Dissemination of Carbapenemases (OXA-48, NDM and VIM) Producing Enterobacteriaceae Isolated from the Mohamed VI University Hospital in Marrakech, Morocco
Abstract
1. Introduction
2. Results
3. Discussion
4. Material and Methods
4.1. Bacterial Strains
4.2. Antibiotics Susceptibility Testing
4.3. Phenotypic Detection of Carbapenemases
4.4. Molecular Characterization of Carbapenemase Genes
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Oli, A.N.; Itumo, C.J.; Okam, P.C.; Ezebialu, I.U.; Okeke, K.N.; Ifezulike, C.C.; Ezeobi, I.; Emechebe, G.O.; Okezie, U.M.; Adejumo, S.A.; et al. Carbapenem-Resistant Enterobacteriaceae Posing a Dilemma in Effective Healthcare Delivery. Antibiotics 2019, 8, 156. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.S.; Jin, Y.-H.; Park, S.-H.; Han, S.; Kim, H.S.; Yu, J.K.; Jang, J.I.; Kim, J.; Hong, C.-K.; Lee, J.-H.; et al. Horizontal transfer of blaNDM-1-carrying IncX3 plasmid between carbapenem-resistant Enterobacteriaceae in a single patient. J. Infect. 2020, 81, 816–846. [Google Scholar] [CrossRef] [Scilit]
- Kalasseril, S.G.; Krishnan, R.; Vattiringal, R.K.; Paul, R.; Mathew, P.; Pillai, D. Detection of New Delhi Metallo-β-lactamase 1 and Cephalosporin Resistance Genes Among Carbapenem-Resistant Enterobacteriaceae in Water Bodies Adjacent to Hospitals in India. Curr. Microbiol. 2020, 77, 2886–2895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smibert, O.; Satlin, M.J.; Nellore, A.; Peleg, A.Y. Carbapenem-Resistant Enterobacteriaceae in Solid Organ Transplantation: Management Principles. Curr. Infect. Dis. Rep. 2019, 21, 26. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Zhai, W.; Lin, Q.; Zhu, X.; Xiao, Z.; Yang, R.; Zheng, Y.; Zhang, F.; Li, S.; Wang, C.; et al. Carbapenem-resistant Enterobacteriaceae in hematological patients: Outcome of patients with Carbapenem-resistant Enterobacteriaceae infection and risk factors for progression to infection after rectal colonization. Int. J. Antimicrob. Agents 2019, 54, 527–529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, Z.; Li, X.; Hu, Z.; Li, Z.; Lv, Y.; Lei, M.; Wu, B.; Chen, H.; Wang, X. Characteristics of Carbapenem-Resistant and Colistin-Resistant Escherichia coli Co-Producing NDM-1 and MCR-1 from Pig Farms in China. Microorganisms 2019, 7, 482. [Google Scholar] [CrossRef] [Scilit]
- Aires-De-Sousa, M.; Fournier, C.; Lopes, E.; De Lencastre, H.; Nordmann, P.; Poirel, L. High Colonization Rate and Heterogeneity of ESBL- and Carbapenemase-Producing Enterobacteriaceae Isolated from Gull Feces in Lisbon, Portugal. Microorganisms 2020, 8, 1487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darville, T. Imipenem and meropenem. Semin. Pediatr. Infect. Dis. 1999, 10, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Van Duin, D.; Doi, Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence 2017, 8, 460–469. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alotaibi, F.E.; Bukhari, E.E.; Al-Mohizea, M.M.; Hafiz, T.; Essa, E.B.; AlTokhais, Y.I. Emergence of carbapenem-resistant Enterobacteriaceae isolated from patients in a university hospital in Saudi Arabia. Epidemiology, clinical profiles and outcomes. J. Infect. Public Health 2017, 10, 667–673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Girmenia, C.; Serrao, A.; Canichella, M. Epidemiology of Carbapenem Resistant Klebsiella Pneumoniae Infections in Mediterranean Countries. Mediterr. J. Hematol. Infect. Dis. 2016, 8, e2016032. [Google Scholar] [CrossRef] [Scilit]
- Cassini, A.; Högberg, L.D.; Plachouras, D.; Quattrocchi, A.; Hoxha, A.; Simonsen, G.S.; Colomb-Cotinat, M.; Kretzschmar, M.E.; Devleesschauwer, B.; Cecchini, M.; et al. Attributable deaths and disability-adjusted life-years caused by infections with antibiotic-resistant bacteria in the EU and the European Economic Area in 2015: A population-level modelling analysis. Lancet Infect. Dis. 2019, 19, 56–66. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development of New Antibiotics. 2017. Available online: https://www.who.int/medicines/publications/global-priority-list-antibiotic-resistant-bacteria/en/ (accessed on 1 October 2020).
