Next Article in Journal
Galactose-Clicked Curcumin-Mediated Reversal of Meropenem Resistance among Klebsiella pneumoniae by Targeting Its Carbapenemases and the AcrAB-TolC Efflux System
Previous Article in Journal
Association between Periodontal Disease and Systemic Inflammatory Conditions Using Electronic Health Records: A Pilot Study
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 4
10.3390/antibiotics10040387
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China

by
Yan Zhang
1,2,
Yin-Huan Sun
2,
Jiang-Yang Wang
2,
Man-Xia Chang
2,
Qiu-Yun Zhao
2 and
Hong-Xia Jiang
1,2,*
1
Guangdong Laboratory for Lingnan Modern Agriculture, Guangzhou 510642, China
2
Guangdong Key Laboratory for Veterinary Drug Development and Safety Evaluation, College of Veterinary Medicine, South China Agricultural University, Guangzhou 510642, China
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(4), 387; https://doi.org/10.3390/antibiotics10040387
Submission received: 9 March 2021 / Revised: 31 March 2021 / Accepted: 2 April 2021 / Published: 4 April 2021
Browse Figures
Review Reports Versions Notes

Abstract

:
The aim of this study was to elucidate the prevalence of blaCTX-M-27-producing Escherichia coli and transmission mechanisms of blaCTX-M-27 from swine farms in China. A total of 333 E. coli isolates were collected from two farms from 2013 to 2016. Thirty-two CTX-M-27-positive E. coli were obtained, and all were multidrug-resistant. Pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) profiles indicated a wide range of strain types that carried blaCTX-M-27, and the sequence type ST10 predominated. Conjugation, replicon typing, S1-PFGE and hybridization experiments confirmed that 28 out of 32 CTX-M-27 positive isolates carried blaCTX-M-27 genes on plasmids F18:A-:B10 (16) and F24:A-:B1 (12).The blaCTX-M-27 genes for 24 isolates were transmitted by plasmids with sizes ranging from 40 to 155 kb. A comparative analysis with blaCTX-M-27-plasmids indicated that the tra-trb region of F24:A-:B1 plasmids was destroyed by insertion of a complex region (eight isolates) and a novel structure containing blaCTX-M-27 in the F18:A-:B10 plasmids (12 isolates). The novel structure increased the stability of the blaCTX-M-27 gene in E. coli. This study indicated that the predominant vehicle for blaCTX-M-27 transmission has diversified over time and that control strategies to limit blaCTX-M-27 transmission in farm animals are necessary.

1. Introduction

Production of extended-spectrum β-lactamases (ESBLs) is the principal mechanism of resistance to cephalosporins. CTX-Ms was the largest group of ESBLs, and they have become globally disseminated [1]. A recent study indicated that food-producing animals represent an important source of blaCTX-M-producing E coli isolates [2]. CTX-M-15 and CTX-M-14 are the most prevalent. Additionally, blaCTX-M-27 has been detected as increasing rapidly in prevalence [1]. The detection of CTX-M-27 in Escherichia coli patient isolates has been increasing, and is especially alarming because of its presence in clonal groups such as ST10, ST69 and ST131 [3,4,5,6]. In particular, E. coli ST131 isolates are the primary hosts responsible for CTX-M-27 transmission in E. coli from companion animals, the environment, farm animals and animal products [3,7,8,9,10,11,12,13]. IncF plasmids and transposons are frequently associated with transfer of blaCTX-M-27 in E. coli and are frequently associated with IncF plasmids and transposons [14,15]. The pressure of antibiotics could facilitate the evolution of the transmission mechanism of blaCTX-M. The prevalence of blaCTX-M-27 in Salmonella isolated from food animals is also increasing, and transduction of blaCTX-M-27 in Salmonella isolated from pork has been recently demonstrated to be mediated by a P1-like bacteriophage that had integrated a Tn1721-like structure [16]. A prospective study utilizing salmonella and E. coli isolates from 2003 to 2014 indicated that blaCTX-M-27 could be mobilized via a Tn1721-like structure between E. coli plasmids and P1-like bacteriophage in salmonella [17].
Intestinal carriage of CTX-M-producing bacteria (especially pathogenic bacteria) in food-producing animals and retail meat or dairy products contaminated by CTX-M β-lactamases might contribute to increased occurrence of infections with ESBL-producing bacteria in humans [18]. The prevalent vehicle for blaCTX-M transmission has diversified over time. This would lead to the further spread of the blaCTX-M-27 gene and further highlights the importance of controlling the spread of blaCTX-M-27. In the current work we investigated the prevalence and transmission mechanisms of CTX-M-27 E. coli from swine in Guangdong province, China from 2013 to 2016. We identified a novel structure containing blaCTX-M-27 that contributed to the stability of blaCTX-M-27 in E. coli.

