Next Article in Journal
Overexpression of the MexXY Multidrug Efflux System Correlates with Deficient Pyoverdine Production in Pseudomonas aeruginosa
Previous Article in Journal
Dalbavancin for the Treatment of Prosthetic Joint Infections: A Narrative Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 6
10.3390/antibiotics10060657
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Colistin Resistance and ESBL Production in Salmonella and Escherichia coli from Pigs and Pork in the Thailand, Cambodia, Lao PDR, and Myanmar Border Area

by
Khin Khin Lay
1,
Saharuetai Jeamsripong
2,
Kyaw Phyoe Sunn
2,3,
Sunpetch Angkititrakul
4,
Ransiya Prathan
2,
Songsak Srisanga
2 and
Rungtip Chuanchuen
2,*
1
Department of Animal Science, University of Veterinary Science, Nay Phi Tau 15013, Myanmar
2
Research Unit in Microbial Food Safety and Antimicrobial Resistance, Department of Veterinary Public Health, Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand
3
Division of Public Health, Department of Livestock Breeding and Veterinary, Ministry of Agriculture, Livestock and Irrigation, Nay Phi Tau 15011, Myanmar
4
Research Group for Prevention Technology in Livestock, Faculty of Veterinary Medicine, Khon Kaen University, Khon Kaen 40002, Thailand
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(6), 657; https://doi.org/10.3390/antibiotics10060657
Submission received: 26 April 2021 / Revised: 22 May 2021 / Accepted: 28 May 2021 / Published: 31 May 2021
Browse Figure
Review Reports Versions Notes

Abstract

:
The study aimed to examine the prevalence and genetic characteristics of ESBL-production and colistin resistance in Salmonella and Escherichia coli from pigs and pork in the border area among Thailand, Cambodia, Lao PDR, and Myanmar. Salmonella (n = 463) and E. coli (n = 767) isolates were collected from pig rectal swab from slaughterhouses (n = 441) and pork from retail markets (n = 368) during October 2017 and March 2018. All were determined for susceptibility to colistin and cephalosporins, ESBL production and mcr and ESBL genes. Salmonella was predominantly found in Cambodia (65.8%). Serovars Rissen (35.6%) and Anatum (15.3%) were the most common. The E. coli prevalence in pork was above 91% in all countries. Colistin-resistance rate in E. coli (10.4%) was significantly higher than Salmonella (2.6%). ESBL-producing Salmonella (1.9%) and E. coli (6.3%) were detected. The blaCTX-M-55 and blaCTX-M-14 were identified. The mcr-1 gene was detected in Salmonella (n = 12) and E. coli (n = 68). The mcr-1/blaCTX-M-55 and mcr-3/blaCTX-M-55 co-concurrence was observed in one Salmonella and three E. coli isolates, respectively. In conclusion, pigs and pork serve as carriers of colistin and new generation cephalosporins resistance. Testing for resistance to last line antibiotics should be included in national AMR surveillance program using One Health approach.

1. Introduction

Multidrug resistance (MDR) in bacterial pathogens has escalated and become a significant cause of morbidity and mortality worldwide [1]. Resistance to last resort antibiotics (e.g., colistin and newer generation cephalosporins) is of particular concern because it may limit antibiotic therapy for bacterial infections in the near future [2,3].
Cephalosporins (3rd, 4th, and 5th generations) are used for disease treatment in humans and animals [4] and categorized as critically important antimicrobials in both human [5] and veterinary medicine [6]. Over recent years, resistance to cephalosporins have been increasingly reported in humans and animals [7,8] and role of livestock as important sources of extended-spectrum β-lactamase (ESBL) producers potentially spread to humans through the food chain was highlighted [9]. Resistance to cephalosporins is mainly due to the production of ESBLs that confer resistance to most β-lactams, including new generation cephalosporins and monobactams (e.g., aztreonam), but not cephamycin (e.g., cefoxitin) and carbapenems (e.g., imipenem) [10]. ESBL-encoding genes are primarily located on plasmid that can be horizontally transferred to inter and intra bacterial species. The genes frequently co-exist with other resistance genes on the same large plasmids, resulting in MDR phenotype of ESBL producers [9,11]. Colistin or polymyxin E has a narrow antibacterial spectrum mainly against Gram-negative bacteria [12]. Colistin is widely used in pig production for treatment and control of Enterobacteriaceae infections. Colistin-resistant E. coli carrying plasmid-borne mcr-1 were isolated from food animals in China in 2016 [13]. Since then, several mcr variants have been identified in livestock in many parts of the world, including countries with zero to marginal use of colistin (e.g., the United States) [14]. The mcr variants can occur due to transference of multiple mobile genetic elements. The co-occurrence of variants of mcr genes and other antimicrobial resistance (AMR) genes can increase the widespread of colistin resistance and pose a global public health risk [15].The border-crossing areas between Thailand and its land neighboring countries including Cambodia, Lao PDR and Myanmar has flourished and become a major route for cross-border trade and tourism owing to their geographical advantages situated along the Mekong river [16]. Purchasing and selling live animals and retail meat, especially pigs and pig products, is one of the high-trade volume and value. The cross-border trade has been emphasized on improvement of their commerce, investment, and economic cooperation [16]. This raises a particular concern over the role of food animals and products as reservoirs of diseases and AMR bacteria that possibly spread to other regions and countries.
Currently, knowledge on resistance to new generation cephalosporins and colistin in bacteria from livestock and products remains largely undiscovered in most cross-border regions globally. This study aimed to examine the prevalence and genetic characteristics of ESBL-production and colistin resistance in Salmonella and E. coli isolated from pigs and pork in the border area between Thailand, Cambodia, Lao PDR, and Myanmar.

2. Results

2.1. Salmonella Prevalence and Serovars in Pigs and Pork

Half of the samples were positive to Salmonella (49.8%) (Table 1). The highest Salmonella prevalence was found in Cambodia (65.8%, 98/149), followed by Thailand (56.3%, 214/380). The Salmonella positive samples in retail markets (61.0%, 246/403) was 1.6 times greater than those in slaughterhouses (39.0%, 157/403). A total of 463 Salmonella isolates with 60 serovars were obtained from Thailand (n = 237), Cambodia (n = 121), Lao PDR (n = 86) and Myanmar (n = 19) (Table 2). The most common Salmonella serovars were Rissen (35.6%), followed by Anatum (15.3%).

2.2. E. coli Prevalence in Pork

The overall percentage of E. coli in pork from the markets was 44.7% (343/767). The high prevalence (>88%) was observed in pork in all countries. The high recovery rate (>94%) for commensal E. coli was observed for rectal swab sample, indicating the high competence of E. coli isolation method used (Table 1). Subtotal of E. coli was not identified in Table 1 to avoid the comparison among the sampling sources since commensal E. coli regularly present in rectal swab. Seven hundred and sixty-seven isolates were collected from Thailand (n = 368), Cambodia (n = 136), Laos (n = 133), and Myanmar (n = 130) for further experiments (Table 1).