- Eichenberger, E.M.; Thaden, J.T. Epidemiology and Mechanisms of Resistance of Extensively Drug Resistant Gram-Negative Bacteria. Antibiotics 2019, 8, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suay-García, B.; Pérez-Gracia, M.T. Present and Future of Carbapenem-resistant Enterobacteriaceae (CRE) Infections. Antibiotics 2019, 8, 122. [Google Scholar] [CrossRef] [Scilit]
- Martin, J.; Phan, H.T.T.; Findlay, J.; Stoesser, N.; Pankhurst, L.; Navickaite, I.; De Maio, N.; Eyre, D.W.; Toogood, G.; Orsi, N.M.; et al. Covert dissemination of carbapenemase-producing Klebsiella pneumoniae (KPC) in a successfully controlled outbreak: Long- and short-read whole-genome sequencing demonstrate multiple genetic modes of transmission. J. Antimicrob. Chemother. 2017, 72, 3025–3034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathers, A.J.; Cox, H.L.; Kitchel, B.; Bonatti, H.; Brassinga, A.K.C.; Carroll, J.; Scheld, W.M.; Hazen, K.C.; Sifri, C.D. Molecular Dissection of an Outbreak of Carbapenem-Resistant Enterobacteriaceae Reveals Intergenus KPC Carbapenemase Transmission through a Promiscuous Plasmid. mBio 2011, 2, e00204-11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carrër, A.; Poirel, L.; Eraksoy, H.; Cagatay, A.A.; Badur, S.; Nordmann, P. Spread of OXA-48-Positive Carbapenem-Resistant Klebsiella pneumoniae Isolates in Istanbul, Turkey. Antimicrob. Agents Chemother. 2008, 52, 2950–2954. [Google Scholar] [CrossRef] [Scilit]
- Mathlouthi, N.; Al-Bayssari, C.; Bakour, S.; Rolain, J.M.; Chouchani, C. Retracted Article: Prevalence and emergence of carbapenemases-producing Gram-negative bacteria in Mediterranean basin. Crit. Rev. Microbiol. 2016, 43, 43–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mairi, A.; Pantel, A.; Sotto, A.; Lavigne, J.-P.; Touati, A. OXA-48-like carbapenemases producing Enterobacteriaceae in different niches. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 37, 587–604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stewart, A.; Harris, P.; Henderson, A.; Paterson, D. Treatment of Infections by OXA-48-Producing Enterobacteriaceae. Antimicrob. Agents Chemother. 2018, 62, e01195-18. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Potron, A.; Nordmann, P. OXA-48-like carbapenemases: The phantom menace. J. Antimicrob. Chemother. 2012, 67, 1597–1606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathlouthi, N.; Al-Bayssari, C.; El Salabi, A.; Bakour, S.; Ben Gwierif, S.; Zorgani, A.A.; Jridi, Y.; Ben Slama, K.; Rolain, J.-M.; Chouchani, C. Carbapenemases and extended-spectrum β-lactamases producing Enterobacteriaceae isolated from Tunisian and Libyan hospitals. J. Infect. Dev. Ctries. 2016, 10, 718–727. [Google Scholar] [CrossRef] [Scilit]
- Benouda, A.; Touzani, O.; Khairallah, M.-T.; Araj, G.F.; Matar, G.M. First detection of oxacillinase-mediated resistance to carbapenems in Klebsiella pneumoniae from Morocco. Ann. Trop. Med. Parasitol. 2010, 104, 327–330. [Google Scholar] [CrossRef] [Scilit]
- Barguigua, A.; El Otmani, F.; Talmi, M.; Zerouali, K.; Timinouni, M. Emergence of carbapenem-resistant Enterobacteriaceae isolates in the Moroccan community. Diagn. Microbiol. Infect. Dis. 2012, 73, 290–291. [Google Scholar] [CrossRef] [Scilit]
- Girlich, D.; Bouihat, N.; Poirel, L.; Benouda, A.; Nordmann, P. High rate of faecal carriage of extended-spectrum β-lactamase and OXA-48 carbapenemase-producing Enterobacteriaceae at a University hospital in Morocco. Clin. Microbiol. Infect. 2014, 20, 350–354. [Google Scholar] [CrossRef] [Scilit]