2. Results and Discussion

2.1. Phenotypes of blaCTX-M-27-Carrying Isolates

We surveyed two swine farms in Guangdong province and confirmed the presence of blaCTX-M-27 in 32 E. coli isolates including 62.5% (20) from farm 1 and 37.5% (12) from farm 2 (Figure 1). CTX-M-27 has been only sporadically detected in E. coli isolates from food-producing animals, and its prevalence has remained constant at <8% over the past decade [17,19]. The prevalence of blaCTX-M-27 in our study (9.61%) was higher than in previous studies. Importantly, all 32 CTX-M-27 isolates were multidrug-resistant (MDR) strains (Table S1). The prevalence of ciprofloxacin-resistance in these isolates was 93.75% compared with 77.78% from isolates in 2003 to 2009 in China on swine farms [17], and the prevalence of ciprofloxacin resistance in blaCTX-M-14 or blaCTX-M-15-producing E. coli almost above 80% [20,21]. Additionally, we detected QRDR (Quinolone Resistance Determining Regions) mutations in gyrA (S83L and D87N) and parC (S80I) in high-level quinolone resistant isolates (28), and 14 of these coharbored oqxAB (Figure 1). This was consistent with a previous study where blood isolates of blaCTX-M-27-producing ST131 E. coli possessed QRDR mutations that enabled high level resistance to quinolones [22]. Similarly, blaCTX-M-14, blaCTX-M-55, blaCTX-M-15 and blaCTX-M-9-producing E. coli possessed QRDR mutations and carried PMQR genes that enabled high level resistance to quinolones [23]. In contrast, our isolates possessed a lower MICCIP range of 0.25 to 1 μg/mL but did not contain QRDR mutations although either qnrS or oqxAB were present. This was consistent with a previous study reporting that blaCTX-M-55-producing salmonella with an MICCIP in the 0.5 to 4 μg/mL range did not contain QRDR mutations but all contained qnrS [24]. In addition, 9/32 (28.1%) of our isolates coharbored mcr-1, and these exhibited resistance to colistin at MIC = 8 μg/mL (Figure 1).
The coexistence or cotransfer of other resistance genes in CTX-M-producing E. coli strains increases their probability of survival in the presence of other antibiotics, including the cephalosporins [24,25,26]. Infections caused by MDR bacteria are becoming common and represents a serious public health concern [27].

2.2. Molecular Typing Analysis

In our group of 32 CTX-M-27-producing E. coli isolates, we identified seven sequence types (ST). The ST131 was previously found to be associated with blaCTX-M-27 in Japan, North America and Europe [28,29,30]. However, ST131 was not present in any of our isolates. We found that ST10 was most prevalent (50%, 16/32) followed by ST224 (28.1%, 9/32), ST101 (9.4%, 3/32). ST10 and ST224 were detected on both farms. The isolates containing ST46, ST162, ST93 and ST58 were represented by one isolate each (Figure 1). Recent reports documented that ST10 and ST224 E. coli are primarily carriers of CTX-M-15, CTX-M-14, CTX-M-1 and CTX-M-8 [31,32,33,34,35,36,37]. Our recent study identified ST8900 as the most prevalent ST (Sequence Typing) in CTX-M-27-positive E. coli isolates obtained during 2003 to 2009 [17]. These results indicate that the dominant ST of blaCTX-M-27-producing E. coli has changed. ST10 E. coli contributes to the distribution of the blaCTX-M-27 gene on swine farms in China. Previous studies showed that although the epidemiology and population dynamics of Global Extraintestinal Pathogenic E. coli (ExPEC) are complex, ST10 was the major ST the ExPEC (Extraintestinal Pathogenic Escherichia coli) group, and has remained at a constant level. ST10 has now been linked to multidrug resistance gene carriage or ESBL production [38]. Increased numbers of antibiotic resistance genes have been found and are carried by pathogenic bacteria and this is a human health concern. The 32 CTX-M-27 isolates we found could also be divided into 14 different PFGE clusters. These data indicated that the transmission of blaCTX-M-27 among E. coli isolates occurred via clonal expansion and horizontal transmission. The results of both clonal spread of resistant strains and horizontal transmission of the resistance plasmids contributed to the dissemination of blaCTX-M-27-positive salmonella or E. coli isolates were also obtained in previous studies [16,17,39].