2.3. ESBL Production and Colistin Resistance in Salmonella and E. coli

Of all Salmonella, colistin-resistant Salmonella was found at low frequency (2.8%) (Table 3). Colistin-resistant Salmonella were found in pork from Myanmar (5.6%), Cambodia (5.3%), Thailand (4.2%), and Laos (1.8%). Cephalsosporin-resistance rates were still low (<2.4%), of which the Thai pork isolates exhibited the highest prevalence to all cephalosporins tested (Table 4).
For E. coli, overall colistin-resistance rate (10.4%) was significantly higher (p < 0.05) than that in Salmonella (Table 3 and Table 4). Colistin resistance was most common in Lao PDR (28.6%, 38/133), where the highest rate was observed among the pork isolates (37.0%, 20/54). Resistance rates to ceftazidime (6.4%) cefotaxime (9.0%) and cefpodoxime (8.7%) in E. coli were higher than those in Salmonella (Table 4).

2.4. Prevalence of ESBL-Producing Salmonella and E. coli

The ESBL-producing Salmonella percentage was low (1.9%, 9/463). The isolates were found only in Thailand (3.4%, 8/237) and Lao PDR (1.2%, 2/86) (Table 3).
The overall prevalence of ESBL-producing E. coli was 6.5% (50/767), of which the highest percentage was among the Myanmar isolates (13.9%, 18/130) (Table 3).
The prevalence of ESBL-producing E. coli (6.5%) was significantly different from that of Salmonella (1.9%). The presence of ESBL-producing E. coli was associated with sample type, and significantly higher in pigs (7.8%, 33/424) than pork (5.0%, 17/343) (OR = 2.88, p = 0.028). A Salmonella isolate (from Laos) and 4 E. coli from Thailand (n = 2) and Cambodia (n = 2) were ESBL producers that were additonally resistant to colistin.

2.5. Genotype of Colistin-Resistant and ESBL-Producing Salmonella and E. coli

In Salmonella, all colistin-resistant isolates (n = 13) carried mcr-1 (Table 3). A Thai pig isolate additionally harbored mcr-3. Only blaCTX-M55 (88.9%, 8/9) was observed in ESBL-producing Salmonella (Table 3). The only ESBL-producing Salmonella from pork in Lao PDR carried both mcr-1 and blaCTX-M55.
In E. coli, mcr-1 (85%, 68/80) and mcr-3 (38.8%, 31/80) were found (Table 3). Five mcr-1-possitive E. coli from three Thai and two Cambodian pig isolates were susceptible to colistin. Six colistin-resistant E. coli from pigs in Thailand (n = 1) and Cambodia (n = 1) and pork in Camodia (n = 1) and Lao PDR (n = 3) carried both mcr-1 and mcr-3 (colistin MIC = 4 and 8 µg/mL). The blaCTX-M-55 (70.8%, 34/48) and blaCTX-M-9 (32%, 16/48) genes were detected among the ESBL-producing E. coli. Three E. coli from Thai pig (n = 1) and Cambodian pig (n = 1) and pork (n = 1) harbored both mcr-3 and blaCTX-M55.
The β-lactamase gene, blaTEM-1, was common in ESBL-producing Salmonella (77.8%, 7/9) and E. coli (54.2%, 26/48). The percentage of ESBL production was statistically associated with blaTEM-1 (p < 0.05).
The blaCTX-M55 gene in one ESBL-producing Salmonella from Thai pig and seven ESBL-producing E. coli from Cambodia (one from pig and one from pork) and Myanmar (three from pigs and two from pork) was conjugally transferred.

3. Discussion

A major finding in this study was the high prevalence of E. coli contamination in pork in retail markets, in agreement with a previous study [17]. Concurrently, the Salmonella contamination rate was approximately 1.9 times lower than that of E. coli. These observations emphasize that legal framework of microbiological quality of raw meat must be effectively implemented for food safety in retail market facilities among border provinces. In general, retail meat is delivered in open buckets and sold in open-air under ambient temperature. Unsold meat is stored overnight in an icebox for re-selling in the following day. These unhygienic practices contribute to the high bacterial contamination observed. Importantly, Salmonella contamination increased at retail markets, suggesting cross-contamination during slaughtering process or transportation or from environment at retail markets. However, the samples were not collected immediately after slaughtering and before transporting to retail markets, therefore, the hypothesis cannot be scrutinized. Together with the high E. coli contamination, it indicates that fresh meat at retail markets serve as a major source of foodborne pathogens and highlights the need for the effective-hygienic practice along food production chain.
Thailand has launched law and regulations to contain Salmonella in poultry since 2010 [18]. The law includes the enforcement of sample collection for Salmonella detection in broiler, laying hens and breeders. Such law has not been specifically issued for pig farm. However, the microbiological quality of meat is regulated under the Microbiological Quality Criteria for Food and Food Contact Containers No.3 (2017), indicating that Salmonella must not be present in 25 g of fresh and frozen raw meat (either pork or chicken meat) intended for human consumption [19]. Therefore, good manufacturing practice is required at both farm and slaughtering process levels to produce Salmonella free raw meat.
In this study, the most common Salmonella serovars were Rissen and Anatum, in agreement with a previous study [20]. Salmonella Enteritidis was not observed in this study. This maybe because the major reservoir of Salmonella Enteritidis is not in swine production in agreement of previous study [17]. ESBL-producing Salmonella and E. coli were present at lower rate when compared to previous studies in Thailand, [21,22] and other countries e.g., Denmark [23], Czech [24], Nigeria [25], and Germany [26]. The differences could be associated with many factors (e.g., sampling period, geographical variations and different antimicrobials usage). This study covered the border provinces of Thailand and 3 neighboring countries (i.e., Cambodia, Lao PDR and Myanmar). However, when compared to our previous study conducted in Thailand-Cambodia border province, the prevalence of ESBL-positive Salmonella (2.2%) in this study was higher than that observed (1.7%) in the same area [27]. Due to high cost of cephalosporins, use of these antimicrobials in livestock production will increase investment cost and reduce profits. Therefore, cephalosporins may not be commonly used in food-animals in the study areas. In addition, distribution of ESBL producers is not always a direct effect of cephalosporin usage [28] and could be due to coselection of ESBL genes by other antibiotics, e.g., ampicillins, aminoglycosides, tetracyclines that are commonly used in swine production in Thailand [29].
Most ESBL-producing Salmonella (8%) and E. coli (54%) carried blaTEM-1 and almost all carried CTX-M group 1 and 9, in agreement with a previous study showing that blaCTX-M-positive E. coli isolates usually non ESBL blaTEM-1 [30]. This was also supported by the statistical significance of association between ESBL production and blaTEM-1 (p < 0.05) observed. In addition, not all ESBL producers in this study carried the ESBL genes tested, indicating the existence of other resistance mechanisms and/or ESBL genes that were not included in this study.
A previous study in the same region demonstrated that CTX-M β-lactamases were common among ESBL-producing isolates in this study [31]. This was in agreement with the current study where blaCTX-M-55 of CTX-M-1 and blaCTX-M-14 of CTX-M-9 were predominant. Several studies previously reported the common presence of blaCTX-M-1 in food animals in Switzerland, Tunisia, the United Kingdom, and Germany [9,10,32,33]. The blaCTX-M55 genes were located on conjugative plasmids, in agreement with our previous studies [27] and supporting its distribution in this area. Horizontal transfer of blaCTX-M-55 was under selective pressure of ampicillin in conjugation experiment, highlighting the role of the old generation antibiotic that has been widely used for a long time as a selective pressure for the new generation of clinically important antibiotics. In addition, the blaCTX-M-14 gene was most frequently found in ESBL-producing E. coli, in agreement with food animals in China [34] and Denmark [23].
In Thailand, the use of medicated feed containing polymyxins, cephalosporins, fluoroquinolones and others is regulated by the law on “Characteristics and conditions of animal feed containing drugs prohibited from producing, importing, selling and using” that was issued in 2018 [35]. The regulation of antimicrobials drugs (including polymyxins B, colistin and other drugs in penicillin and fluroquinolone groups) that must not be mixed in animal feed for prophylactic purposes was later announced [36]. The use of colistin for short-term treatment can be performed in swine production [37]. Colistin-resistant E. coli was found in pigs and pork, reflecting the use of colistin in pig production in the region. Interestingly, colistin-resistant Salmonella was limited to pork. This is rather a result of cross contamination during slaughtering, transportation, and in retail markets.
Most colistin-resistant Salmonella and E. coli harbored either mcr-1 or mcr-3, supporting the significance of mcr genes on spread of colistin resistance worldwide. However, some colistin-resistant isolates lacked both genes, indicating the existence of other colistin-resistance mechanisms not characterized in this study. Colistin-resistant Salmonella and E. coli harboring both mcr-1 and mcr-3 were isolated, in agreement with previous studies [38]. Their colistin MICs were 4 and 8 µg/mL (data not shown) and not different from those with mcr-1 and mcr-3 alone, suggesting the variable effect of mcr genes on colistin-resistance level. The common presence of mcr-3 (either alone or with mcr-1) has warned about the possibility of its global spread as observed for mcr-1. None of mcr-2 was observed, in agreement with a previous study [39].
The findings of Salmonella with mcr-1/blaCTX-M-55 (n = 1) and E. coli with mcr-3/blaCTX-M55 (n = 3) are of particular concern. This is consistent with previous studies [40,41]. Despite the low percentage, the co-occurrence generates impact on human and veterinary medicine due to the potential contribution to the spread of bacteria with clinically important antimicrobial resistance, resulting in limited choice for bacterial infection therapy. Resistance genes in these groups are plasmid borne and potentially distribute to bacteria in humans, other animals and environment, so implementation of One Health approach is needed to alleviate the AMR issue.

