Evaluation of Three Carbapenemase-Phenotypic Detection Methods and Emergence of Diverse VIM and GES Variants among Pseudomonas aeruginosa Isolates in Tunisia
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates
2.2. Antimicrobial Susceptibility Testing
2.3. Phenotypic Detection of Carbapenemase Production
2.4. Detection and Characterization of Beta-Lactamase Genes
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dantas, R.C.; Ferreira, M.L.; Gontijo-Filho, P.P.; Ribas, R.M. Pseudomonas aeruginosa bacteraemia: Independent risk factors for mortality and impact of resistance on outcome. J. Med. Microbiol. 2014, 63, 1679–1687. [Google Scholar] [CrossRef] [PubMed]
- Gniadek, T.J.; Carroll, K.C.; Simner, P.J. Carbapenem-resistant non-glucose-fermenting gram-negative bacilli: The missing piece to the puzzle. J. Clin. Microbiol. 2016, 54, 1700–1710. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kateete, D.P.; Nakanjako, R.; Namugenyi, J.; Erume, J.; Joloba, M.L.; Najjuka, C. Carbapenem resistant Pseudomonas aeruginosa and Acinetobacter baumannii at Mulago Hospital in Kampala, Uganda (2007–2009). SpringerPlus 2016, 5, 1308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livermore, D.M.; Woodford, N. Carbapenemases: A problem in waiting? Curr. Opin. Microbiol. 2000, 3, 489–495. [Google Scholar] [CrossRef]
- Poirel, L.; Naas, T.; Nicolas, D.; Collet, L.; Bellais, S.; Cavallo, J.-D.; Nordmann, P. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-beta -lactamase and its plasmid- and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 2000, 44, 891–897. [Google Scholar] [CrossRef] [Green Version]
- Chairat, S.; Ben Yahia, H.; Rojo-Bezares, B.; Sáenz, Y.; Torres, C.; Ben Slama, K. High prevalence of imipenem-resistant and metallo-beta-lactamase-producing Pseudomonas aeruginosa in the burns hospital in Tunisia: Detection of a novel class 1 integron. J. Chemother. 2019, 31, 120–126. [Google Scholar] [CrossRef]
- Ktari, S.; Mnif, B.; Znazen, A.; Rekik, M.; Mezghani, S.; Mahjoubi-Rhimi, F.; Hammami, A. Diversity of β-lactamases in Pseudomonas aeruginosa isolates producing metallo-β-lactamase in two Tunisian hospitals. Microb. Drug Resist. 2011, 17, 25–30. [Google Scholar] [CrossRef]
- Hammami, S.; Boutiba-Ben Boubaker, I.; Ghozzi, R.; Saidani, M.; Amine, S.; Ben Redjeb, S. Nosocomial outbreak of imipenem-resistant Pseudomonas aeruginosa producing VIM-2 Metallo-β-lactamase in a kidney transplantation unit. Diagn. Pathol. 2011, 6, 106. [Google Scholar] [CrossRef] [Green Version]
- Diene, S.M.; Rolain, J.-M. Carbapenemase genes and genetic platforms in gram-negative bacilli: Enterobacteriaceae, Pseudomonas and Acinetobacter species. Clin. Microbiol. Infect. 2014, 20, 831–838. [Google Scholar] [CrossRef] [Green Version]
- Uechi, K.; Tada, T.; Shimada, K.; Kuwahara-Arai, K.; Arakaki, M.; Tome, T.; Nakasone, I.; Maeda, S.; Kirikae, T.; Fujita, J. A modified carbapenem inactivation method, CIMTris, for carbapenemase production in Acinetobacter and Pseudomonas species. J. Clin. Microbiol. 2017, 55, 3405–3410. [Google Scholar] [CrossRef] [Green Version]
- Lucena, A.; Costa, L.M.D.; Da Nogueira, K.S.; Matos, A.P.; Gales, A.C.; Raboni, S.M. Comparison of phenotypic tests for the detection of metallo-beta-lactamases in clinical isolates of Pseudomonasaeruginosa. Enferm. Infecc. Microbiol. Clínica 2014, 32, 625–630. [Google Scholar] [CrossRef]
- Leeflang, M.M.G.; Allerberger, F. How to: Evaluate a diagnostic test. Clin. Microbiol. Infect. 2019, 25, 54–59. [Google Scholar] [CrossRef] [Green Version]
- Ilstrup, D.M. Statistical methods in microbiology. Clin. Microbiol. Rev. 1990, 3, 219–226. [Google Scholar] [CrossRef]
- Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [Green Version]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 2011, 70, 119–123. [Google Scholar] [CrossRef]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar] [CrossRef] [Green Version]
- Gupta, R.; Malik, A.; Rizvi, M.; Ahmed, S.M. Incidence of multidrug-resistant Pseudomonas spp. in ICU patients with special reference to ESBL, AMPC, MBL and biofilm production. J. Glob. Infect. Dis. 2016, 8, 25. [Google Scholar] [CrossRef]
- Malkoçoğlu, G.; Aktaş, E.; Bayraktar, B.; Otlu, B.; Bulut, M.E. VIM-1, VIM-2, and GES-5 carbapenemases among Pseudomonas aeruginosa isolates at a tertiary hospital in Istanbul, Turkey. Microb. Drug Resist. 2017, 23, 328–334. [Google Scholar] [CrossRef]
- Viedma, E.; Juan, C.; Acosta, J.; Zamorano, L.; Otero, J.R.; Sanz, F.; Chaves, F.; Oliver, A. Nosocomial spread of colistin-only-sensitive sequence type 235 Pseudomonas aeruginosa isolates producing the extended-spectrum-lactamases GES-1 and GES-5 in Spain. Antimicrob. Agents Chemother. 2009, 53, 4930–4933. [Google Scholar] [CrossRef] [Green Version]
- Hishinuma, T.; Tada, T.; Kuwahara-Arai, K.; Yamamoto, N.; Shimojima, M.; Kirikae, T. Spread of GES-5 carbapenemase-producing Pseudomonasaeruginosa clinical isolates in Japan due to clonal expansion of ST235. PLoS ONE 2018, 13, e0207134. [Google Scholar] [CrossRef]
- Labuschagne, C.D.J.; Weldhagen, G.F.; Ehlers, M.M.; Dove, M.G. Emergence of class 1 integron-associated GES-5 and GES-5-like extended-spectrum β-lactamases in clinical isolates of Pseudomonas aeruginosa in South Africa. Int. J. Antimicrob. Agents 2008, 31, 527–530. [Google Scholar] [CrossRef]
- Picao, R.C.; Poirel, L.; Gales, A.C.; Nordmann, P. Diversity of -lactamases produced by ceftazidime-resistant Pseudomonasaeruginosa isolates causing bloodstream infections in Brazil. Antimicrob. Agents Chemother. 2009, 53, 3908–3913. [Google Scholar] [CrossRef] [Green Version]
- Koutsogiannou, M.; Drougka, E.; Liakopoulos, A.; Jelastopulu, E.; Petinaki, E.; Anastassiou, E.D.; Spiliopoulou, I.; Christofidou, M. Spread of multidrug-resistant Pseudomonas aeruginosa clones in a university hospital. J. Clin. Microbiol. 2013, 51, 665–668. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer a | Sequence (5′–3′) c | Product Size (bp) b | Reference |
---|---|---|---|---|
blaGES | MultiGES-F | AGTCGGCTAGACCGGAAG | 399 | [14] |
MultiGES-R | TTTGTCCGTGCTCAGGAT | |||
blaOXA-48 | MultiOXA-48 F | GCTTGATCGCCCTCGATT | 281 | [14] |
MultiOXA-48 R | GATTTGCTCCGTGGCCGAAA | |||
blaIMP | MltiIMP-F | TTGACACTCCATTTACDG | 232 | [15] |
MultiIMP-R | GATYGAGAATTAAGCCACYCT | |||
blaVIM | MultiVIM-F | GATGGTGTTTGGTCGCATA | 390 | [15] |
MultiVIM-R | CGAATGCGCAGCACCAG | |||
blaKPC | MultiKPC-F | CATTCAAGGGCTTTCTTGCT C | 798 | [15] |
MultiKPC-R | ACGACGGCATAGTCATTTGC | |||
blaBIC | MultiBIC-F | TATGCAGCTCCTTTAAAGGGC | 537 | [15] |
MultiBIC-R | TCATTGGCGGTGCCGTACAC | |||
blaNDM | MultiNDM-F | GGTTTGGCGATCTGGTTTTC | 621 | [15] |