2.3. Location and Genetic Context of the blaCTX-M-27 Gene

The genomic locations of the blaCTX-M-27 for our 32 isolates included F plasmids of 40–155 kb for 28 isolates and four were present on nontypeable incompatibility group plasmids. Most of these endogenous plasmids (24. 75%) could be successfully transferred to a laboratory strain E. coli C600 by conjugation. This was consistent with previous studies reporting that IncF plasmids are frequently associated with blaCTX-M genes [17]. Plasmid multilocus sequence typing (pMLST) of the IncF plasmids indicated only two plasmid types: F18:A-:B10 (16) and F24:A-:B1 (12) (Figure 1).
The plasmid p1-8 (F18:A-:B10) was completely sequenced (155,669 bp), possessed a G + C content of 51.56% and possessed a full complement of DNA transfer genes in the F18:A-:B10 backbone (Figure 2B). These transfer regions were highly similar to other F plasmids and differed by the number of CAACAGCCG tandem repeats in the traD gene. Our isolates all possessed only one of these repeats and were highly similar to that of a blaCTX-M-55-harboring F18:A-:B1 plasmid pCREC-544_1 (NZ_CP024827.1) from a human clinical isolate from Korea, and a blaNDM-5-harboring F18:A-:B58 plasmid pMTY18780-2 (NZ_AP023199.1) human isolate from Japan. IncF plasmids have been implicated as main players for transmission of blaCTX-M-27 [40]. So, we estimate that F18:A-:Bx plasmids are the primary vectors for animal to human transmission of most antibiotic resistance genes, and this has significant health implications for both humans and animals.
The second plasmid pM8-1 (F24:A-:B1) we identified possessed DNA transfer genes that had been altered by insertion of a 17,034 bp region that included TnAs3, IS5075, IS26, intI1, mph and IS6100, as well as two IS26 copies in the same orientation. This insertion destroyed traI and traN, and the entire trbH/F/G/B/A/E, traD/T/S/G/H/Q/F region was lost (Figure 2). A similar disruption was previously documented for pHNAH9 that lacked most parts of the tra-trb region due to multiple recombination events, and this most likely accounted for its conjugation failure. Our F24:A-:B1 plasmids were highly similar to pHNAH9 [41]. These results indicate that E. coli ST224 possessing F24:A-:B1 was disseminated prior to its acquisition of blaCTX-M-27, similar to the blaCTX-M-carrying F1:A2:B20 plasmid in E. coli ST131-H30R1 [42].
The region (Figure 3a) containing blaCTX-M-27 (17354 bp) was present in both our plasmid types, F18:A-:B10 and F24:A-:B1. This region was identical to the variable region from pMRY15_117 (accession no: NZ_AP017618.1, Figure 3a). The insertion of ISEcp1-blaCTX-M-27-IS903B in the tnpA transposition gene of Tn2 might be expected to prevent transposition. However, IRTEM had been lost, although the IRtnp and the resolvase (res) sites were intact. Therefore, it is possible that the TnpA function was provided by another Tn3-like transposon and that this mediated movement of this interrupted Tn2 region [43]. Thus, Tn2-mediated events contributed to the spread of blaCTX-M-27 in the F24:A-:B1 plasmids.
We also identified another genetic context contained within a 22,178 bp insertion (Figure 3b). This was a novel structure associated with blaCTX-M-27. The region responsible for blaCTX-M-27 transfer possessed a common background region ΔISEcp1-blaCTX-M-27-IS903B within the variable region. The region downstream of IS903B was the 312 bp ΔtnpA of Tn2 produced by the insertion of IS15DI and TnAs3 in pSCU-103 (CP054458.1) (Figure 3d) and differed from p53_A (Figure 3e) (684 bp ΔtnpA/res/tnpR of Tn2). In p4_4.1 (CP023827.1) (Figure 3c), the insertion of IS15 resulted in ΔtnpR/res/tnpAΔ-iroNΔ inversion. The iroN and Tn2 sequences were lost, and R1, R2, R3 and aadA5-qacEΔ1-sul1 were all inverted in p1-8, while intI1 and dfrA17 from In54 were lost (Figure 3b). Taken together, these results indicate that Tn2 was incomplete and incapable of transfer of blaCTX-M-27 in these plasmids. Therefore, F18:A-:B10 was one of the primary contributors to the spread of blaCTX-M-27 in E. coli for our swine isolates and resulted in greater stability of blaCTX-M-27 in clinical isolates. This indicates that the blaCTX-M-27 gene was stable in vehicles and its natural host. The plasmid can mediate its transmission in a wider range hosts, which poses a serious threat to public health. The ISEcp1-like family has been shown to act as a promoter region for high-level expression of different CTX-M enzymes in a previous study [44]. The conserved region responsible for transmission of blaCTX-M-27 was ISECP1-blaCTX-M-27-IS903B. Since more complex structures that mediate transmission of blaCTX-M-27 have been recently described, and a diversity of media promotes the transmission of blaCTX-M-27, it may cause a serious threat to public health.
The F18:A-:B10 plasmids may make it easier for E. coli ST10 to acquire blaCTX-M-27, and similar results have been reported for the MDR IncF group F1:A2:B20 plasmid in E. coli ST131-H30R1 [42]. Our recent work revealed that blaCTX-M-27-plasmids isolated from 2003 to 2009 contained a genetic context with the Tn1721-like structure ΔISEcp1B-blaCTX-M-27-IS903D-iroN-Δmap-Tn1721 [17]. In contrast, the present study indicated that the horizontal transmission of blaCTX-M-27 was related to Tn2, so that the prevalent vehicle for blaCTX-M-27 transmission has diversified over time.