4. Materials and Methods

4.1. Sampling Location and Sample Collection

The sampling area are boundary provinces along the border between Thailand and Cambodia (Sa Kaeo and Banteay Meanchey), Thailand and Lao PDR (Nong Khai and Vientiane), and Thailand and Myanmar (Chiang Rai and Tarchileik) (Figure 1). The samples were collected during 2017–2018. All pig samples were obtained from one municipal pig slaughterhouse and one municipal fresh market in each province.
All pigs were from commercial production farms that provided meat for domestic consumption. In Thailand, the pig slaughterhouse in Nong Khai was a large-scale facility with greater than 80 pigs were slaughtered each day, while slaughterhouses in Sa Kaeo and Chiang Rai provinces were small-scale modern facilities with no more than 50 pigs were processed daily. The pig slaughterhouses in Banteay Meanchey province, Cambodia and from Tachileik, Myanmar were traditionally small slaughterhouses with a throughput of 30 or fewer pigs per day. In Lao PDR, the pig slaughterhouse in Vientiane was large-scale modern facility with a throughput of greater than 200 pigs per day. A total of 809 samples were collected by rectal swab from pigs in slaughterhouses (n = 441) and carcass swab in retail markets (n = 368) from Thailand (n = 380), Cambodia (n = 149), Lao PDR (n = 140) and Myanmar (n = 140) (Table 1).
At slaughterhouses, rectal swab samples were obtained by rectal evacuation after bleeding but prior to scalding. At fresh markets, the pig carcass swab was obtained by swabbing an area of at least 50 cm2 on each fresh carcass. The sample collection was performed three times at each sampling site. All samples were stored in an icebox and transported within 24 h after collection for immediate processing or held in refrigerator at 4 °C until exanimation 48 h of collection.

4.2. Isolation and Identification of Salmonella and E. coli

Salmonella was isolated following ISO 6579:2002(E) [42] and subjected to serotyping by slide agglutination based on the Kaufman-White scheme [43]. A single colony of each serotype was collected from each positive sample. E. coli was isolated and biochemically confirmed [44,45]. One isolate was collected from each positive sample and all were stored as 20% glycerol stock at −80 °C.

4.3. Determination of Minimum Inhibitory Concentration (MICs) of Colistin

All the Salmonella (n = 463) and E. coli (n = 767) isolates were tested for susceptibility to colistin by MIC determination using two-fold agar dilution method [46]. The colistin concentrations ranged from 0.0625 to 64 µg/mL. The clinical breakpoint for defining colistin resistance was 2 µg/mL [47]. Multidrug resistance (MDR) was defined as being resistant to at least three different classes of antibiotics.

4.4. Determination of ESBL Production

ESBL production was initially screened and confirmed using disk diffusion method in all the Salmonella and E. coli isolates [46]. Initial screening was performed using ceftazidime (30 ug), cefotaxime (30 ug) and cefpodoxime (10 ug) (Oxoid, Hampshire, England). All the isolates resistant to at least one of the indicator cephalosporins were subjected to confirm ESBLs production by using combination disk diffusion method with ceftazidime (30 µg) and cefotaxime (30 µg) alone and in combination with clavulanic acid (10 µg) (Oxoid). A difference of ≥5 mm between the inhibition zone of the cephalosporin/clavulanic acid combination and corresponding cephalosporin disks alone was interpreted as positive ESBL phenotype E. coli ATCC 25922 was used as a quality control strain.

4.5. PCR and Nucleotide Sequencing

PCR-template DNA was prepared by whole cell boiled lysate procedure [48]. All the primers used are listed in Table 5. All PCR reactions were performed using GeNei™mastermix (Merck, Munich, Germany). PCR amplicons were gel purified using Nucleospin® Gel (Macherey-Nagel, Düren, Germany) and submitted for sequencing using PCR primers at First Base Laboratories (Selangor Darul Ehsan, Malaysia). The obtained DNA sequence was BLAST compared with GenBank database (http://www.ncbi.nlm.nih.gov/ BLAST accessed on 24 May 2021).

4.6. Detection of ESBL and mcr Genes

All Salmonella (n = 12) and E. coli (n = 80) resistant to colistin were screened for the presence of mcr-1 [13], mcr-2 [39], and mcr-3 [49]. All the isolates that were confirmed to be ESBL produccers including ESBL-producing Salmonella (n = 9) and E. coli (n = 50) were examined for β-lactamase genes including blaTEM, blaSHV, blaCMY-1 [51], and blaCTX-M and blaPSE-M [50]. CTX-M subgroups including blaCTX-M1, blaCTX-M2, blaCTX-M8/25 [52], and blaCTX-M9 [53], were further examined in blaCTX-M-positive E. coli. The E. coli isolates positive to blaCTX-M1 were examined for blaCTX-M15 [54]. All PCR amplicons were gel purified and submitted for sequencing using PCR primers. The presence of blaCMY-2 was examined [51].