- Maroui, I.; Barguigua, A.; Aboulkacem, A.; Ouarrak, K.; Sbiti, M.; Louzi, H.; Timinouni, M.; Belhaj, A. First report of VIM-2 metallo-β-lactamases producing Pseudomonas aeruginosa isolates in Morocco. J. Infect. Chemother. 2016, 22, 127–132. [Google Scholar] [CrossRef] [Scilit]
- Barguigua, A.; Zerouali, K.; Katfy, K.; El Otmani, F.; Timinouni, M.; Elmdaghri, N. Occurrence of OXA-48 and NDM-1 carbapenemase-producing Klebsiella pneumoniae in a Moroccan university hospital in Casablanca, Morocco. Infect. Genet. Evol. 2015, 31, 142–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El Hafa, H.; Nayme, K.; El Hamzaoui, N.; Maroui, I.; Sbiti, M.; Zerouali, K.; Timinouni, M.; Belhaj, A. Dissemination of carbapenem-resistant Acinetobacter baumannii strains carrying the blaGES, blaNDM and blaOXA23 in Morocco. Germs 2019, 9, 133–141. [Google Scholar] [CrossRef] [Scilit]
- Taoufik, L.; Hanchi, A.A.; Fatiha, B.; Nissrine, S.; Rabou, M.F.M.; Nabila, S. Emergence of OXA-48 Carbapenemase Producing Klebsiella pneumoniae in a Neonatal Intensive Care Unit in Marrakech, Morocco. Clin. Med. Insights Pediatr. 2019, 13, 1179556519834524. [Google Scholar] [CrossRef] [Scilit]
- El Wartiti, M.A.; Bahmani, F.-Z.; Elouennass, M.; Benouda, A. Prevalence of Carbapenemase-Producing Enterobacteriaceae in a University Hospital in Rabat, Morocco: A 19-Months Prospective Study. Int. Arab. J. Antimicrob. Agents 2012, 2, 1–6. [Google Scholar]
- Pollett, S.; Miller, S.; Hindler, J.; Uslan, D.; Carvalho, M.; Humphries, R.M. Phenotypic and Molecular Characteristics of Carbapenem-Resistant Enterobacteriaceae in a Health Care System in Los Angeles, California, from 2011 to 2013. J. Clin. Microbiol. 2014, 52, 4003–4009. [Google Scholar] [CrossRef] [Scilit]
- Morbidity and Mortality Weekly Report. Vital signs: Carbapenem-resistant Enterobacteriaceae. MMWR 2013, 62, 165–170.
- Jean, S.-S.; Lee, W.-S.; Hsueh, P.-R. Ertapenem non-susceptibility and independent predictors of the carbapenemase production among the Enterobacteriaceae isolates causing intra-abdominal infections in the Asia-Pacific region: Results from the Study for Monitoring Antimicrobial Resistance Trends (SMART). Infect. Drug Resist. 2018, 11, 1881–1891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahin, K.; Tekin, A.; Ozdas, S.; Akin, D.; Yapislar, H.; Dilek, A.R.; Sonmez, E. Evaluation of carbapenem resistance using phenotypic and genotypic techniques in Enterobacteriaceae isolates. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tran, D.M.; Larsson, M.; Olson, L.; Hoang, N.T.; Le, N.K.; Khu, D.T.; Nguyen, H.D.; Vu, T.V.; Trinh, T.H.; Le, T.Q.; et al. High prevalence of colonisation with carbapenem-resistant Enterobacteriaceae among patients admitted to Vietnamese hospitals: Risk factors and burden of disease. J. Infect. 2019, 79, 115–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brolund, A.; Lagerqvist, N.; Byfors, S.; Struelens, M.J.; Monnet, D.L.; Albiger, B.; Kohlenberg, A.; European Antimicrobial Resistance Genes Surveillance Network (EURGen-Net) Capacity Survey Group. Worsening epidemiological situation of carbapenemase-producing Enterobacteriaceae in Europe, assessment by national experts from 37 countries, July 2018. Eurosurveillance 2019, 24, 1900123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Center for Emerging and Zoonotic Infectious Diseases. Facility Guidance for Control of Carbapenem-resistant Enterobacteriaceae (CRE). Available online: http://www.cdc.gov/hai/pdfs/cre/cre-guidance-508.pdf (accessed on 12 November 2020).