3. Materials and Methods

A total of 333 E. coli isolates were isolated from swine swabs from Guangdong province, China and were maintained in our laboratory. These were obtained between June 2013 and September 2016 from farm 1 (95/236, 40.25%) and farm 2 (141/236, 59.75%). The presence of the blaCTX-M-27 gene was confirmed by PCR (Polymerase Chain Reaction) and DNA sequencing [45]. The minimum inhibitory concentration (MIC) of blaCTX-M-27-positive isolates was determined for the following: ampicillin (AMP), ceftiofur (CTF), cefotaxime (CTX), ceftazidime (CTZ), meropenem (MRO), florfenicol (FLF), chloramphenicol (CHL), gentamycin (GEN), streptomycin (STR), amikacin (AMI), apramycin (APR), ciprofloxacin (CIP), nalidixic acid (NAL), dafloxacin (DF), olaquindox (OQX), tetracycline (TET), fosfomycin (FOS), enrofloxacin (ENR) and kanamycin (KAN), determined by the agar dilution method, and colistin (CL) was determined by the microdilution broth method. Escherichia coli ATCC 25,922 was used as a quality control strain. The results were interpreted following Clinical and Laboratory Standards Institution (CLSI) guidelines (2015, M100-S25) and veterinary CLSI (VET01-A4/VET01-S2).
All blaCTX-M-27 positive isolates were screened for the presence of the β-lactamase genes (blaTEM, blaSHV, blaCTX-M-1G, blaCTX-M-9G), carbapenem resistance genes (blaIMP, blaVIM, blaNDM, blaOXA) and PMQR genes (qnrA, qnrB, qnrC, qnrD, qnrS, oqxAB, aac(6‘)-Ib-cr, qepA) using previously described primers and protocols [18]. The DNA sequences and deduced amino acid sequences were compared with sequences available at GenBank using BLAST (Basic Local Alignment Search Tool) https://blast.ncbi.nlm.nih.gov/Blast.cgi (blaCTX-M-27-bearing plasmids from the NCBI nonredundant database were retrieved as of 15 February 2021). Mutations in the QRDR of the target genes gyrA, gyrB, parC, parE were confirmed by PCR and sequencing, and compared with the E. coli K12 genome as a reference.
MLST was performed for blaCTX-M-27-producing isolates as previously reported [46]. The PCR and DNA sequence analysis of seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA and recA) was performed, the allelic profiles were determined, and the sequence type (ST) was assigned in accordance with http://mlst.warwick.ac.uk/mlst/dbs/, (accessed on 15 February 2021). Pulsed field gel electrophoresis (PFGE) patterns with the XbaI enzyme were analyzed in experiments following the method of Jiang et al. for genetic relatedness of all blaCTX-M-27-harboring isolates [18].
E. coli C600 strain (streptomycin-resistant) was used as donor strain and clinical blaCTX-M-27-producing strains were used as recipient strains to test the transferability of the blaCTX-M-27 gene. Transconjugants were selected on MacConkey agar supplemented with 1 mg/L cefotaxime and 2000 mg/L streptomycin [18]. PCR-based replicon typing (PBRT) was performed on all transconjugants with blaCTX-M-27-carrying plasmids using primers as previously described [47]. To determine the location of blaCTX–M–27, all the transconjugants were subjected to pulsed-field gel electrophoresis (PFGE) with S1 nuclease (Takara) and Southern transfer and probing with a digoxigenin-labelled probes specific for the blaCTX-M-9G gene as described previously [16].
Genomic DNA samples from M8-1 and transconjugant C-1-8 were subjected to 250-bp paired-end whole-genome sequencing using the Illumina HiSeq system (Illumina, San Diego, CA, USA), and the paired-end Illumina reads were assembled by SOAPdenovo version 2.04 [48]. To obtain the complete sequence of p1-8, PCR and Sanger sequencing was applied to close all the suspected gaps. Sequence comparisons of M8-1 and pMRY15_117 (NZ_AP017618.1) were performed using BLAST (http://blast.ncbi.nlm.nih.gov (accessed on 15 February 2021)) and Mauve [49], and similar contigs were extracted from the assemblies.
Specific primers used for further analysis of genomic context sequence on the other plasmids carrying blaCTX-M-27 gene were designed using Primer Premier v5.0 (IS1-8-fw: TCCGACACGATAGAAGGAAT/IS1-8-rev: TTGCCATCACGACTGTGC; ISM8-1-fw: CCGTCAGAAGTAAGTTGGC/ISM8-1-rev: GTGGACTGTGGGTGATAAGA). Target sequences were identified using PCR (30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C (p1-8)/52.9 °C (pM8-1) for 30 s and extension at 72 °C for 4 min 30 s. This was followed by an additional 10 min extension at 72 °C) and amplicon identities were confirmed by Sanger sequencing [50]. Gene prediction and annotation of contigs were performed using the RAST (Rapid Annotation using Subsystem Technology) server (http://rast.nmpdr.org/ (accessed on 15 February 2021)) [51] and BLAST was used for a manual review of results. The ISfinder program (https://www-is.biotoul.fr/ (accessed on 15 February 2021)) [52] and ResFinder (https://cge.cbs.dtu.dk//services/ResFinder/ (accessed on 15 February 2021)) were used to identify mobile elements and resistance genes. The replicon types of plasmids were analyzed using the plasmid MLST database (http://pubmlst.org/plasmid/ (accessed on 15 February 2021)).

4. Conclusions

In this study we identified ST10 E. coli as one of the dominant vehicles for blaCTX-M-27 transmission in China. We report a novel structure containing blaCTX-M-27 that contributed to the persistence of this gene in E. coli. This study identified multidrug-resistant IncF group F18:A-:B10 plasmids that contributed to the spread of blaCTX-M-27 in E. coli. E. coli ST224 possessing F24:A-:B1 were likely transmitted before acquiring blaCTX-M-27, and Tn2-related events may have contributed to the spread of blaCTX-M-27 in F24:A-:B1 plasmids. Additionally, the prevalent vehicle for blaCTX-M-27 transmission has diversified over time so that that transmission of the blaCTX-M-27 gene in farm animals should be closely monitored.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10040387/s1, Table S1: Antimicrobial resistance of 32 CTX-M-27 producing Escherichia coli from swine in china, Table S2: Primers used in this study.

Author Contributions

Y.-H.S., J.-Y.W. and Y.Z.; the antimicrobial susceptibility tests and PCR amplification; Y.Z. and Y.-H.S.; conjugation experiments, S1-PFGE and southern blotting; Y.Z., Q.-Y.Z. and M.-X.C.; bioinformatics analyses, visualization and wrote the paper; H.-X.J.; acquired funding and edited the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant number 31972734) and the Local Innovative and Research Teams Project of Guangdong Pearl River Talents Program (Grant number 2019BT02N054).

Informed Consent Statement

Not applicable.

Data Availability Statement

The complete nucleotide sequence of plasmids p1-8 have been deposited to the GenBank database and assigned accession number MW633522.

Acknowledgments

The authors would like to thank all the laboratory researchers that collected the Escherichia coli strains over several years.

Conflicts of Interest

The other authors have no conflict of interest to disclose.