4.7. Test of Conjugation Transfer of ESBL Genes

Conjugation experiment was conducted in all ESBL producers using biparental mating method [55]. E. coli MG1655 (rifr MG1655; MIC = 256 µg/mL) were used as recipient for ESBL-producing Salmonella donors and S. Enteritidis SE12 (rifr SE12; MIC = 256 µg/mL) was used as recipient for ESBL-producing E. coli donors. All transconjugants selected on LB agar containing rifampicin (32 µg/mL) and ampicillin (100 µg/mL) and were tested for ESBL genes as in correspondent donors.

4.8. Statistical Analysis

The significance differences between the prevalence of Salmonella and E. coli and the occurrence of AMR stratified by population, location, and sample type were determined using Pearson’s Chi-square or Fisher’s exact test. The statistical analyses were performed with IBM SPSS Statistics for Windows, Version 18.0 (SPSS Inc., Chicago, IL, USA). Logistic regression analysis was used to measure the strength of association between phenotype and genotype of resistance (STATA SE12, Stata Corp LLC.: College Station, TX, USA). A p-value of <0.05 was considered statistically significant. Odds ratio and 95% confidence interval (CI) were calculated.

5. Conclusions

Healthy pigs can serve as reservoirs for colistin-resistant and ESBL-producing Salmonella and E. coli that may constitute a public health threat. It highlights the need for surveillance program as well as control and prevention strategic plan for AMR in bacteria of food animal origin at national and regional levels. Standard hygiene and sanitation practices should be enhanced in retail markets to minimize the cross contamination. The epidemiological data will help to understand the root cause of AMR. Guidance of the interventions and evaluation of the success of the inventions from farm to fork is essential for the region.

Author Contributions

Conceptualization, R.C.; methodology, K.K.L., K.P.S., S.A., R.P., and S.S.; software, S.J.; validation, R.C.; formal analysis, S.J.; investigation, R.C.; writing—original draft preparation, S.J.; writing—review and editing, R.C.; visualization, R.C.; supervision, R.C.; project administration, R.P.; funding acquisition, R.C. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by National Research University Project, Office of Higher Education Commission [NRU59-015-HR] and partly by Thailand Research Fund (TRF) Basic Research Grant [BRG6080014] and Chulalongkorn University-the One Health Research Cluster. K.K.L was supported by Rachadapisek Sompote Fund for Postdoctoral Fellowship, Chulalongkorn University. KPS is a recipient of the ASEAN scholarship program for ASEAN countries, Chulalongkorn University.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