MultiNDM-R | CGGAATGGCTCATCACGATC | |||
blaAIM | MultiAIM-F | CTGAAGGTGTACGGAAACAC | 322 | [15] |
MultiAIM-R | GTTCGGCCACCTCGAATTG | |||
blaGIM | MultiGIM-F | TCGACACACCTTGGTCTGAA | 477 | [15] |
MultiGIM-R | AACTTCCAACTTTGCCATGC | |||
blaSIM | MultiSIM-F | TACAAGGGATTCGGCATCG | 570 | [15] |
MultiSIM-R | TAATGGCCTGTTCCCATGTG | |||
blaDIM | MultiDIM-F | GCTTGTCTTCGCTTGCTAACG | 699 | [15] |
MultiDIM-R | CGTTCGGCTGGATTGATTTG | |||
blaSPM | SPM-F | AAAATCTGGGTACGCAAACG | 271 | [15] |
SPM-R | ACATTATCCGCTGGAACAGG |
Strains | Specimen | Ward | Date of Isolation (Day/Month/Year) | Minimal Inhibitory Concentration (µg/mL) | Resistance to Non β-lactams | Phenotypic Detection of Carbapenemases | bla Genes | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
Imipenem (4–8) * | Meropenem (2–8) * | Colistin (4) * | mCIM | CIMTris | mHodge | ||||||
S1 | Pus | Urology | 21 August 2014 | 512 | 128 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | - | - | - |
S2 | Urine | ICU | 21 August 2014 | 16 | 4 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaVIM-2 |
S3 | Pulmonary | ICU | 21 August 2014 | 32 | 16 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaVIM-2 |
S4 | Pulmonary | ICU | 30 August 2014 | 512 | 128 | 4 | GEN, AMN, NET, TOB, CIP, FOS | + | + | + | blaVIM-1 |
S5 | Pulmonary | ICU | 8 September 2014 | 32 | 16 | 1 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-9 |
S6 | Material | Surgery | 10 September 2014 | 16 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-9 |
S7 | Pulmonary | ICU | 23 September 2014 | 8 | 4 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S8 | Pulmonary | Surgery | 30 October 2014 | 16 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S9 | Pulmonary | ICU | 24 December 2014 | 512 | 256 | 1 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaVIM-2 |
S10 | Pulmonary | ICU | 20 December 2014 | 8 | 4 | 1 | GEN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S11 | Urine | EC | 06 February 2015 | 8 | 8 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | - | - | - |
S12 | Pulmonary | Surgery | 27 June 2015 | 16 | 16 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | - |
S13 | Urine | EC | 30 June 2015 | 16 | 8 | 4 | GEN, NET, TOB, CIP, FOS | - | + | - | - |
S14 | Pulmonary | Surgery | 19 September 2015 | 8 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S15 | Pus | Surgery | 30 September 2015 | 128 | 128 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5, blaVIM-11 |
S16 | Pus | ICU | 18 March 2016 | 16 | 8 | 2 | GEN, NET, TOB, CIP, FOS | + | + | + | blaVIM-2 |
S17 | Pulmonary | ICU | 06 April 2016 | 16 | 8 | 2 | AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S18 | Pus | ICU | 26 May 2016 | 32 | 32 | 16 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S19 | Blood | ICU | 13 June 2016 | 4 | 4 | 2 | GEN, AMN, NET, TOB, FOS | + | + | - | blaVIM-2 |
S20 | Blood | ICU | 12 July 2016 | 32 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5, blaVIM-2 |
S21 | Blood | Surgery | 18 August 2016 | 32 | 16 | 2 | AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S22 | Blood | ICU | 16 August 2016 | 32 | 8 | 4 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S23 | Pulmonary | Surgery | 21 August 2016 | 16 | 8 | 4 | AMN, NET, TOB, CIP, FOS | + | + | - | blaGES-5 |