References

  1. Bevan, E.R.; Jones, A.M.; Hawkey, P.M. Global epidemiology of CTX-M β-lactamases: Temporal and geographical shifts in genotype. J. Antimicrob. Chemother. 2017, 72, 2145–2155. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Huang, Y.; Zeng, L.; Doi, Y.; Lv, L.; Liu, J.H. Extended-spectrum beta-lactamase-producing Escherichia coli. Lancet Infect. Dis. 2020, 20, 404–405. [Google Scholar] [CrossRef]
  3. Matsumura, Y.; Johnson, J.R.; Yamamoto, M.; Nagao, M.; Tanaka, M.; Takakura, S.; Ichiyama, S.; Kyoto, S.C.M.S.; Kyoto-Shiga, C.M.S.G. CTX-M-27- and CTX-M-14-producing, ciprofloxacin-resistant Escherichia coli of the H30 subclonal group within ST131 drive a Japanese regional ESBL epidemic. J. Antimicrob. Chemother. 2015, 70, 1639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Rohde, A.M.; Zweigner, J.; Wiese-Posselt, M.; Schwab, F.; Behnke, M.; Kola, A.; Schröder, W.; Peter, S.; Tacconelli, E.; Wille, T.; et al. Prevalence of third-generation cephalosporin-resistant Enterobacterales colonization on hospital admission and ESBL genotype-specific risk factors: A cross-sectional study in six German university hospitals. J. Antimicrob. Chemother. 2020, 75, 1631–1638. [Google Scholar] [CrossRef] [PubMed]
  5. Flament-Simon, S.; García, V.; Duprilot, M.; Mayer, N.; Alonso, M.P.; García-Meniño, I.; Blanco, J.E.; Blanco, M.; Nicolas-Chanoine, M.; Blanco, J. High Prevalence of ST131 Subclades C2-H30Rx and C1-M27 Among Extended-Spectrum β-Lactamase-Producing Escherichia coli Causing Human Extraintestinal Infections in Patients from Two Hospitals of Spain and France During 2015. Front. Cell Infect. Microbiol. 2020, 10. [Google Scholar] [CrossRef]
  6. García-Meniño, I.; García, V.; Mora, A.; Díaz-Jiménez, D.; Flament-Simon, S.C.; Alonso, M.P.; Blanco, J.E.; Blanco, M.; Blanco, J. Swine Enteric Colibacillosis in Spain: Pathogenic Potential of mcr-1 ST10 and ST131 E. coli Isolates. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef]
  7. Kawamura, K.; Sugawara, T.; Matsuo, N.; Hayashi, K.; Norizuki, C.; Tamai, K.; Kondo, T.; Arakawa, Y. Spread of CTX-Type Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolates of Epidemic Clone B2-O25-ST131 Among Dogs and Cats in Japan. Microb. Drug Resist. 2017, 23, 1059–1066. [Google Scholar] [CrossRef] [PubMed]
  8. Piccirilli, A.; Pompilio, A.; Rossi, L.; Segatore, B.; Amicosante, G.; Rosatelli, G.; Perilli, M.; Di Bonaventura, G. Identification of CTX-M-15 and CTX-M-27 in Antibiotic-Resistant Gram-Negative Bacteria Isolated from Three Rivers Running in Central Italy. Microb. Drug Resist. 2019, 25, 1041–1049. [Google Scholar] [CrossRef]
  9. Pepin-Puget, L.; El Garch, F.; Bertrand, X.; Valot, B.; Hocquet, D. Genome analysis of enterobacteriaceae with non-wild type susceptibility to third-generation cephalosporins recovered from diseased dogs and cats in Europe. Vet. Microbiol. 2020, 242, 108601. [Google Scholar] [CrossRef]
  10. Aguirre, L.; Vidal, A.; Seminati, C.; Tello, M.; Redondo, N.; Darwich, L.; Martín, M. Antimicrobial resistance profile and prevalence of extended-spectrum beta-lactamases (ESBL), AmpC beta-lactamases and colistin resistance (mcr) genes in Escherichia coli from swine between 1999 and 2018. Porc. Health Manag. 2020, 6. [Google Scholar] [CrossRef] [Green Version]
  11. Tamang, M.D.; Nam, H.; Kim, S.; Chae, M.H.; Jang, G.; Jung, S.; Lim, S. Prevalence and Molecular Characterization of CTX-M β-Lactamase–Producing Escherichia coli Isolated from Healthy Swine and Cattle. Foodborne Pathog. Dis. 2013, 10, 13–20. [Google Scholar] [CrossRef]
  12. Ball, T.A.; Monte, D.F.; Aidara-Kane, A.; Matheu-Alvarez, J.; Ru, H.; Thakur, S.; Horovitz, J.; Ejobi, F.; Lacher, D.W.; Fedorka-Cray, P.J. Phenotypic and Genotypic Characterization of Escherichia coli and Salmonella enterica from Dairy Cattle Farms in the Wakiso District, Uganda: A Cross-Sectional Study. Foodborne Pathog. Dis. 2019, 16, 54–59. [Google Scholar] [CrossRef]
  13. Afema, J.A.; Ahmed, S.; Besser, T.E.; Jones, L.P.; Sischo, W.M.; Davis, M.A. Molecular Epidemiology of Dairy Cattle-Associated Escherichia coli Carrying blaCTX-M Genes in Washington State. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [Green Version]
  14. Matsumura, Y.; Pitout, J.D.D.; Gomi, R.; Matsuda, T.; Noguchi, T.; Yamamoto, M.; Peirano, G.; DeVinney, R.; Bradford, P.A.; Motyl, M.R.; et al. Global Escherichia coli Sequence Type 131 Clade with blaCTX-M-27 Gene. Emerg. Infect. Dis. 2016, 22, 1900–1907. [Google Scholar] [CrossRef] [Green Version]
  15. Tadesse, D.A.; Li, C.; Mukherjee, S.; Hsu, C.; Bodeis Jones, S.; Gaines, S.A.; Kabera, C.; Loneragan, G.H.; Torrence, M.; Harhay, D.M.; et al. Whole-Genome Sequence Analysis of CTX-M Containing Escherichia coli Isolates from Retail Meats and Cattle in the United States. Microb. Drug Resist. 2018, 24, 939–948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Yang, L.; Li, W.; Jiang, G.; Zhang, W.; Ding, H.; Liu, Y.; Zeng, Z.; Jiang, H. Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp. resistant to third generation cephalosporins isolated from pork in China. Sci. Rep. 2017, 7, 40710. [Google Scholar] [CrossRef] [Green Version]