We would like to thank Department of Livestock Development for their assistance in sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dadgostar, P. Antimicrobial Resistance: Implications and Costs. Infect. Drug Resist. 2019, 12, 3903–3910. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Palumbi, S.R. Humans as the world’s greatest evolutionary force. Science 2001, 293, 1786–1790. [Google Scholar] [CrossRef]
  3. Fair, R.J.; Tor, Y. Antibiotics and bacterial resistance in the 21st century. Perspect. Med. Chem. 2014, 6, 25–64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Cavaco, L.M.; Abatih, E.; Aarestrup, F.M.; Guardabassi, L. Selection and persistence of CTX-M-producing Escherichia coli in the intestinal flora of pigs treated with amoxicillin, ceftiofur, or cefquinome. Antimicrob. Agents Chemother. 2008, 52, 3612–3616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. WHO; WHO Advisory Group on Integrated Surveillance of Antimicrobial Resistance (AGISAR). Critically Important Antimicrobials for Human Medicine, 3rd ed.; WHO: Geneva, Switzerland, 2012; Available online: https://www.alimenti-salute.it/sites/default/files/CIA’s%20human_WHO_2011_eng.pdf (accessed on 24 March 2021).
  6. OIE. OIE List of Antimicrobials of Veterinary Importance 2007. Resolution No. XXVIII, General Session.: 1–7. WHO 2007. Available online: https://www.oie.int/fileadmin/Home/eng/Internationa_Standard_Setting/docs/pdf/OIE_list_antimicrobials.pdf (accessed on 24 December 2019).
  7. Panta, K.; Ghimire, P.; Rai, S.K.; Mukhiya, R.K.; Singh, R.N.; Rai, G. Antibiogram typing of gram negative isolates in different clinical samples of a tertiary hospital. Asian J. Pharm. Clin. Res. 2013, 6, 153–156. [Google Scholar]
  8. Shaikh, S.; Fatima, J.; Shakil, S.; Rizvi, S.M.D.; Kamal, M.A. Antibiotic resistance and extended spectrum beta-lactamases: Types, epidemiology and treatment. Saudi J. Biol. Sci. 2015, 22, 90–101. [Google Scholar] [CrossRef] [Green Version]
  9. Geser, N.; Stephan, R.; Hächler, H. Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res. 2012, 8, 21. [Google Scholar] [CrossRef] [Green Version]
  10. Ben Sallem, R.; Ben Slama, K.; Sáenz, Y.; Rojo-Bezares, B.; Estepa, V.; Jouini, A.; Gharsa, H.; Klibi, N.; Boudabous, A.; Torres, C. Prevalence and characterization of extended-spectrum beta-lactamase (ESBL)–and CMY-2–producing Escherichia coli isolates from healthy food-producing animals in Tunisia. Foodborne Pathog. Dis. 2012, 9, 1137–1142. [Google Scholar] [CrossRef]
  11. Sihem, M.; Salah, H.; Riadh, M.; Salah, A.M. Overview of ESBL-producing Escherichia coli of Animal Origin in Tunisia: In the Way of the Global Spread of CTX-M β-Lactamases. Arch. Clin. Microbiol. 2015, 6, 1–7. [Google Scholar]
  12. Catry, B.; Cavaleri, M.; Baptiste, K.; Grave, K.; Grein, K.; Holm, A.; Jukes, H.; Liebana, E.; Navas, A.L.; Mackay, D.; et al. Use of colistin-containing products within the European Union and European Economic Area (EU/EEA): Development of resistance in animals and possible impact on human and animal health. Int. J. Antimicrob. Agents 2015, 46, 297–306. [Google Scholar] [CrossRef]
  13. Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  14. Butaye, P.; Wang, C. Colistin resistance, beyond the current knowledge. EBioMedicine 2018, 34, 16–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Long, H.; Feng, Y.; Ma, K.; Liu, L.; McNally, A.; Zong, Z. The co-transfer of plasmid-borne colistin-resistant genes mcr-1 and mcr-3.5, the carbapenemase gene blaNDM-5 and the 16S methylase gene rmtB from Escherichia coli. Sci. Rep. 2019, 9, 696. [Google Scholar] [CrossRef] [PubMed]
  16. Manarungsan, S. Thailand’s Trade Relations with GMS and CLMV. In Japan and Korea with Mekong River Basin Countries; Kagami, M., Ed.; BRV Research Report No. 3; Bangkok Research Center, IDE-JETRO: Bangkok, Thailand, 2010; Available online: https://www.ide.go.jp/library/English/Publish/Download/Brc/pdf/03_chapter6.pdf (accessed on 24 March 2021).
  17. Trongjit, S.; Angkittitrakul, S.; Chuanchuen, R. Occurrence and molecular characteristics of antimicrobial resistance of Escherichia coli from broilers, pigs and meat products in Thailand and Cambodia provinces. Microbiol. Immunol. 2016, 60, 575–585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  18. DLD. Control Salmonella in Poultry. Notification of the Department of Livestock Development. The Ministry of Agriculture and Cooperatives, Thailand. 2010. Available online: http://www.ratchakitcha.soc.go.th (accessed on 20 May 2021).
  19. BQSF. Microbiological Quality Criteria for Food and Food Contact Containers No. 3. Notification of the Bureau of Quality and Safety of Food, Department of Medical Sciences, The Ministry of Public Health, Thailand. 2017. Available online: http://bqsf.dmsc.moph.go.th (accessed on 20 May 2021).
  20. Pornsukarom, S.; Patchanee, P.; Erdman, M.; Cray, P.F.; Wittum, T.; Lee, J.; Gebreyes, W.A. Comparative phenotypic and genotypic analyses of Salmonella Rissen that originated from food animals in Thailand and United States. Zoonoses Public Health. 2015, 62, 151–158. [Google Scholar] [CrossRef]
  21. Boonyasiri, A.; Tangkoskul, T.; Seenama, C.; Saiyarin, J.; Tiengrim, S.; Thamlikitkul, V. Prevalence of antibiotic resistant bacteria in healthy adults, foods, food animals, and the environment in selected areas in Thailand. Pathog. Glob. Health 2014, 108, 235–245. [Google Scholar] [CrossRef] [Green Version]
  22. Nuangmek, A.; Rojanasthien, S.; Chotinun, S.; Yamsakul, P.; Tadee, P.; Thamlikitkul, V.; Tansakul, N.; Patchanee, P. Antimicrobial Resistance in ESBL-Producing Escherichia coli Isolated from Layer and Pig Farms in Thailand. Acta. Sci. Vet. 2018, 46, 8. Available online: https://seer.ufrgs.br/ActaScientiaeVeterinariae/article/view/81823 (accessed on 15 April 2021). [CrossRef] [Green Version]
  23. Hammerum, A.M.; Larsen, J.; Andersen, V.D.; Lester, C.H.; Skytte, T.S.S.; Hansen, F.; Olsen, S.S.; Mordhorst, H.; Skov, R.L.; Aarestrup, F.M.; et al. Characterization of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli obtained from Danish pigs, pig farmers and their families from farms with high or no consumption of third-or fourth-generation cephalosporins. J. Antimicrob. Chemother. 2014, 69, 2650–2657. [Google Scholar] [CrossRef]
  24. Zelendova, M.; Dolejska, M.; Masarikova, M.; Jamborova, I.; Vasek, J.; Smola, J.; Manga, I.; Cizek, A. CTX-M-producing Escherichia coli in pigs from a Czech farm during production cycle. Lett. Appl. Microbiol. 2020, 71, 369–376. [Google Scholar] [CrossRef]
  25. Olowe, O.A.; Adewumi, O.; Odewale, G.; Ojurongbe, O.; Adefioye, O.J. Phenotypic and molecular characterisation of extended-spectrum beta-lactamase producing Escherichia coli obtained from animal fecal samples in Ado Ekiti, Nigeria. J. Environ. Public Health 2015, 2015, 497980. [Google Scholar] [CrossRef] [Green Version]
  26. Schill, F.; Abdulmawjood, A.; Klein, G.; Reich, F. Prevalence and characterization of extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase producing Enterobacteriaceae in fresh pork meat at processing level in Germany. Int. J. Food Microbiol. 2017, 257, 58–66. [Google Scholar] [CrossRef]
  27. Trongjit, S.; Angkititrakul, S.; Tuttle, R.E.; Poungseree, J.; Padungtod, P.; Chuanchuen, R. Prevalence and antimicrobial resistance in Salmonella enterica isolated from broiler chickens, pigs and meat products in Thailand–Cambodia border provinces. Microbiol. Immunol. 2017, 61, 23–33. [Google Scholar] [CrossRef] [Green Version]
  28. Guiral, E.; Pons, M.J.; Vubil, D.; Marí-Almirall, M.; Sigaúque, B.; Soto, S.M.; Alonso, P.L.; Ruiz, J.; Vila, J.; Mandomando, I. Epidemiology and molecular characterization of multidrug-resistant Escherichia coli isolates harboring blaCTX-M group 1 extended-spectrum β-lactamases causing bacteremia and urinary tract infection in Manhiça, Mozambique. Infect. Drug Resist. 2018, 11, 927–936. [Google Scholar] [CrossRef] [Green Version]
  29. Coyne, L.; Arief, R.; Benigno, C.; Giang, V.N.; Huong, L.Q.; Jeamsripong, S.; Kalpravidh, W.; McGrane, J.; Padungtod, P.; Patrick, I.; et al. Characterizing Antimicrobial Use in the Livestock Sector in Three South East Asian Countries (Indonesia, Thailand, and Vietnam). Antibiotics 2019, 8, 33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  30. Tamang, M.D.; Nam, H.M.; Kim, S.R.; Chae, M.H.; Jang, G.C.; Jung, S.C.; Lim, S.K. Prevalence and molecular characterization of CTX-M β-lactamase–producing Escherichia coli isolated from healthy swine and cattle. Foodborne Pathog. Dis. 2013, 10, 13–20. [Google Scholar] [CrossRef]
  31. Tong, P.; Sun, Y.; Ji, X.; Du, X.; Guo, X.; Liu, J.; Zhu, L.; Zhou, B.; Zhou, W.; Liu, G.; et al. Characterization of antimicrobial resistance and extended-spectrum β-lactamase genes in Escherichia coli isolated from chickens. Foodborne Pathog. Dis. 2015, 12, 345–352. [Google Scholar] [CrossRef] [PubMed]
  32. Randall, L.P.; Lemma, F.; Rogers, J.P.; Cheney, T.E.A.; Powell, L.F.; Teale, C.J. Prevalence of extended-spectrum-β-lactamase-producing Escherichia coli from pigs at slaughter in the UK in 2013. J. Antimicrob. Chemother. 2014, 69, 2947–2950. [Google Scholar] [CrossRef] [Green Version]
  33. Valentin, L.; Sharp, H.; Hille, K.; Seibt, U.; Fischer, J.; Pfeifer, Y.; Michael, G.B.; Nickel, S.; Schmiedel, J.; Falgenhauer, L.; et al. Subgrouping of ESBL-producing Escherichia coli from animal and human sources: An approach to quantify the distribution of ESBL types between different reservoirs. Inter. J. Med. Microbiol. 2014, 304, 805–816. [Google Scholar] [CrossRef] [Green Version]
  34. Zheng, H.; Zeng, Z.; Chen, S.; Liu, Y.; Yao, Q.; Deng, Y.; Chen, X.; Lv, L.; Zhuo, C.; Chen, Z.; et al. Prevalence and characterisation of CTX-M β-lactamases amongst Escherichia coli isolates from healthy food animals in China. Int. J. Antimicrob. Agents. 2012, 39, 305–310. [Google Scholar] [CrossRef] [PubMed]
  35. DLD. A List of Drugs that Must not be Mixed in Animal Feed for Prophylactic Purposes. Notification of the Department of Livestock Development. The Ministry of Agriculture and Cooperatives, 2018. Available online: http://legal.dld.go.th (accessed on 20 May 2021).
  36. DLD. Characteristics and Conditions of Animal feed Containing Drugs Prohibited from Producing, Importing, Selling and using. Notification of the Department of Livestock Development. The Ministry of Agriculture and Cooperatives, 2019. Available online: https://legal.dld.go.th/web2012/news/P15/13136182190762.PDF (accessed on 20 May 2021).
  37. Poolperm, P.; Tangkoskul, T.; Seenama, C.; Maknakhon, N.; Thamlikitkul, V. Association between the use of colistin for short-term treatment of Gram-negative bacterial infections and the emergence of colistin-resistant Enterobacteriaceae in swine from selected swine farms in Thailand. PLoS ONE 2020, 15, e0238939. [Google Scholar] [CrossRef]
  38. Zhang, J.; Chen, L.; Wang, J.; Yassin, A.K.; Butaye, P.; Kelly, P.; Gong, J.; Guo, W.; Li, J.; Li, M.; et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 2018, 8, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Xavier, B.B.; Lammens, C.; Ruhal, R.; Kumar-Singh, S.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Identification of a novel plasmid-mediated colistin-resistance gene, mcr-2, in Escherichia coli, Belgium, June 2016. Eurosurveillance 2016, 21, 30280. [Google Scholar] [CrossRef]
  40. Falgenhauer, L.; Waezsada, S.E.; Yao, Y.; Imirzalioglu, C.; Käsbohrer, A.; Roesler, U.; Michael, G.B.; Schwarz, S.; Werner, G.; Kreienbrock, L.; et al. Colistin resistance gene mcr-1 in extended-spectrum β-lactamase-producing and carbapenemase-producing Gram-negative bacteria in Germany. Lancet Infect. Dis. 2016, 16, 282–283. [Google Scholar] [CrossRef] [Green Version]
  41. Yao, X.; Doi, Y.; Zeng, L.; Luchao, L.V.; Liu, J.H. Carbapenem-resistant and colistin-resistant Escherichia coli co-producing NDM-9 and MCR-1. Lancet Infect. Dis. 2016, 16, 288–289. [Google Scholar] [CrossRef] [Green Version]