- Harish, B.; Mohamudha, P.R.; Parija, S.C. Molecular description of plasmid-mediated AmpC β-lactamases among nosocomial isolates of Escherichia coli & Klebsiella pneumoniae from six different hospitals in India. Indian J. Med Res. 2012, 135, 114–119. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.Y.; Shin, J.; Shin, S.Y.; Ko, K.S. Characteristics of carbapenem-resistant Enterobacteriaceae isolates from Korea. Diagn. Microbiol. Infect. Dis. 2013, 76, 486–490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hays, C.; Benouda, A.; Poirel, L.; Elouennass, M.; Nordmann, P. Nosocomial occurrence of OXA-48-producing enterobacterial isolates in a Moroccan hospital. Int. J. Antimicrob. Agents 2012, 39, 545–547. [Google Scholar] [CrossRef] [Scilit]
- Potron, A.; Kalpoe, J.; Poirel, L.; Nordmann, P. European dissemination of a single OXA-48-producing Klebsiella pneumoniae clone. Clin. Microbiol. Infect. 2011, 17, E24–E26. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Ros, A.; Carrër, A.; Fortineau, N.; Carricajo, A.; Berthelot, P.; Nordmann, P. Cross-border transmission of OXA-48-producing Enterobacter cloacae from Morocco to France. J. Antimicrob. Chemother. 2011, 66, 1181–1182. [Google Scholar] [CrossRef] [Scilit]
- Arana, D.M.; Ortega, A.; González-Barberá, E.; Lara, N.; Bautista, V.; Gómez-Ruíz, D.; Sáez, D.; Fernández-Romero, S.; Aracil, B.; Pérez-Vázquez, M.; et al. Carbapenem-resistant Citrobacter spp. isolated in Spain from 2013 to 2015 produced a variety of carbapenemases including VIM-1, OXA-48, KPC-2, NDM-1 and VIM-2. J. Antimicrob. Chemother. 2017, 72, 3283–3287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lalaoui, R.; Djukovic, A.; Bakour, S.; Hadjadj, L.; Sanz, J.; Salavert, M.; López-Hontangas, J.L.; Sanz, M.A.; Ubeda, C.; Rolain, J.-M. Genomic characterization of Citrobacter freundii strains coproducing OXA-48 and VIM-1 carbapenemase enzymes isolated in leukemic patient in Spain. Antimicrob. Resist. Infect. Control. 2019, 8, 167. [Google Scholar] [CrossRef] [Scilit]
- Dortet, L.; Poirel, L.; Nordmann, P. Worldwide Dissemination of the NDM-Type Carbapenemases in Gram-Negative Bacteria. BioMed Res. Int. 2014, 2014, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Nahid, F.; Khan, A.A.; Rehman, S.; Zahra, R. Prevalence of metallo-β-lactamase NDM-1-producing multi-drug resistant bacteria at two Pakistani hospitals and implications for public health. J. Infect. Public Health 2013, 6, 487–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Chen, G.; Wu, X.; Wang, L.; Cai, J.; Chan, E.W.; Chen, S.; Zhang, R. Increased prevalence of carbapenem resistant Enterobacteriaceae in hospital setting due to cross-species transmission of the blaNDM-1 element and clonal spread of progenitor resistant strains. Front. Microbiol. 2015, 6, 595. [Google Scholar] [CrossRef] [Scilit]
- Barguigua, A.; El Otmani, F.; El Yaagoubi, F.L.; Talmi, M.; Zerouali, K.; Timinouni, M. First report of a Klebsiella pneumoniae strain coproducing NDM-1, VIM-1 and OXA-48 carbapenemases isolated in Morocco. APMIS 2012, 121, 675–677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahrach, Y.; Mourabit, N.; Arakrak, A.; Bakkali, M.; Laglaoui, A. Phenotypic and Molecular Study of Car-bapenemase-Producing Enterobacteriaceae in a Regional Hospital in Northern Morocco. J. Clin. Med. Sci. 2019, 3, 113. [Google Scholar] [CrossRef]
- Mentasti, M.; Prime, K.; Sands, K.; Khan, S.; Wootton, M. Rapid detection of IMP, NDM, VIM, KPC and OXA-48-like carbapenemases from Enterobacteriales and Gram-negative non-fermenter bacteria by real-time PCR and melt-curve analysis. Eur. J. Clin. Microbiol. Infect. Dis. 2019, 38, 2029–2036. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Bonnin, R.A.; Nordmann, P. Genetic Features of the Widespread Plasmid Coding for the Carbapenemase OXA-48. Antimicrob. Agents Chemother. 2011, 56, 559–562. [Google Scholar] [CrossRef] [Scilit]
- Al Bayssari, C.; Diene, S.M.; Loucif, L.; Gupta, S.K.; Dabboussi, F.; Mallat, H.; Hamze, M.; Rolain, J.-M. Emergence of VIM-2 and IMP-15 Carbapenemases and Inactivation ofoprDGene in Carbapenem-Resistant Pseudomonas aeruginosa Clinical Isolates from Lebanon. Antimicrob. Agents Chemother. 2014, 58, 4966–4970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diene, S.M.; Bruder, N.; Raoult, D.; Rolain, J.-M. Real-time PCR assay allows detection of the New Delhi metallo-β-lactamase (NDM-1)-encoding gene in France. Int. J. Antimicrob. Agents 2011, 37, 544–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Touati, M.; Diene, S.M.; Dekhil, M.; Djahoudi, A.; Racherache, A.; Rolain, J.-M. Dissemination of a Class I Integron Carrying VIM-2 Carbapenemase in Pseudomonas aeruginosa Clinical Isolates from a Hospital Intensive Care Unit in Annaba, Algeria. Antimicrob. Agents Chemother. 2013, 57, 2426–2427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, S.; Dai, W.; Sun, S.; Zhang, X.; Zhang, L. Prevalence of Plasmid-Mediated Quinolone Resistance and Aminoglycoside Resistance Determinants among Carbapeneme Non-Susceptible Enterobacter cloacae. PLoS ONE 2012, 7, e47636. [Google Scholar] [CrossRef] [Scilit]

| Antibiotics * | All (n = 131) | K. pneumoniae (n = 77) | E. cloacae (n = 31) | E. coli (n = 13) |
|---|---|---|---|---|
| ETP | 100% (n = 131) | 98.7% (n = 76) | 100% (n = 31) | 100% (n = 13) |
| IMP | 83.21% (n = 109) | 80.5% (n = 62) | 84% (n = 26) | 76.92% (n = 10) |
| GEN | 100% (n = 131) | 100% (n = 77) | 100% (n = 31) | 100% (n = 13) |
| CIP | 87.02%(n = 114) | 84.42% (n = 65) | 93.55% (n = 29) | 84.61% (n = 11) |
| SXT | 87.79% (n = 115) | 88.30 (n = 68) | 93.55% (n = 29) | 76.92% (n = 10) |
| PTZ | 100% (n = 131) | 100% (n = 77) | 100% (n = 31) | 100% (n = 13) |
| CS | 34.35% (n = 45) | 27.27% (n = 21) | 48.39% (n = 15) | 38.46% (n = 5) |
| Species | blaOXA-48 | blaNDM | blaKPC | blaVIM | blaOXA-48 + blaNDM | blaOXA-48 + blaKPC | blaNDM + blaKPC | blaNDM + blaVIM | Unknown | Total |
|---|---|---|---|---|---|---|---|---|---|---|
| K. pneumoniae (n = 77) | 25 | 13 | 0 | 5 | 26 | 0 | 0 | 0 | 8 | 77 |
| K. oxytoca (n = 3) | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 3 |
| E. cloacae (n = 31) | 10 | 7 | 0 | 1 | 6 | 0 | 0 | 0 | 7 | 31 |
| E. coli (n = 13) | 4 | 4 | 0 | 0 | 3 | 0 | 0 | 0 | 2 | 13 |
| C. freundii (n = 4) | 0 | 1 | 0 | 1 | 2 | 0 | 0 | 0 | 0 | 4 |
| C. braakii (n = 1) | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 1 |
| S. marcescens (n = 2) | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 1 | 2 |
| Total | 40 | 27 | 0 | 7 | 38 | 0 | 0 | 0 | 19 | 131 |
| Target Gene | Type of PCR | Primer Name | Primers/Sond | Amplicon Size (bp) | Ref. |
|---|---|---|---|---|---|
| OXA-48 | Standard PCR | OXA48_STD_F | TTGGTGGCATCGATTATCGG | 744 | [52] |
| OXA48_STD_R | GAGCACTTCTTTTGTGATGGC | ||||
| Real-time PCR | OXA48_RT_F | TCTTAAACGGGCGAACCAAG | 125 | [53] | |
| OXA48_RT_R | GCGTCTGTCCATCCCACTTA | ||||
| OXA48_RT_Probe | 6-FAM-AGCTTGATCGCCCTCGATTTGG-TAMRA | ||||
| NDM | Standard PCR | NDM-1-F | CATTTGCGGGGTTTTTAATG | 1022 | [54] |
| NDM-1-R | CTGGGTCGAGGTCAGGATAG | ||||
| Real-time PCR | NDM_RT_F | GCGCAACACAGCCTGACTTT | 155 | [54] | |
| NDM_RT_R | CAGCCACCAAAAGCGATGTC | ||||
| NDM_RT_Probe | 6-FAM-CAACCGCGCCCAACTTTGGC-TAMRA | ||||
| KPC | Standard PCR | KPC-F | ATGTCACTGTATCGCCGTCT | 893 | [54] |
| KPC-R | TTTTCAGAGCCTTACTGCCC | ||||
| Real-time PCR | KPC-F | GATACCACGTTCCGTCTGGA | 180 | [23] | |
| KPC-R | GGTCGTGTTTCCCTTTAGCC | ||||
| KPC-Probe | 6-FAM-CGCGCGCCGTGACGGAAAGC-TAMRA | ||||
| VIM | Standard PCR | VIM-F | TGGTCTACATGACCGCGTCT | 766 | [55] |
| VIM-R | CGACTGAGCGATTTGTGTG | ||||
| Real-time PCR | VIM-F | CACAGYGGCMCTTCTCGCGGAGA | 132 | [53] | |
| VIM-R | GCGTACGTYGCCACYCCAGCC | ||||
| VIM-Probe | 6-FAM-AGTCTCCACGCACTTTCATGACGACCGCGTCGGCG-TAMRA | ||||
| IMP | Standard PCR | IMP-F | CATGGTTTGGTGGTTCTTGT | 488 | [56] |
| IMP-R | ATAATTTGGCGGACTTTGGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Loqman, S.; Soraa, N.; Diene, S.M.; Rolain, J.-M. Dissemination of Carbapenemases (OXA-48, NDM and VIM) Producing Enterobacteriaceae Isolated from the Mohamed VI University Hospital in Marrakech, Morocco. Antibiotics 2021, 10, 492. https://doi.org/10.3390/antibiotics10050492
Loqman S, Soraa N, Diene SM, Rolain J-M. Dissemination of Carbapenemases (OXA-48, NDM and VIM) Producing Enterobacteriaceae Isolated from the Mohamed VI University Hospital in Marrakech, Morocco. Antibiotics. 2021; 10(5):492. https://doi.org/10.3390/antibiotics10050492
Chicago/Turabian StyleLoqman, Souad, Nabila Soraa, Seydina M. Diene, and Jean-Marc Rolain. 2021. "Dissemination of Carbapenemases (OXA-48, NDM and VIM) Producing Enterobacteriaceae Isolated from the Mohamed VI University Hospital in Marrakech, Morocco" Antibiotics 10, no. 5: 492. https://doi.org/10.3390/antibiotics10050492
APA StyleLoqman, S., Soraa, N., Diene, S. M., & Rolain, J.-M. (2021). Dissemination of Carbapenemases (OXA-48, NDM and VIM) Producing Enterobacteriaceae Isolated from the Mohamed VI University Hospital in Marrakech, Morocco. Antibiotics, 10(5), 492. https://doi.org/10.3390/antibiotics10050492