  17. Zhao, Q.; Li, W.; Cai, R.; Lu, Y.; Zhang, Y.; Cai, P.; Webber, M.A.; Jiang, H. Mobilization of Tn1721-like structure harboring blaCTX-M-27 between P1-like bacteriophage in Salmonella and plasmids in Escherichia coli in China. Vet. Microbiol. 2021, 253, 108944. [Google Scholar] [CrossRef]
  18. Jiang, H.X.; Song, L.; Liu, J.; Zhang, X.H.; Ren, Y.N.; Zhang, W.H.; Zhang, J.Y.; Liu, Y.H.; Webber, M.A.; Ogbolu, D.O.; et al. Multiple transmissible genes encoding fluoroquinolone and third-generation cephalosporin resistance co-located in non-typhoidal Salmonella isolated from food-producing animals in China. Int. J. Antimicrob. Agents 2014, 43, 242–247. [Google Scholar] [CrossRef]
  19. Cormier, A.; Zhang, P.L.C.; Chalmers, G.; Weese, J.S.; Deckert, A.; Mulvey, M.; McAllister, T.; Boerlin, P. Diversity of CTX-M-positive Escherichia coli recovered from animals in Canada. Vet. Microbiol. 2019, 231, 71–75. [Google Scholar] [CrossRef] [PubMed]
  20. Shin, J.; Kim, D.H.; Ko, K.S. Comparison of CTX-M-14- and CTX-M-15-producing Escherichia coli and Klebsiella pneumoniae isolates from patients with bacteremia. J. Infect. 2011, 63, 39–47. [Google Scholar] [CrossRef] [PubMed]
  21. Dhanji, H.; Murphy, N.M.; Akhigbe, C.; Doumith, M.; Hope, R.; Livermore, D.M.; Woodford, N. Isolation of fluoroquinolone-resistant O25b:H4-ST131 Escherichia coli with CTX-M-14 extended-spectrum beta-lactamase from UK river water. J. Antimicrob. Chemother. 2011, 66, 512–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Peirano, G.; Lynch, T.; Matsumara, Y.; Nobrega, D.; Finn, T.J.; DeVinney, R.; Pitout, J.D.D. Trends in Population Dynamics of Escherichia coli Sequence Type 131, Calgary, Alberta, Canada, 2006–20161. Emerg. Infect. Dis. 2020, 26, 2907–2915. [Google Scholar] [CrossRef] [PubMed]
  23. Zogg, A.L.; Simmen, S.; Zurfluh, K.; Stephan, R.; Schmitt, S.N.; Nuesch-Inderbinen, M. High Prevalence of Extended-Spectrum beta-Lactamase Producing Enterobacteriaceae Among Clinical Isolates From Cats and Dogs Admitted to a Veterinary Hospital in Switzerland. Front. Vet. Sci. 2018, 5, 62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Zhang, C.; Ding, X.; Lin, X.; Sun, R.; Lu, Y.; Cai, R.; Webber, M.A.; Ding, H.; Jiang, H. The Emergence of Chromosomally Located blaCTX-M-55 in Salmonella from Foodborne Animals in China. Front. Microbiol. 2019, 10. [Google Scholar] [CrossRef] [PubMed]
  25. Faccone, D.; Moredo, F.A.; Giacoboni, G.I.; Albornoz, E.; Alarcón, L.; Nievas, V.F.; Corso, A. Multidrug-resistant Escherichia coli harbouring mcr-1 and blaCTX-M genes isolated from swine in Argentina. J. Glob. Antimicrob. Resist. 2019, 18, 160–162. [Google Scholar] [CrossRef]
  26. Komatsu, Y.; Kasahara, K.; Inoue, T.; Lee, S.; Muratani, T.; Yano, H.; Kirita, T.; Mikasa, K. Molecular epidemiology and clinical features of extended-spectrum beta-lactamase-or carbapenemase-producing Escherichia coli bacteremia in Japan. PLoS ONE 2018, 13, e202276. [Google Scholar] [CrossRef] [Green Version]
  27. Vivas, R.; Barbosa, A.A.T.; Dolabela, S.S.; Jain, S. Multidrug-Resistant Bacteria and Alternative Methods to Control Them: An Overview. Microb. Drug Resist. 2019, 25, 890–908. [Google Scholar] [CrossRef] [PubMed]
  28. Matsuo, N.; Nonogaki, R.; Hayashi, M.; Wachino, J.I.; Suzuki, M.; Arakawa, Y.; Kawamura, K. Characterization of blaCTX-M-27/F1:A2:B20 Plasmids Harbored by Escherichia coli Sequence Type 131 Sublineage C1/H30R Isolates Spreading among Elderly Japanese in Nonacute-Care Settings. Antimicrob. Agents Chemother. 2020, 64. [Google Scholar] [CrossRef]
  29. Ghosh, H.; Bunk, B.; Doijad, S.; Schmiedel, J.; Falgenhauer, L.; Spröer, C.; Imirzalioglu, C.; Overmann, J.; Chakraborty, T. Complete Genome Sequence of blaCTX-M-27-Encoding Escherichia coli Strain H105 of Sequence Type 131 Lineage C1/H30R. Genome Announc. 2017, 5. [Google Scholar] [CrossRef] [Green Version]
  30. Birgy, A.; Levy, C.; Nicolas-Chanoine, M.; Cointe, A.; Hobson, C.A.; Magnan, M.; Bechet, S.; Bidet, P.; Cohen, R.; Bonacorsi, S. Independent Host Factors and Bacterial Genetic Determinants of the Emergence and Dominance of Escherichia coli Sequence Type 131 CTX-M-27 in a Community Pediatric Cohort Study. Antimicrob. Agents Chemother. 2019, 63. [Google Scholar] [CrossRef] [Green Version]
  31. Founou, L.L.; Founou, R.C.; Allam, M.; Ismail, A.; Essack, S.Y. Draft genome sequence of an extended-spectrum beta-lactamase (CTX-M-15)-producing Escherichia coli ST10 isolated from a nasal sample of an abattoir worker in Cameroon. J. Glob. Antimicrob. Resist. 2018, 14, 68–69. [Google Scholar] [CrossRef]