  42. International Organization for Standardization (ISO). Microbiology of Food and Animal Feeding Stuffs–Horizontal Method for the Detection of Salmonella spp.; ISO 6579:2002; ISO: Rome, Italy, 2002. [Google Scholar]
  43. Grimont, P.A.D.; Weill, F.X. Antigenic Formulae of the Salmonella Serovars, 9th ed.; World Health Organization Collaborating Center for Reference and Research on Salmonella; Institut Pasteur: Paris, France, 2007; pp. 1–166. [Google Scholar]
  44. Quinn, P.J. Clinical Veterinary Microbiology; Wolfe: London, UK, 1994; p. 648. [Google Scholar]
  45. Carter, G.R.; Cole, J.R., Jr. Diagnostic Procedure in Veterinary Bacteriology and Mycology; Academic Press: Cambridge, MA, USA, 2012; p. 620. [Google Scholar]
  46. CLSI. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-third Informational Supplement M100-S25; Clinical Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2015. [Google Scholar]
  47. EUCAST. European Committee on Antimicrobial Susceptibility Testing, Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 10.0. In European Committee on Antimicrobial Susceptibility Testing; 2020; Available online: http://www.eucast.org/clinical_breakpoints/ (accessed on 25 May 2021).
  48. Levesque, C.; Piche, L.; Larose, C.; Roy, P.H. PCR mapping of integrons reveals several novel combinations of resistance genes. J. Antimicrob. Chemother. 1995, 39, 185–191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Yin, W.; Li, H.; Shen, Y.; Liu, Z.; Wang, S.; Shen, Z.; Zhang, R.; Walsh, T.R.; Shen, J.; Wang, Y. Novel plasmid-mediated colistin resistance gene mcr-3 in Escherichia coli. MBio 2017, 8, e00543. [Google Scholar] [CrossRef] [Green Version]
  50. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Batchelor, M.; Hopkins, K.; Threlfall, E.J.; Clifton-Hadley, F.A.; Stallwood, A.D.; Davies, R.H.; Liebana, E. blaCTX-M genes in clinical Salmonella isolates recovered from humans in England and Wales from 1992 to 2003. Antimicrob. Agents Chemother. 2005, 49, 1319–1322. [Google Scholar] [CrossRef] [Green Version]
  52. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Sabaté, M.; Tarragó, R.; Navarro, F.; Miró, E.; Vergés, C.; Barbé, J.; Prats, G. Cloning and Sequence of the Gene Encoding a Novel Cefotaxime-Hydrolyzing β-Lactamase (CTX-M-9) from Escherichia coli in Spain. Antimicrob. Agents Chemother. 2000, 44, 1970–1973. [Google Scholar] [CrossRef] [Green Version]
  54. Muzaheed, Y.D.; Adams-Haduch, J.M.; Endimiani, A.; Sidjabat, H.E.; Gaddad, S.M.; Paterson, D.L. High prevalence of CTX-M-15-producing Klebsiella pneumoniae among inpatients and outpatients with urinary tract infection in Southern India. J. Antimicrob. Chemother. 2008, 61, 1393–1394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Woodall, C.A. DNA transfer by bacterial conjugation. In E. coli Plasmid Vectors; Nicola, C., Andrew, P., Eds.; Humana Press: Totowa, NJ, USA, 2003; pp. 61–65. [Google Scholar]
Antibiotics 10 00657 g001 550
Figure 1. Sampling location in the border provinces between Thailand ( Antibiotics 10 00657 i001) and other neighboring counties ( Antibiotics 10 00657 i002) including Lao PDR, Cambodia and Myanmar. Number of samples is indicated in parenthesis.
Figure 1. Sampling location in the border provinces between Thailand ( Antibiotics 10 00657 i001) and other neighboring counties ( Antibiotics 10 00657 i002) including Lao PDR, Cambodia and Myanmar. Number of samples is indicated in parenthesis.
Antibiotics 10 00657 g001
Table
Table 1. Number of samples and prevalence of Salmonella and E. coli in the border provinces among Thailand, Cambodia, Lao PDR, and Myanmar (n = 809).
Table 1. Number of samples and prevalence of Salmonella and E. coli in the border provinces among Thailand, Cambodia, Lao PDR, and Myanmar (n = 809).
CountryLocationSourceType of SampleNo. of SampleNo. of Positive Sample (%)
SalmonellaE. coli 1
ThailandNong KhaiSlaughterhouseRectal swab8057 (71.3)79 (98.8)
MarketCarcass swab6046 (76.7)57 (95.0)
Subtotal140103 (73.6)-
Sa KaeoSlaughterhouseRectal swab602 (3.3)58 (96.7)
MarketCarcass swab6034 (56.7)58 (96.7)
Subtotal12036 (30.0)-
ChiangraiSlaughterhouseRectal swab6030 (50.0)58 (96.7)
MarketCarcass swab6045 (75.0)58 (96.7)
Subtotal12075 (62.5)-
CambodiaBanteay MeancheySlaughterhouseRectal swab8439 (46.4)79 (94.0)
MarketCarcass swab6559 (90.8)57 (87.7)
Subtotal14998 (65.8)-
Lao PDRVientianeSlaughterhouseRectal swab8228 (34.1)79 (96.3)
MarketCarcass swab5844 (75.9)54 (93.1)
Subtotal14072 (51.4)-
MyanmarTarchileikSlaughterhouseRectal swab751 (1.3)71 (94.7)
MarketCarcass swab6518 (27.7)59 (90.8)
Subtotal14019 (13.6)-
Grand total809403 (49.8)343(93) 2
1 subtotal and total percentage was not calculated as commensal E. coli are normally identified in rectal swab. 2 calculated for carcass swab in markets only.
Table
Table 2. Salmonella serovars from pig and pork samples (n = 468) in Thailand, Lao PDR, Cambodia, and Myanmar.
Table 2. Salmonella serovars from pig and pork samples (n = 468) in Thailand, Lao PDR, Cambodia, and Myanmar.
Salmonella SerotypeNo. of Isolates (%)
Thailand (n = 237)Laos PDR (n = 86)Cambodia (n = 121)Myanmar (n = 19)
PigPorkPigPorkPigPorkPigPork
Typhimurium12 (5.0)-1 (1.2)-2 (1.7)---
Sao12 (5.0)8 (3.3)------
Augustenborg1 (0.4)1 (0.4)-2 (2.3)----
Schwarzengrund2 (0.8)--1 (1.2)----
Derby2 (0.8)---3 (2.5)1 (0.8)--
Rissen37 (15.5)66 (27.6)-11 (12.8)18 (14.9)30 (24.8)1 (5.3)2 (10.5)
Saintpaul2 (0.8)8 (3.3)-1 (1.2)---2 (10.5)
Eastbourne1 (0.4)-------
Anatum8 (3.3)30 (12.6)5 (5.8)5 (5.8)-9 (7.4)-14 (73.7)
Rideau1 (0.4)4 (1.7)-1 (1.2)----
Sanktmarx5 (2.1)10 (4.2)1 (1.2)2 (2.3)----
Weltevreden4 (1.7)1 (0.4)--1 (0.8)1 (0.8)--
Braenderup1 (0.4)----2 (1.7)--
Fareham4 (1.7)2 (0.8)------
Stanley2 (0.8)1 (0.4)8 (9.3)7 (8.1)3 (2.5)5 (4.1)--
Vijle-1-1 (0.4)------
Norwich-2 (0.8)-1 (1.2)----
Yalding-4 (1.7)------
Calabar-1 (0.4)------
Hayindogo-3 (1.3)-6 (7.0)-1 (0.8)--
Muenster-1 (0.4)-3 (3.5)1 (0.8)5 (4.1)--
Potto--3 (3.5)-----
Tsevie--1 (1.2)-2 (1.7)---
Brunei--4 (4.7)-----
Kissi--1 (1.2)-----
Eschberg--1 (1.2)-----
Ayinde--1 (1.2)-----
Kentucky--1 (1.2)2 (2.3)----
Rottnest--1 (1.2)-----