S24 | Puncture | Surgery | 13 October 2016 | 16 | 8 | 1 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | blaGES-5 |
S25 | Pulmonary | Surgery | 31 October 2016 | 16 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaGES-5 |
S26 | Material | ICU | 25 October 2016 | 16 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | - | - | - |
S27 | Pulmonary | ICU | 15 February 2017 | 128 | 64 | 1 | AMN, NET, TOB, CIP, FOS | + | + | - | blaVIM-2 |
S28 | Pus | ICU | 17 February 2017 | 16 | 8 | 1 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | - |
S29 | Pulmonary | ICU | 24 June 2017 | 16 | 8 | 1 | GEN, AMN, NET, TOB, CIP, FOS | - | - | - | - |
S30 | Urine | Urology | 28 August 2017 | 16 | 8 | 2 | GEN, AMN, NET, TOB, CIP, FOS | - | + | - | - |
S31 | Rectal | ICU | 16 September 2017 | 16 | 8 | 1 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaGES-5 |
S32 | Pulmonary | ICU | 09 October 2017 | 8 | 4 | 1 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaVIM-2 |
S33 | Rectal | ICU | 09 October 2017 | 32 | 32 | 4 | GEN, AMN, NET, TOB, CIP, FOS | + | + | + | blaVIM-2 |
S34 | Rectal | ICU | 22 November 2017 | 64 | 32 | 2 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaGES-5 |
S35 | Pulmonary | ICU | 30 November 2017 | 32 | 16 | 2 | GEN, AMN, NET, TOB, CIP, FOS | + | + | - | blaGES-5 |
mCIM | CIMTris | mHodge Test | |
---|---|---|---|
True positive | 12 | 28 | 3 |
True negative | 8 | 4 | 8 |
False positive | 0 | 3 | 0 |
False negative | 15 | 0 | 24 |
Specificity (%) | 100 | 90,4 | 100 |
Sensitivity (%) | 34.8 | 100 | 25 |
Phenotypic Tests | PCR Results | |||
---|---|---|---|---|
Carbapenemase Coding Genes | blaVIM | blaGES | ||
mHodge test | Positive (n) | 3 | 1 | |
Negative (n) | 24 | 15 | ||
Sensitivity (%) | 12.5 | 30 | 5 | |
Specificity (%) | 100 | 100 | 86.66 | |
mCIM | Positive (n) | 7 | 5 | |
Negative (n) | 20 | 10 | ||
Sensitivity (%) | 46.15 | 63.7 | 26.31 | |
Specificity (%) | 100 | 83.33 | 62.5 | |
CIMTris | Positive (n) | 9 | 15 | |
Negative (n) | 7 | 5 | ||
Sensitivity (%) | 96.15 | 81.81 | 74 | |
Specificity (%) | 44.44 | 29 | 21.42 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ferjani, S.; Maamar, E.; Ferjani, A.; Kanzari, L.; Boubaker, I.B.B. Evaluation of Three Carbapenemase-Phenotypic Detection Methods and Emergence of Diverse VIM and GES Variants among Pseudomonas aeruginosa Isolates in Tunisia. Antibiotics 2022, 11, 858. https://doi.org/10.3390/antibiotics11070858
Ferjani S, Maamar E, Ferjani A, Kanzari L, Boubaker IBB. Evaluation of Three Carbapenemase-Phenotypic Detection Methods and Emergence of Diverse VIM and GES Variants among Pseudomonas aeruginosa Isolates in Tunisia. Antibiotics. 2022; 11(7):858. https://doi.org/10.3390/antibiotics11070858
Chicago/Turabian StyleFerjani, Sana, Elaa Maamar, Asma Ferjani, Lamia Kanzari, and Ilhem Boutiba Ben Boubaker. 2022. "Evaluation of Three Carbapenemase-Phenotypic Detection Methods and Emergence of Diverse VIM and GES Variants among Pseudomonas aeruginosa Isolates in Tunisia" Antibiotics 11, no. 7: 858. https://doi.org/10.3390/antibiotics11070858
APA StyleFerjani, S., Maamar, E., Ferjani, A., Kanzari, L., & Boubaker, I. B. B. (2022). Evaluation of Three Carbapenemase-Phenotypic Detection Methods and Emergence of Diverse VIM and GES Variants among Pseudomonas aeruginosa Isolates in Tunisia. Antibiotics, 11(7), 858. https://doi.org/10.3390/antibiotics11070858