  32. Zahra, R.; Javeed, S.; Malala, B.; Babenko, D.; Toleman, M.A. Analysis of Escherichia coli STs and resistance mechanisms in sewage from Islamabad, Pakistan indicates a difference in E. coli carriage types between South Asia and Europe. J. Antimicrob. Chemother. 2018, 73, 1781–1785. [Google Scholar] [CrossRef] [Green Version]
  33. Day, M.J.; Hopkins, K.L.; Wareham, D.W.; Toleman, M.A.; Elviss, N.; Randall, L.; Teale, C.; Cleary, P.; Wiuff, C.; Doumith, M.; et al. Extended-spectrum beta-lactamase-producing Escherichia coli in human-derived and foodchain-derived samples from England, Wales, and Scotland: An epidemiological surveillance and typing study. Lancet Infect. Dis. 2019, 19, 1325–1335. [Google Scholar] [CrossRef] [Green Version]
  34. Song, J.; Oh, S.; Kim, J.; Shin, J. Extended-spectrum β-lactamase-producing Escherichia coli isolated from raw vegetables in South Korea. Sci. Rep. 2020, 10. [Google Scholar] [CrossRef]
  35. Sghaier, S.; Abbassi, M.S.; Pascual, A.; Serrano, L.; Díaz-De-Alba, P.; Said, M.B.; Hassen, B.; Ibrahim, C.; Hassen, A.; López-Cerero, L. Extended-spectrum β-lactamase-producing Enterobacteriaceae from animal origin and wastewater in Tunisia: First detection of O25b-B23-CTX-M-27-ST131 Escherichia coli and CTX-M-15/OXA-204-producing Citrobacter freundii from wastewater. J. Glob. Antimicrob. Resist. 2019, 17, 189–194. [Google Scholar] [CrossRef] [PubMed]
  36. Silva, M.M.; Sellera, F.P.; Fernandes, M.R.; Moura, Q.; Garino, F.; Azevedo, S.S.; Lincopan, N. Genomic features of a highly virulent, ceftiofur-resistant, CTX-M-8-producing Escherichia coli ST224 causing fatal infection in a domestic cat. J. Glob. Antimicrob. Resist. 2018, 15, 252–253. [Google Scholar] [CrossRef] [PubMed]
  37. Silva, K.C.; Moreno, M.; Cabrera, C.; Spira, B.; Cerdeira, L.; Lincopan, N.; Moreno, A.M. First Characterization of CTX-M-15-Producing Escherichia coli Strains Belonging to Sequence Type (ST) 410, ST224, and ST1284 from Commercial Swine in South America. Antimicrob. Agents Chemother. 2016, 60, 2505–2508. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Manges, A.R.; Geum, H.M.; Guo, A.; Edens, T.J.; Fibke, C.D.; Pitout, J.D.D. Global Extraintestinal Pathogenic Escherichia coli (ExPEC) Lineages. Clin. Microbiol. Rev. 2019, 32. [Google Scholar] [CrossRef]
  39. Colmenarejo, C.; Hernández-García, M.; Muñoz-Rodríguez, J.R.; Huertas, N.; Navarro, F.J.; Mateo, A.B.; Pellejero, E.M.; Illescas, S.; Vidal, M.D.; Del Campo, R. Prevalence and risks factors associated with ESBL-producing faecal carriage in a single long-term-care facility in Spain: Emergence of CTX-M-24- and CTX-M-27-producing Escherichia coli ST131-H30R. J. Antimicrob. Chemother. 2020, 75, 2480–2484. [Google Scholar] [CrossRef]
  40. Lucas, P.; Jouy, E.; Le Devendec, L.; de Boisseson, C.; Perrin-Guyomard, A.; Jove, T.; Blanchard, Y.; Touzain, F.; Kempf, I. Characterization of plasmids harboring blaCTX-M genes in Escherichia coli from French pigs. Vet. Microbiol. 2018, 224, 100–106. [Google Scholar] [CrossRef]
  41. Wang, J.; Zeng, Z.L.; Huang, X.Y.; Ma, Z.B.; Guo, Z.W.; Lv, L.C.; Xia, Y.B.; Zeng, L.; Song, Q.H.; Liu, J.H. Evolution and Comparative Genomics of F33:A-:B- Plasmids Carrying blaCTX-M-55 or blaCTX-M-65 in Escherichia coli and Klebsiella pneumoniae Isolated from Animals, Food Products, and Humans in China. Msphere 2018, 3. [Google Scholar] [CrossRef] [Green Version]
  42. Hayashi, M.; Matsui, M.; Sekizuka, T.; Shima, A.; Segawa, T.; Kuroda, M.; Kawamura, K.; Suzuki, S. Dissemination of IncF group F1:A2:B20 plasmid-harbouring multidrug-resistant Escherichia coli ST131 before the acquisition of blaCTX-M in Japan. J. Glob. Antimicrob. Resist. 2020, 23, 456–465. [Google Scholar] [CrossRef]
  43. Zong, Z.; Ginn, A.N.; Dobiasova, H.; Iredell, J.R.; Partridge, S.R. Different IncI1 plasmids from Escherichia coli carry ISEcp1-blaCTX-M-15 associated with different Tn2-derived elements. Plasmid 2015, 80, 118–126. [Google Scholar] [CrossRef]
  44. Canton, R.; Coque, T.M. The CTX-M beta-lactamase pandemic. Curr. Opin. Microbiol. 2006, 9, 466–475. [Google Scholar] [CrossRef]
  45. Jiang, H.X.; Tang, D.; Liu, Y.H.; Zhang, X.H.; Zeng, Z.L.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of beta-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef]
  46. Hibbert-Rogers, L.C.; Heritage, J.; Gascoyne-Binzi, D.M.; Hawkey, P.M.; Todd, N.; Lewis, I.J.; Bailey, C. Molecular epidemiology of ceftazidime resistant Enterobacteriaceae from patients on a paediatric oncology ward. J. Antimicrob. Chemother. 1995, 36, 65–82. [Google Scholar] [CrossRef]
  47. Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Meth. 2005, 63, 219–228. [Google Scholar] [CrossRef]
  48. Luo, R.; Liu, B.; Xie, Y.; Li, Z.; Huang, W.; Yuan, J.; He, G.; Chen, Y.; Pan, Q.; Liu, Y.; et al. SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. Gigascience 2012, 1, 18. [Google Scholar] [CrossRef] [PubMed]