Vilvoorde--1 (1.2)-----
Kouka--1 (1.2)-----
Portanigra---1 (1.2)----
Newlands---2 (2.3)----
Bristol---1 (1.2)----
Sandow---1 (1.2)-10 (8.3)--
Haifa---1 (1.2)-1 (0.8)--
Magumeri---1 (1.2)----
Lika---1 (1.2)----
V---1 (1.2)----
Koenigstuhl---1 (1.2)1 (0.8)---
II---1 (1.2)-1 (0.8)--
Suberu---1 (1.2)----
Ikayi---2 (2.3)----
Dallgow----1 (0.8)---
Paratyphi-B----1 (0.8)---
Lekke----1 (0.8)---
Herston----1 (0.8)---
Hvittingfoss/II----1 (0.8)---
Stanley ville----1 (0.8)---
Bradford----1 (0.8)---
Yoruba----1 (0.8)---
Rechovot----4 (3.3)---
Bracknell----1 (0.8)---
Idikan----1 (0.8)---
Sinstorf-----5 (4.1)--
Paris-----1 (0.8)--
Newport-----1 (0.8)--
Ituri-----1 (0.8)--
Kedougou-----1 (0.8)--
Havana-----1 (0.8)--
Total94 (39.7)143 (60.3)30 (34.9)56 (65.1)45 (37.2)76 (62.8)1 (5.3)18 (94.7)
Table
Table 3. Distribution of phenotypic and genotypic of ESBL production and colistin resistance in Salmonella (n = 463) and E. coli (n = 767).
Table 3. Distribution of phenotypic and genotypic of ESBL production and colistin resistance in Salmonella (n = 463) and E. coli (n = 767).
CountrySourceTotal No.SalmonellaSourceTotal No.E. coli
ESBL Production, No. (%) 1Colistin Resistance, No. (%) 2ESBL Production, No. (%) 1Colistin Resistance, No. (%) 2
TotalblaCTX-M-55blaTEM-1Totalmcr-1mcr-3 TotalblaCTX-M-55blaCTX-M-14blaTEM-1Totalmcr-1mcr-3
ThailandPig942 (2.1)1 (1.1)1 (1.1)--1 (1.1)Pig19512 (6.2)8 (4.1)4 (2.1)7 (3.6)8 (4.1)11 (5.6)5 (2.6)
Pork1436 (4.2)6 (4.2)6 (4.2)6 (4.2)6 (4.2)-Pork1739 (5.2)6 (3.5)4 (2.3)6 (3.5)14 (8.1)6 (3.5)4 (2.3)
Total2378 (3.4)7 (3.0)7 (3.0)6 (2.5)6 (2.5)1 (0.4)Total36821 (5.7)14 (3.8)8 (2.2)13 (3.5)22 (6.0)17 (4.6)9 (2.4)
CambodiaPig45------Pig792 (2.5)2 (2.5)-2 (2.5)11 (13.9)9 (11.4)5 (6.3)
Pork76---4 (5.3)4 (5.3) Pork571 (1.8)1 (1.8)--7 (12.3)4 (7.0)5 (8.8)
Total121---4 (3.3)4 (3.3) Total1363 (2.2)3 (2.2)-2 (1.5)18 (13.2)13 (9.6)10 (7.4)
Lao PDRPig30------Pig796 (7.6)2 (2.5)4 (5.1)5 (6.3)18 (22.8)16 (20.3)6 (7.6)
Pork561 (1.8)1 (1.8)-1 (1.8)1 (1.8)-Pork54-1 (1.9)--20 (37.0)17 (31.5)6 (11.1)
Total861 (1.2)1 (1.2)-1 (1.2)1 (1.2)-Total1336 (4.5)3 (2.6)4 (3.0)5 (3.8)38 (28.6)33 (24.8)12 (9.0)
MyanmarPig1------Pig7113 (18.3)10 (14.1)3 (4.2)5 (7.0)-2 (2.8)-
Pork18---1 (5.6)1 (5.6)-Pork595 (8.5)4 (6.8)1 (1.7)1 (1.7)2 (3.4)3 (5.1)-
Total19---1 (5.6)1 (5.3)-Total13018 (13.8)14 (10.8)4 (3.1)6 (4.6)2 (1.5)5 (3.8)-
Grand
total		4639 (1.9)8 (1.7)7 (1.5)13 (2.8)12 (2.6)1 (0.2)Grand
total		76748 (6.3)34 (4.4)16 (2.1)26 (3.4)80 (10.4)68 (8.9)31 (4.0)
1 ESBL genes were examined in all ESBL producers. 2 mcr genes were tested in all isolates.
Table
Table 4. Cephalosporin resistant Salmonella (n = 463) and E. coli (n = 767) from pig and pork.
Table 4. Cephalosporin resistant Salmonella (n = 463) and E. coli (n = 767) from pig and pork.
CountrySourceSalmonellaE. coli
Total No.No. of Positive (%)Total No.No. of Positive (%)
CeftazidimeCefotaximeCefpodoximeCeftazidimeCefotaximeCefpodoxime
ThailandPigs943 (3.2)2 (2.1)3 (3.2)19512 (6.2)19 (9.7)19 (9.7)
Pork1435 (3.5)6 (4.2)6 (4.2)17314 (8.1)15 (8.7)16 (9.2)
Total2378 (3.4)8 (3.4)9 (3.8)36826 (7.1)34 (9.2)35 (9.5)
CambodiaPigs451 (2.2)1 (2.2)1 (2.2)793 (3.8)4 (5.1)2 (2.5)
Pork76---574 (7.0)1 (1.8)1 (1.8)
Total1211 (0.8)1 (0.8)1 (0.8)1367 (5.1)5 (3.7)3 (2.2)
Lao PDRPigs301 (3.3)1 (3.3)1 (3.3)793 (3.8)8 (10.1)7 (8.9)
Pork561 (1.8)1 (1.8)1 (1.8)541 (1.9)1 (1.9)1 (1.9)
Total862 (2.3)2 (2.3)2 (2.3)1334 (3.0)9 (6.8)8 (6.0)
MyanmarPigs1---717 (9.9)13 (18.3)13 (18.3)
Pork181 (5.6)--595 (8.5)8 (13.6)8 (13.6)
Total191 (5.6)--13012 (9.2)21 (16.2)21 (16.2)
Grand total46312 (2.6)11 (2.4)12 (2.6)76749 (6.4)69 (9.0)67 (8.7)
Table
Table 5. Primers used in this study.
Table 5. Primers used in this study.
GenePrimerPrimer Sequence (5′-3′)Tm (°C)Reference
MCR
mcr-1CLR-5F
CLR-5R		CGGTCAGTCCGTTTGTTC
CTTGGTCGGTCTGTA		58[13]
mcr-2MCR2-IF
MCR2-IR		TGTTGCTTGTGCCGATTGGA
AGATGGTATTGTTGGTTGCTG		58[39]
mcr-3MCR3-IF
MCR3-IR		AAATAAAAATTGTTCCGCTTAT
GAATGGAGATCCCCGTTTTT		58[49]
ESBL
blaCTX-MCTX-M up
CTX-M down		ATGTGCAGYACCAGTAARGTKATGGC
TGGGTRAARTARGTSACCAGAAYCAGCGG		60[50]
blaTEMTEM up
TEM down		GCGGAACCCCTATTTG
TCTAAAGTATATATGAGTAAACTTGGTCTGAC		50[51]
blaSHVSHV up
SHV down		TTCGCCTGTGTATTATCTCCCTG
TTAGCGTTGCCAGTGYTCG		50[51]
blaCMY-1CMY1 up
CMY1 down		GTGGTGGATGCCAGCATCC
GGTCGAGCCGGTCTTGTTGAA		58[51]
blaCMY-2CMY2 up
CMY2 down		GCACTTAGCCACCTATACGGCAG
GCTTTTCAAGAATGCGCCAGG		58[51]
blaPSEPSE up
PSE down		GCTCGTATAGGTGTTTCCGTTT
CGATCCGCCGATGTTCCATCC		55[50]
blaCTX-M1MultiCTXMGp1-F
MultiCTXMGp1-R		TTAGGAARTGTGCCGCTGYA
CGATATCGTTGGTGGTRCCAT		688[52]
blaCTX-M2MultiCTXMGp2-F
MultiCTXMGp2-R		CGTTAACGGCACGATGAC
CGATATCGTTGGTGGTRCCAT		404[52]
blaCTX-M8/25MultiCTXMGp8/25-F
MultiCTXMGp8/25-R		AACRCRCAGACGCTCTAC
TCGAGCCGGAASGTGTYAT		326[52]
blaCTX-M9MultiCTXMGp9-F
MultiCTXMGp9-R		GTGACAAAGAGAGTGCAACGG
ATGATTCTCGCCGCTGAAGCC		850[53]
blaCTX-M15CTX-M-15-SF
CTX-M-15-SR		CACACGTGGAATTTAGGGACT
GCCGTCTAAGGCGATAAACA		996[54]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lay, K.K.; Jeamsripong, S.; Sunn, K.P.; Angkititrakul, S.; Prathan, R.; Srisanga, S.; Chuanchuen, R. Colistin Resistance and ESBL Production in Salmonella and Escherichia coli from Pigs and Pork in the Thailand, Cambodia, Lao PDR, and Myanmar Border Area. Antibiotics 2021, 10, 657. https://doi.org/10.3390/antibiotics10060657

AMA Style

Lay KK, Jeamsripong S, Sunn KP, Angkititrakul S, Prathan R, Srisanga S, Chuanchuen R. Colistin Resistance and ESBL Production in Salmonella and Escherichia coli from Pigs and Pork in the Thailand, Cambodia, Lao PDR, and Myanmar Border Area. Antibiotics. 2021; 10(6):657. https://doi.org/10.3390/antibiotics10060657

Chicago/Turabian Style

Lay, Khin Khin, Saharuetai Jeamsripong, Kyaw Phyoe Sunn, Sunpetch Angkititrakul, Ransiya Prathan, Songsak Srisanga, and Rungtip Chuanchuen. 2021. "Colistin Resistance and ESBL Production in Salmonella and Escherichia coli from Pigs and Pork in the Thailand, Cambodia, Lao PDR, and Myanmar Border Area" Antibiotics 10, no. 6: 657. https://doi.org/10.3390/antibiotics10060657

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop