Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria
Abstract
1. Introduction
2. Results
2.1. Isolation and Identification of Presumptive Antibiotic-Resistant GNB
2.2. Antimicrobial Susceptibility Testing
2.3. Phenotypic and Molecular Characterisation of β-Lactamase and mcr Genes
2.4. Conjugation Experiments
2.5. Multi-Locus Sequence Typing
3. Discussion
4. Materials and Methods
4.1. Sample Collection
4.2. Isolation and Identification of β-Lactams and Colistin-Resistant GNB
4.3. Antimicrobial Susceptibility Testing
4.4. Phenotypic and Molecular Characterisation of β-Lactamases and mcr Genes
4.5. Conjugation Experiments
4.6. Multi-Locus Sequence Typing Analysis
4.7. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Hoek, A.H.; Veenman, C.; Van Overbeek, W.M.; Lynch, G.; De Roda Husman, A.M.; Blaak, H. Prevalence and characterization of ESBL- and AmpC-producing Enterobacteriaceae on retail vegetables. Int. J. Food Microbiol. 2015, 204, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holzel, C.S.; Tetens, J.L.; Schwaiger, K. Unraveling the Role of Vegetables in Spreading Antimicrobial-Resistant Bacteria: A Need for Quantitative Risk Assessment. Foodborne Pathog. Dis. 2018, 15, 671–688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iseppi, R.; De Nu, S.; Bondi, M.; Messi, P.; Sabia, C. Extended-Spectrum β-Lactamase, AmpC, and MBL-Producing Gram-Negative Bacteria on Fresh Vegetables and Ready-to-Eat Salads Sold in Local Markets. Microb. Drug Resist. 2018, 24, 1156–1164. [Google Scholar] [CrossRef] [Scilit]
- Liu, B.T.; Song, F.J. Emergence of two Escherichia coli strains co-harboring mcr-1 and bla (NDM) in fresh vegetables from China. Infect. Drug Resist. 2019, 12, 2627–2635. [Google Scholar] [CrossRef] [Scilit]
- Stockwell, V.O.; Duffy, B. Use of antibiotics in plant agriculture. Rev. Sci. Tech. 2012, 31, 199–210. [Google Scholar] [CrossRef] [Scilit]
- Zalewska, M.; Blazejewska, A.; Czapko, A.; Popowska, M. Antibiotics and Antibiotic Resistance Genes in Animal Manure—Consequences of Its Application in Agriculture. Front. Microbiol. 2021, 12, 610656. [Google Scholar] [CrossRef] [Scilit]
- Berger, C.N.; Sodha, S.V.; Shaw, R.K.; Griffin, P.M.; Pink, D.; Hand, P.; Frankel, G. Fresh fruit and vegetables as vehicles for the transmission of human pathogens. Environ. Microbiol. 2010, 12, 2385–2397. [Google Scholar] [CrossRef] [Scilit]
- Van, D.D.; Doi, Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence 2017, 8, 460–469. [Google Scholar]
- Touati, A.; Mairi, A. Epidemiology of carbapenemase-producing Enterobacterales in the Middle East: A systematic review. Expert Rev. Anti. Infect. Ther. 2020, 18, 241–250. [Google Scholar] [CrossRef] [Scilit]
- Lutgring, J.D. Carbapenem-resistant Enterobacteriaceae: An emerging bacterial threat. Semin. Diagn. Pathol. 2019, 36, 182–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Son, S.J.; Huang, R.; Squire, C.J.; Leung, I.K.H. MCR-1: A promising target for structure-based design of inhibitors to tackle polymyxin resistance. Drug. Discov. Today 2019, 24, 206–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caniaux, I.; Van, B.A.; Zambardi, G.; Poirel, L.; Gros, M.F. MCR: Modern colistin resistance. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 415–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.T.; Zhang, X.Y.; Wan, S.W.; Hao, J.J.; Jiang, R.D.; Song, F.J. Characteristics of Carbapenem-Resistant Enterobacteriaceae in Ready-to-Eat Vegetables in China. Front. Microbiol. 2018, 9, 1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anyanwu, M.U.; Jaja, I.F.; Nwobi, O.C. Occurrence and Characteristics of Mobile Colistin Resistance (mcr) Gene-Containing Isolates from the Environment: A Review. Int. J. Environ. Res. Public Health. 2020, 17, 1028. [Google Scholar] [CrossRef] [Scilit]
- Chelaghma, W.; Loucif, L.; Bendahou, M.; Rolain, J.M. Vegetables and Fruit as a Reservoir of β-Lactam and Colistin-Resistant Gram-Negative Bacteria: A Review. Microorganisms 2021, 9, 2534. [Google Scholar] [CrossRef] [Scilit]
- Luo, J.; Yao, X.; Lv, L.; Doi, Y.; Huang, X.; Huang, S.; Liu, J.H. Emergence of mcr-1 in Raoultella ornithinolytica and Escherichia coli Isolates from Retail Vegetables in China. Antimicrob. Agents Chemother. 2017, 61, e01139-17. [Google Scholar] [CrossRef] [Scilit]
- Blaak, H.; Van Hoek, A.H.; Veenman, C.; Docters Van Leeuwen, A.E.; Lynch, G.; Van Overbeek, W.M.; De Roda Husman, A.M. Extended spectrum β-lactamase- and constitutively AmpC-producing Enterobacteriaceae on fresh produce and in the agricultural environment. Int. J. Food Microbiol. 2014, 169, 8–16. [Google Scholar] [CrossRef] [Scilit]
- Touati, A.; Mairi, A.; Baloul, Y.; Lalaoui, R.; Bakour, S.; Thighilt, L.; Gharout, A.; Rolain, J.M. First detection of Klebsiella pneumoniae producing OXA-48 in fresh vegetables from Béjaia city, Algeria. J. Glob. Antimicrob. Resist. 2017, 9, 17–18. [Google Scholar] [CrossRef] [Scilit]
- Mesbah, Z.F.; Granier, S.A.; Touati, A.; Millemann, Y. Occurrence of Third-Generation Cephalosporins-Resistant Klebsiella pneumoniae in Fresh Fruits and Vegetables Purchased at Markets in Algeria. Microb. Drug. Resist. 2020, 26, 353–359. [Google Scholar] [CrossRef] [Scilit]
- Berrazeg, M.; Drissi, M.; Medjahed, L.; Rolain, J.M. Hierarchical clustering as a rapid tool for surveillance of emerging antibiotic-resistance phenotypes in Klebsiella pneumoniae strains. J. Med. Microbiol. 2013, 62, 864–874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mogren, L.; Windstam, S.; Boqvist, S.; Vagsholm, I.; Söderqvist, K.; Rosberg, A.K.; Lindén, J.; Mulaosmanovic, E.; Karlsson, M.; Uhlig, E.; et al. The Hurdle Approach-A Holistic Concept for Controlling Food Safety Risks Associated with Pathogenic Bacterial Contamination of Leafy Green Vegetables. A Review. Front. Microbiol. 2018, 9, 1965. [Google Scholar] [CrossRef] [Scilit]
- Erhirhie, E.O.; Omoirri, M.A.; Chikodiri, S.C.; Ujam, T.N.; Kesiena, E.E.; Oseyomon, J.O. Evaluation of microbial quality of vegetables and fruits in Nigeria: A review. Int. J. Nutr. Sci. 2020, 5, 99–108. [Google Scholar]
- Fernandez-Bravo, A.; Figueras, M.J. An Update on the Genus Aeromonas: Taxonomy, Epidemiology, and Pathogenicity. Microorganisms 2020, 8, 129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Enoch, D.A.; Birkett, C.I.; Ludlam, H.A. Non-fermentative Gram-negative bacteria. Int. J. Antimicrob. Agents 2007, 29 (Suppl. 3), S33–S41. [Google Scholar] [CrossRef] [Scilit]
- Ullah, S.; Mehmood, H.; Pervin, N.; Zeb, H.; Kamal, K.R.; Liaqat, S. Shewanella putrefaciens: An Emerging Cause of Nosocomial Pneumonia. J. Investig. Med. High Impact Case Rep. 2018, 6, 2324709618775441. [Google Scholar] [CrossRef] [Scilit]
- Zurfluh, K.; Nuesch-Inderbinen, M.; Morach, M.; Zihler, B.A.; Hachler, H.; Stephan, R. Extended-spectrum-β-lactamase-producing Enterobacteriaceae isolated from vegetables imported from the Dominican Republic, India, Thailand, and Vietnam. Appl. Environ. Microbiol. 2015, 81, 3115–3120. [Google Scholar] [CrossRef] [Scilit]
- Marti, R.; Scott, A.; Tien, Y.C.; Murray, R.; Sabourin, L.; Zhang, Y.; Topp, E. Impact of manure fertilization on the abundance of antibiotic-resistant bacteria and frequency of detection of antibiotic resistance genes in soil and on vegetables at harvest. Appl. Environ. Microbiol. 2013, 79, 5701–5709. [Google Scholar] [CrossRef] [Scilit]
- Lahlaoui, H.; Ben Haj, K.A.; Ben Moussa, M. Epidemiology of Enterobacteriaceae producing CTX-M type extended spectrum β-lactamase (ESBL). Med. Mal. Infect. 2014, 44, 400–404. [Google Scholar] [CrossRef] [Scilit]
- Peirano, G.; Pitout, J.D.D. Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae: Update on Molecular Epidemiology and Treatment Options. Drugs 2019, 79, 1529–1541. [Google Scholar] [CrossRef] [Scilit]
- Antwi-Agyei, P.; Cairncross, S.; Peasey, A.; Price, V.; Bruce, J.; Baker, K.; Moe, C.; Ampofo, J.; Armah, G.; Ensink, J. A Farm to Fork Risk Assessment for the Use of Wastewater in Agriculture in Accra, Ghana. PLoS ONE 2015, 10, e0142346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makkaew, P.; Miller, M.; Fallowfield, H.J.; Cromar, N.J. Microbial risk in wastewater irrigated lettuce: Comparing Escherichia coli contamination from an experimental site with a laboratory approach. Water Sci. Technol. 2016, 74, 749–755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zurfluh, K.; Poirel, L.; Nordmann, P.; Klumpp, J.; Stephan, R. First detection of Klebsiella variicola producing OXA-181 carbapenemase in fresh vegetable imported from Asia to Switzerland. Antimicrob. Resist. Infect. Control. 2015, 4, 38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moffatt, J.H.; Harper, M.; Boyce, J.D. Mechanisms of Polymyxin Resistance. Adv. Exp. Med. Biol. 2019, 1145, 55–71. [Google Scholar]
- Kumar, H.; Chen, B.H.; Kuca, K.; Nepovimova, E.; Kaushal, A.; Nagraik, R.; Bhatia, S.K.; Dhanjal, D.S.; Kumar, V.; Kumar, A.; et al. Understanding of Colistin Usage in Food Animals and Available Detection Techniques: A Review. Animals 2020, 10, 1892. [Google Scholar] [CrossRef] [Scilit]
- Oh, S.S.; Song, J.; Kim, J.; Shin, J. Increasing prevalence of multidrug-resistant mcr-1-positive Escherichia coli isolates from fresh vegetables and healthy food animals in South Korea. Int. J. Infect. Dis. 2020, 92, 53–55. [Google Scholar] [CrossRef] [Scilit]
- Manageiro, V.; Jones-Dias, D.; Ferreira, E.; Caniça, M. Plasmid-Mediated Colistin Resistance (mcr-1) in Escherichia coli from Non-Imported Fresh Vegetables for Human Consumption in Portugal. Microorganisms 2020, 8, 429. [Google Scholar] [CrossRef] [Scilit]
- Zurfuh, K.; Poirel, L.; Nordmann, P.; Nuesch-Inderbinen, M.; Hachler, H.; Stephan, R. Occurrence of the Plasmid-Borne mcr-1 Colistin Resistance Gene in Extended-Spectrum-β-Lactamase-Producing Enterobacteriaceae in River Water and Imported Vegetable Samples in Switzerland. Antimicrob. Agents Chemother. 2016, 60, 2594–2595. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Yao, X.; Luo, J.; Lv, L.; Zeng, Z.; Liu, J.H. Emergence of Escherichia coli co-producing NDM-1 and KPC-2 carbapenemases from a retail vegetable, China. J. Antimicrob. Chemother. 2018, 73, 252–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, B.T.; Li, X.; Zhang, Q.; Shan, H.; Zou, M.; Song, F.J. Colistin-Resistant mcr-Positive Enterobacteriaceae in Fresh Vegetables, an Increasing Infectious Threat in China. Int. J. Antimicrob. Agents 2019, 54, 89–94. [Google Scholar] [CrossRef] [Scilit]
- Anssour, L.; Messai, Y.; Estepa, V.; Torres, C.; Bakour, R. Characteristics of ciprofloxacin-resistant Enterobacteriaceae isolates recovered from wastewater of an Algerian hospital. J. Infect. Dev. Ctries. 2016, 10, 728–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mantilla-Calderon, D.; Jumat, M.R.; Wang, T.; Ganesan, P.; Al-Jassim, N.; Hong, P.Y. Isolation and Characterization of NDM-Positive Escherichia coli from Municipal Wastewater in Jeddah, Saudi Arabia. Antimicrob. Agents Chemother. 2016, 60, 5223–5231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Said, L.; Jouini, A.; Alonso, C.A.; Klibi, N.; Dziri, R.; Boudabous, A.; Ben Slama, K.; Torres, C. Characteristics of extended-spectrum β-lactamase (ESBL)- and pAmpC beta-lactamase-producing Enterobacteriaceae of water samples in Tunisia. Sci. Total. Environ. 2016, 550, 1103–1109. [Google Scholar] [CrossRef] [Scilit]
- Toleman, M.A.; Bugert, J.J.; Nizam, S.A. Extensively drug-resistant New Delhi metallo-β-lactamase-encoding bacteria in the environment, Dhaka, Bangladesh, 2012. Emerg. Infect. Dis. 2015, 21, 1027–1030. [Google Scholar] [CrossRef] [Scilit]
- Hassan, J.; Eddine, R.Z.; Mann, D.; Li, S.; Deng, X.; Saoud, I.P.; Kassem, I.I. The Mobile Colistin Resistance Gene, mcr-1.1, Is Carried on IncX4 Plasmids in Multidrug Resistant E. coli Isolated from Rainbow Trout Aquaculture. Microorganisms 2020, 8, 1636. [Google Scholar] [CrossRef] [Scilit]
- Decraene, V.; Phan, H.T.T.; George, R.; Wyllie, D.H.; Akinremi, O.; Aiken, Z.; Cleary, P.; Dodgson, A.; Pankhurst, L.; Crook, D.W.; et al. A Large, Refractory Nosocomial Outbreak of Klebsiella pneumoniae Carbapenemase-Producing Escherichia coli Demonstrates Carbapenemase Gene Outbreaks Involving Sink Sites Require Novel Approaches to Infection Control. Antimicrob. Agents Chemother. 2018, 62, e01689-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adegoke, A.A.; Amoah, I.D.; Stenstrom, T.A.; Verbyla, M.E.; Mihelcic, J.R. Epidemiological Evidence and Health Risks Associated with Agricultural Reuse of Partially Treated and Untreated Wastewater: A Review. Front. Public Health 2018, 6, 337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seng, P.; Drancourt, M.; Gouriet, F.; La Page, S.B.; Fournier, P.E.; Rolain, J.M.; Raoult, D. Ongoing revolution in bacteriology: Routine identification of bacteria by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Clin. Infect. Dis. 2009, 49, 543–551. [Google Scholar] [CrossRef] [Scilit]
- Available online: https://www.sfm-microbiologie.org/wp-content/uploads/2019/02/CASFM2019_V1.0.pdf (accessed on March 2019).
- Available online: https://www.eucast.org (accessed on December 2019).
- Bakour, S.; Garcia, V.; Loucif, L.; Brunel, J.M.; Gharout-Sait, A.; Touati, A.; Rolain, J.M. Rapid identification of carbapenemase-producing Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii using a modified Carba NP test. New Microbes New Infect. 2015, 7, 89–93. [Google Scholar] [CrossRef] [Scilit]
- Gupta, S.K.; Padmanabhan, B.R.; Diene, S.M.; Lopez-Rojas, R.; Kempf, M.; Landraud, L.; Rolain, J.M. ARG-ANNOT, a new bioinformatic tool to discover antibiotic resistance genes in bacterial genomes. Antimicrob. Agents Chemother. 2014, 58, 212–220. [Google Scholar] [CrossRef] [Scilit]
- Yousfi, H.; Hadjadj, L.; Dandachi, I.; Lalaoui, R.; Merah, A.; Amoura, K.; Dahi, A.; Dekhil, M.; Messalhi, N.; Diene, S.M.; et al. Colistin- and Carbapenem-Resistant Klebsiella pneumoniae Clinical_Isolates: Algeria. Microb. Drug. Resist. 2019, 25, 258–263. [Google Scholar] [CrossRef] [Scilit]
- Diene, S.M.; Bruder, N.; Raoult, D.; Rolain, J.M. Real-time PCR assay allows detection of the New Delhi metallo-β-lactamase (NDM-1)-encoding gene in France. Int. J. Antimicrob. Agents 2011, 37, 544–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mesli, E.; Berrazeg, M.; Drissi, M.; Bekkhoucha, S.N.; Rolain, J.M. Prevalence of carbapenemase-encoding genes including New Delhi metallo-β-lactamase in Acinetobacter species, Algeria. Int. J. Infect. Dis. 2013, 17, e739–e743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ly, T.D.A.; Hadjadj, L.; Hoang, V.T.; Louni, M.; Dao, T.L.; Badiaga, S.; Tissot-Dupont, H.; Raoult, D.; Rolain, J.M.; Gautret, P. Low prevalence of resistance genes in sheltered homeless population in Marseille, France, 2014–2018. Infect. Drug. Resist. 2019, 12, 1139–1151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nabti, L.Z.; Sahli, F.; Ngaiganam, E.P.; Radji, N.; Mezaghcha, W.; Lupande-Mwenebitu, D.; Baron, S.A.; Rolain, J.M.; Diene, S.M. Development of real-time PCR assay allowed describing the first clinical Klebsiella pneumoniae isolate harboring plasmid-mediated colistin resistance mcr-8 gene in Algeria. J. Glob. Antimicrob. Resist. 2020, 20, 266–271. [Google Scholar] [CrossRef] [Scilit]
- Roschanski, N.; Fischer, J.; Guerra, B.; Roesler, U. Development of a multiplex real-time PCR for the rapid detection of the predominant beta-lactamase genes CTX-M, SHV, TEM and CIT-type AmpCs in Enterobacteriaceae. PLoS ONE 2014, 9, e100956. [Google Scholar] [CrossRef] [Scilit]
- Hong, J.S.; Yoon, E.J.; Lee, H.; Jeong, S.H.; Lee, K. Clonal Dissemination of Pseudomonas aeruginosa Sequence Type 235 Isolates Carrying blaIMP-6 and Emergence of blaGES-24 and blaIMP-10 on Novel Genomic Islands PAGI-15 and -16 in South Korea. Antimicrob. Agents Chemother. 2016, 60, 7216–7223. [Google Scholar] [CrossRef] [Scilit]
- Jeon, B.C.; Jeong, S.H.; Bae, I.K.; Kwon, S.B.; Lee, K.; Young, D.; Lee, J.H.; Song, J.S.; Lee, S.H. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23 beta-lactamase in korea. J. Clin. Microbiol. 2005, 43, 2241–2245. [Google Scholar] [CrossRef] [Scilit]
- Mathlouthi, N.; Al-Bayssari, C.; El Salabi, A.; Bakour, S.; Ben Gwierif, S.; Zorgani, A.A.; Jridi, Y.; Ben Slama, K.; Rolain, J.M.; Chouchani, C. Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J. Infect. Dev. Ctries. 2016, 10, 718–727. [Google Scholar] [CrossRef] [Scilit]
- Chabou, S.; Leangapichart, T.; Okdah, L.; Le Page, S.; Hadjadj, L.; Rolain, J.M. Real-time quantitative PCR assay with Taqman® probe for rapid detection of MCR-1 plasmid-mediated colistin resistance. New Microbes New Infect. 2016, 13, 71–74. [Google Scholar] [CrossRef] [Scilit]
- Carattoli, A.; Garcia-Fernandez, A.; Varesi, P.; Fortini, D.; Gerardi, S.; Penni, A.; Mancini, C.; Giordano, A. Molecular epidemiology of Escherichia coli producing extended-spectrum beta-lactamases isolated in Rome, Italy. J. Clin. Microbiol. 2008, 46, 103–108. [Google Scholar] [CrossRef] [Scilit]
- Yu, Y.; Ji, S.; Chen, Y.; Zhou, W.; Wei, Z.; Li, L.; Ma, Y. Resistance of strains producing extended-spectrum beta-lactamases and genotype distribution in China. J. Infect. 2007, 54, 53–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yagi, T.; Kurokawa, H.; Shibata, N.; Shibayama, K.; Arakawa, Y. A preliminary survey of extended-spectrum beta-lactamases (ESBLs) in clinical isolates of Klebsiella pneumoniae and Escherichia coli in Japan. FEMS Microbiol. Lett. 2000, 184, 53–56. [Google Scholar] [PubMed]
- Bendjama, E.; Loucif, L.; Chelaghma, W.; Attal, C.; Bellakh, F.Z.; Benaldjia, R.; Kahlat, I.; Meddour, A.; Rolain, J.M. First detection of an OXA-48-producing Enterobacter cloacae isolate from currency coins in Algeria. J. Glob. Antimicrob. Resist. 2020, 23, 162–166. [Google Scholar] [CrossRef] [Scilit]
- Available online: http://mlst.warwick.ac.uk/mlst/dbs/Ecoli (accessed on October 2020).
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kimura, M.A. simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Bacterial Categories | Species Identification | Species Abundance | Antibiotics | Antibiotic Resistance Percentage |
|---|---|---|---|---|
| Fermenting isolates | Citrobacter freundii | 20.90% | Amoxicillin | 96.23% |
| Klebsiella pneumoniae | 11.94% | Cefoxitin | 60.38% | |
| Enterobacter cloacae | 11.94% | Cefotaxime | 75.47% | |
| Escherichia coli | 8.96% | Ceftazidime | 62.26% | |
| Citrobacter braakii | 8.96% | Cefepime | 39.62% | |
| Aeromonas hydrophila | 2.99% | Aztreonam | 50.94% | |
| Serratia marcescens | 2.99% | Amoxicillin/clavulanate | 79.25% | |
| Aeromonas caviae | 1.49% | Ertapenem | 20.75% | |
| Aeromonas eucrenophila | 1.49% | Imipenem | 1.89% | |
| Raoultella ornithinolytica | 1.49% | Tobramycin | 20.75% | |
| Proteus mirabilis | 1.49% | Gentamicin | 16.98% | |
| Serratia rubidaea | 1.49% | Amikacin | 3.77% | |
| Serratia odorifera | 1.49% | Ciprofloxacin | 26.42% | |
| Providencia rettgeri | 1.49% | Colistin | 37.73% | |
| Non-fermenting isolates | Stenotrophomonasmaltophilia | 10.45% | Ticarcillin | 92.86% |
| Shewanella putrefaciens | 2.99% | Ceftazidime | 78.57% | |
| Acinetobacter pittii | 1.49% | Cefepime | 50% | |
| Pseudomonas aeruginosa | 1.49% | Aztreonam | 85.71% | |
| Ticarcillin/clavulanate | 92.86% | |||
| Pseudomonas rhodesiae | 1.49% | Imipenem | 78.57% | |
| Tobramycin | 21.43% | |||
| Pseudomonas alcaligenes | 1.49% | Gentamicin | 7.14% | |
| Amikacin | 7.14% | |||
| Rhizobium radiobacter | 1.49% | Ciprofloxacin | 0% | |
| Colistin | 0% |
| Gene Name | Type of PCR | Primers | Primer Sequence (5′->3′) | References |
|---|---|---|---|---|
| blaKPC | Real-time PCR | KPC-F | GATACCACGTTCCGTCTGGA | [52] |
| KPC-R | GGTCGTGTTTCCCTTTAGCC | |||
| KPC-Probe | 6-FAM-CGCGCGCCGTGACGGA AAGC-TAMRA | |||
| blaVIM | Real-time PCR | VIM-F | CACAGYGGCMCTTCTCGCGGAGA | |
| VIM-R | GCGTACGTYGCCACYCCAGCC | |||
| VIM-Probe | 6-FAM-AGTCTCCACGCACTTTCATGA CGACCGCGTCGGCG-TAMR | |||
| blaNDM | Real-time PCR | NDM-1 F | GCGCAACACAGCCTGACTTT | [53] |
| NDM-1 R | CAGCCACCAAAAGCGATGTC | |||
| NDM-1- Probe | 6-FAM-CAACCGCGCCCAACTTTGGC-TAMRA | |||
| blaOXA-48 | Real-time PCR | OXA48-RT-F | TCTTAAACGGGCGAACCAAG | [52] |
| OXA48-RT-R | GCGTCTGTCCATCCCACTTA | |||
| OXA48-RT-Probe | 6-FAM-AGCTTGATCGCCCTCG ATTTGG-TAMRA | |||
| blaOXA-23 | Real-time PCR | OXA-23-F | TGCTCTAAGCCGCGCAAATA | [54] |
| OXA-23-R | TGACCTTTTCTCGCCCTTCC | |||
| OXA-23- probe | FAM- GCCCTGATCGGATTGGAGAACCA-TAMRA | |||
| blaOXA-24 | Real-time PCR | OXA-24-F | CAAATGAGATTTTCAAATGGGATGG | |
| OXA-24–R | TCCGTCTTGCAAGCTCTTGAT | |||
| OXA-24- probe | FAM- GGTGAGGCAATGGCATTGTCAGCA-TAMRA | |||
| blaOXA-58 | Real-time PCR | OXA-58-F | CGCAGAGGGGAGAATCGTCT | |
| OXA-58-R | TTGCCCATCTGCCTTTTCAA | |||
| OXA-58- probe | FAM-GGGGAATGGCTGTAGACCCGC-TAMRA | |||
| mcr-1-2 | Real-time PCR | mcr-1–2-F | CTGTGCCGTGTATGTTCAGC | [55] |
| mcr-1–2-R | TTATCCATCACGCCTTTTGAG | |||
| Probe (mcr-1–2) | FAM-TATGATGTCGATACCGCCAAATACC-TAMRA | |||
| Probe (mcr-2) | VIC-TGACCGCTTGGGTGTGGGTA-TAMRA | |||
| mcr-3 | Real-time PCR | mcr-3-F | TGAATCACTGGGAGCATTAGGGC | [55] |
| mcr-3-R | TGCTGCAAACACGCCATATCAAC | |||
| mcr-3- probe | FAM-TGCACCGGATGATCAGACCCGT-TAMRA | |||
| mcr-4 | Real-time PCR | mcr-4-F | GCCAACCAATGCTCATACCCAAAA | |
| mcr-4-R | CCGCCCCATTCGTGAAAACATAC | |||
| mcr-4- probe | FAM-GCCACGGCGGTGTCTCTACCC-TAMRA | |||
| mcr-5 | Real-time PCR | mcr-5-F | TATCCCGCAAGCTACCGACGC | |
| mcr-5-R | ACGGGCAAGCACATGATCGGT | |||
| mcr-5- probe | FAM-TGCGACACCACCGATCTGGCCA-TAMRA | |||
| mcr-8 | Real-time PCR | mcr-8-F | TCCGGGATGCGTGACGTTGC | [56] |
| mcr-8-R | TGCTGCGCGAATGAAGACGA | |||
| mcr-8- probe | FAMTCATGGAGAATCGCTGGGGGAAAGC-TAMRA | |||
| blaCTX-M | Real-time PCR group A | CTX-A-F | CGGGCRATGGCGCARAC | [57] |
| CTX-A-R | TGCRCCGGTSGTATTGCC | |||
| CTX-A- probe | Yakima Yellow-CCARCGGGCGCAGYTGGTGAC-BHQ1 | |||
| Real-time PCR group B | CTX-B-F | ACCGAGCCSACGCTCAA | ||
| CTX-B-R | CCGCTGCCGGTTTTATC | |||
| CTX-B- probe | Yakima Yellow- CCCGCGYGATACCACCACGC-BHQ1 | |||
| blaSHV | Real-time PCR | SHV-F | TCCCATGATGAGCACCTTTAAA | |
| SHV-R | TCCTGCTGGCGATAGTGGAT | |||
| SHV- probe | Cy5-TGCCGGTGACGAACAGCTGGAG-BBQ-650 | |||
| blaTEM | Real-time PCR | TEM-F. | GCATCTTACGGATGGCATGA | |
| TEM-R | GTCCTCCGATCGTTGTCAGAA | |||
| TEM- probe | 6-Fam CAGTG CTGCCATAACCA TGAGTGA-BHQ-1 | |||
| OprD | Standard PCR | oprD-F | GGAACCTCAACTATCGCCAAG | [58] |
| oprD-R | GTTGCCTGTCGGTCGATTAC | |||
| blaVIM | Standard PCR | VIM-F | ATTGGTCTATTTGACCGCGTC | [59] |
| VIM-R | TGCTACTCAACGACTGCGCG | |||
| blaOXA-48 | Standard PCR | OXA-48-F | TTGGTGGCATCGATTATCGG | [60] |
| OXA-48-R | GAGCACTTCTTTTGTGATGGC | |||
| mcr-1 | Standard PCR | mcr-1-F | GCAGCATACTTCTGTGTGGTAC | [61] |
| mcr-1-R | TATGCACGCGAAAGAAACTGGC | |||
| blaCTX-M | Standard PCR | CTX-M-1-F | CCCATGGTTAAAAAATCACTGC | [62] |
| CTX-M-1-R | CAGCGCTTTTGCCGTCTAAG | |||
| CTX-M-9-F | GTTACAGCCCTTCGGCGATGATTC | [63] | ||
| CTX-M-9-R | GCGCATGGTGACAAAGAGAGTGCAA | |||
| blaSHV | Standard PCR | SHV-F | ATTTGTCGCTTCTTTACTCGC | [64] |
| SHV-R | TTTATGGCGTTACCTTTGACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chelaghma, W.; Loucif, L.; Bendjama, E.; Cherak, Z.; Bendahou, M.; Rolain, J.-M. Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria. Antibiotics 2022, 11, 988. https://doi.org/10.3390/antibiotics11080988
Chelaghma W, Loucif L, Bendjama E, Cherak Z, Bendahou M, Rolain J-M. Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria. Antibiotics. 2022; 11(8):988. https://doi.org/10.3390/antibiotics11080988
Chicago/Turabian StyleChelaghma, Widad, Lotfi Loucif, Esma Bendjama, Zineb Cherak, Mourad Bendahou, and Jean-Marc Rolain. 2022. "Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria" Antibiotics 11, no. 8: 988. https://doi.org/10.3390/antibiotics11080988
APA StyleChelaghma, W., Loucif, L., Bendjama, E., Cherak, Z., Bendahou, M., & Rolain, J.-M. (2022). Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria. Antibiotics, 11(8), 988. https://doi.org/10.3390/antibiotics11080988