  49. Darling, A.C.; Mau, B.; Blattner, F.R.; Perna, N.T. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004, 14, 1394–1403. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Beck, T.F.; Mullikin, J.C.; Biesecker, L.G. Systematic Evaluation of Sanger Validation of Next-Generation Sequencing Variants. Clin. Chem. 2016, 62, 647–654. [Google Scholar] [CrossRef] [PubMed]
  51. Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST Server: Rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Siguier, P. ISfinder: The reference centre for bacterial insertion sequences. Nucleic Acids Res. 2006, 34, D32–D36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Antibiotics 10 00387 g001 550
Figure 1. Characteristics of 32 CTX-M-27-carrying E. coli isolated from 2013 to 2016 in Guangdong, China. The blaCTX-M-27 genes were all located on plasmids. Isolate names that are underlined indicate that blaCTX-M-27 plasmids could be transferred to strain C600 by conjugation. *: Only the ΔISECP1-blaCTX-M-27-IS903B region was sequenced. Pulsed field gel electrophoresis (PFGE) patterns with a cutoff at 85% similarity (the dashed line) are considered to be the same PFGE cluster and are indicated as groups I–XIV respectively.
Figure 1. Characteristics of 32 CTX-M-27-carrying E. coli isolated from 2013 to 2016 in Guangdong, China. The blaCTX-M-27 genes were all located on plasmids. Isolate names that are underlined indicate that blaCTX-M-27 plasmids could be transferred to strain C600 by conjugation. *: Only the ΔISECP1-blaCTX-M-27-IS903B region was sequenced. Pulsed field gel electrophoresis (PFGE) patterns with a cutoff at 85% similarity (the dashed line) are considered to be the same PFGE cluster and are indicated as groups I–XIV respectively.
Antibiotics 10 00387 g001
Antibiotics 10 00387 g002 550
Figure 2. Linear comparisons of backbones for the two plasmids identified in this study. Regions of >99% identity are shaded in blue. The fluorescent pink arrows indicate tra area and the purple arrow indicate the trb area.
Figure 2. Linear comparisons of backbones for the two plasmids identified in this study. Regions of >99% identity are shaded in blue. The fluorescent pink arrows indicate tra area and the purple arrow indicate the trb area.
Antibiotics 10 00387 g002
Antibiotics 10 00387 g003 550
Figure 3. Genomic context of blaCTX-M-27 in pM8-1 and p1-8 and gene structure comparisons of with other plasmids as indicated Regions of >99% identity are shaded in blue. R1, orf1-sul2-aph(3′’)-Ib-aph(6)-Ib-orf2-tet(A)-orf3; R2, mphR(A)-mrx-mph(A); R3, chrA region; R4, aadA5-qacEΔ1-sul1. The five-pointed star indicates the insertion element. a: genomic context of blaCTX-M-27 in pM8-1 (F24:A-:B1, this study). b: genomic context of blaCTX-M-27 in p1-8 (F18:A-:B10, this study). c: genomic context of blaCTX-M-27 in p4_4.1 (F1:A2:B20, accession no: CP023827.1). d: genomic context of blaCTX-M-27 in pSCU-103 (F36:A4:B58, accession no: CP054458.1). e: genomic context of blaCTX-M-27 in p53_A (F31:A4:B37, accession no: CP048360.1).
Figure 3. Genomic context of blaCTX-M-27 in pM8-1 and p1-8 and gene structure comparisons of with other plasmids as indicated Regions of >99% identity are shaded in blue. R1, orf1-sul2-aph(3′’)-Ib-aph(6)-Ib-orf2-tet(A)-orf3; R2, mphR(A)-mrx-mph(A); R3, chrA region; R4, aadA5-qacEΔ1-sul1. The five-pointed star indicates the insertion element. a: genomic context of blaCTX-M-27 in pM8-1 (F24:A-:B1, this study). b: genomic context of blaCTX-M-27 in p1-8 (F18:A-:B10, this study). c: genomic context of blaCTX-M-27 in p4_4.1 (F1:A2:B20, accession no: CP023827.1). d: genomic context of blaCTX-M-27 in pSCU-103 (F36:A4:B58, accession no: CP054458.1). e: genomic context of blaCTX-M-27 in p53_A (F31:A4:B37, accession no: CP048360.1).
Antibiotics 10 00387 g003
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, Y.; Sun, Y.-H.; Wang, J.-Y.; Chang, M.-X.; Zhao, Q.-Y.; Jiang, H.-X. A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China. Antibiotics 2021, 10, 387. https://doi.org/10.3390/antibiotics10040387

AMA Style

Zhang Y, Sun Y-H, Wang J-Y, Chang M-X, Zhao Q-Y, Jiang H-X. A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China. Antibiotics. 2021; 10(4):387. https://doi.org/10.3390/antibiotics10040387

Chicago/Turabian Style

Zhang, Yan, Yin-Huan Sun, Jiang-Yang Wang, Man-Xia Chang, Qiu-Yun Zhao, and Hong-Xia Jiang. 2021. "A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China" Antibiotics 10, no. 4: 387. https://doi.org/10.3390/antibiotics10040387

APA Style

Zhang, Y., Sun, Y. -H., Wang, J. -Y., Chang, M. -X., Zhao, Q. -Y., & Jiang, H. -X. (2021). A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China. Antibiotics, 10(4), 387. https://doi.org/10.3390/antibiotics10040387

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop