7)81 (49.7) 1
>1 h21 (12.9)42 (25.8)0.0042.132 (1.034–4.396)1.890 (0.6321–5.652)0.235
Bold: p-value statistically significant association.
Table 4. Presentation of the cefoxitin and vancomycin resistance patterns of mecA carrying Staphylococci, and the distribution of femA and van genes among patients diagnosed with SSI at four different hospitals in Ethiopia from July 2020 to August 2021.
Table 4. Presentation of the cefoxitin and vancomycin resistance patterns of mecA carrying Staphylococci, and the distribution of femA and van genes among patients diagnosed with SSI at four different hospitals in Ethiopia from July 2020 to August 2021.
Lane (mecApos)MALDI-TOF MSStudy SiteCefoxitinVancomycin femAmecAvanA and vanB
1S. aureusDTCSHRSPosPosNeg
5S. aureusJUTSHRSPosPosNeg
7M. sciuriDTCSHRSPosPosNeg
11S. haemolyticusDTCSHRRPosPosNeg
12S. warneriDTCSHRSPosPosNeg
18S. aureusTASHRSPosPosNeg
19S. aureusHUCSHRSPosPosNeg
23M. sciuriDTCSHRSPosPosNeg
24M. sciuriDTCSHRSPos PosNeg
29M. sciuriDTCSHRSPosPosNeg
31M. sciuriDTCSHRSNeg PosNeg
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Worku, S.; Abebe, T.; Seyoum, B.; Alemu, A.; Shimelash, Y.; Yimer, M.; Abdissa, A.; Beyene, G.T.; Swedberg, G.; Mihret, A. Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus among Patients Diagnosed with Surgical Site Infection at Four Hospitals in Ethiopia. Antibiotics 2023, 12, 1681. https://doi.org/10.3390/antibiotics12121681

AMA Style

Worku S, Abebe T, Seyoum B, Alemu A, Shimelash Y, Yimer M, Abdissa A, Beyene GT, Swedberg G, Mihret A. Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus among Patients Diagnosed with Surgical Site Infection at Four Hospitals in Ethiopia. Antibiotics. 2023; 12(12):1681. https://doi.org/10.3390/antibiotics12121681

Chicago/Turabian Style

Worku, Seble, Tamrat Abebe, Berhanu Seyoum, Ashenafi Alemu, Yidenek Shimelash, Marechign Yimer, Alemseged Abdissa, Getachew Tesfaye Beyene, Göte Swedberg, and Adane Mihret. 2023. "Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus among Patients Diagnosed with Surgical Site Infection at Four Hospitals in Ethiopia" Antibiotics 12, no. 12: 1681. https://doi.org/10.3390/antibiotics12121681

APA Style

Worku, S., Abebe, T., Seyoum, B., Alemu, A., Shimelash, Y., Yimer, M., Abdissa, A., Beyene, G. T., Swedberg, G., & Mihret, A. (2023). Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus among Patients Diagnosed with Surgical Site Infection at Four Hospitals in Ethiopia. Antibiotics, 12(12), 1681. https://doi.org/10.3390/antibiotics12121681

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop