Development of a Novel ssDNA Sequence for a Glycated Human Serum Albumin and Construction of a Simple Aptasensor System Based on Reduced Graphene Oxide (rGO)
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Construction of the ssDNA Library and Primers
2.3. Aptamer Screening with Reduced Graphene Oxide
2.4. Sequence Analysis
2.5. Characterization of the Aptamer with rGO
2.6. Target Detection in Human Serum Solution
3. Results
3.1. Development of Aptamers against GHSA via rGO-SELEX
3.2. Binding Affinity of the Selected Aptamer
3.3. Specificity Test
3.4. LOD Determination of GABAS-01
3.5. GHSA Detection from Human Serum Solution
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- World Health Organization. Global Report on Diabetes; No. 9789241565257; World Health Organization: Geneva, Switzerland, 2016. [Google Scholar]
- Atkinson, M.A.; Eisenbarth, G.S.; Michels, A.W. Type 1 diabetes. Lancet 2014, 383, 69–82. [Google Scholar] [CrossRef]
- Abdullah, A.; Peeters, A.; De Courten, M.; Stoelwinder, J. The magnitude of association between overweight and obesity and the risk of diabetes: A meta-analysis of prospective cohort studies. Diabetes Res. Clin. Pract. 2010, 89, 309–319. [Google Scholar] [CrossRef]
- Kohei, K.A.K.U. Pathophysiology of type 2 diabetes and its treatment policy. Jpn. Med. Assoc. J. 2010, 53, 41–46. [Google Scholar]
- Brännmark, C.; Nyman, E.; Fagerholm, S.; Bergenholm, L.; Ekstrand, E.M.; Cedersund, G.; Strålfors, P. Insulin signaling in type 2 diabetes experimental and modeling analyses reveal mechanisms of insulin resistance in human adipocytes. J. Biol. Chem. 2013, 288, 9867–9880. [Google Scholar] [CrossRef]
- The Walter and Eliza Hall Institute of Medical Research. Insulin Receptor and Type 2 Diabetes. Available online: https://www.wehi.edu.au/wehi-tv/insulin-receptor-and-type-2-diabetes (accessed on 2 February 2015).
- World Health Organization. The Top 10 Causes of Death. Available online: https://www.who.int/en/news-room/fact-sheets/detail/the-top-10-causes-of-death (accessed on 24 May 2018).
- International Diabetes Federation. Global diabetes Data Report 2010–2045. Available online: https://diabetesatlas.org/data/en/world/ (accessed on 25 November 2019).
- Papatheodorou, K.; Banach, M.; Edmonds, M.; Papanas, N.; Papazoglou, D. Complications of diabetes. J. Diabetes Res. 2015, 2015. [Google Scholar] [CrossRef]
- Papatheodorou, K.; Banach, M.; Bekiari, E.; Rizzo, M.; Edmonds, M. Complications of diabetes 2017. J. Diabetes Res. 2018, 2018. [Google Scholar] [CrossRef] [PubMed]
- Constantino, M.I.; Molyneaux, L.; Limacher-Gisler, F.; Al-Saeed, A.; Luo, C.; Wu, T.; Twigg, S.M.; Yue, D.K.; Wong, J. Long-term complications and mortality in young-onset diabetes: Type 2 diabetes is more hazardous and lethal than type 1 diabetes. Diabetes Care 2013, 36, 3863–3869. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. Definition and Diagnosis of Diabetes Mellitus and Intermediate Hyperglycaemia: Report of a WHO/IDF Consultation. World Health Org. 2006. Available online: https://apps.who.int/iris/bitstream/handle/10665/43588/9241594934_eng.pdf (accessed on 15 May 2020).
- American Diabetes Association. Diagnosis and classification of diabetes mellitus. Diabetes Care 2006, 30, S42–S47. [Google Scholar]
- Sherwani, S.I.; Khan, H.A.; Ekhzaimy, A.; Masood, A.; Sakharkar, M.K. Significance of HbA1c test in diagnosis and prognosis of diabetic patients. Biomark. Insights 2016, 11, 95–104. [Google Scholar] [CrossRef]
- Punthakee, Z.; Goldenberg, R.; Katz, P. Definition, classification and diagnosis of diabetes, prediabetes and metabolic syndrome. Can. J. Diabetes 2018, 42, S10–S15. [Google Scholar] [CrossRef] [PubMed]
- Freitas, P.A.C.; Ehlert, L.R.; Camargo, J.L. Glycated albumin: A potential biomarker in diabetes. Arch. Endocrinol. Metab. 2017, 61, 296–304. [Google Scholar] [CrossRef] [PubMed]
- Inaba, M.; Okuno, S.; Kumeda, Y.; Yamada, S.; Imanishi, Y.; Tabata, T.; Okamura, M.; Okada, S.; Yamakawa, T.; Nishizawa, Y.; et al. Glycated albumin is a better glycemic indicator than glycated hemoglobin values in hemodialysis patients with diabetes: Effect of anemia and erythropoietin injection. J. Am. Soc. Nephrol. 2007, 18, 896–903. [Google Scholar] [CrossRef] [PubMed]
- Kim, W.J.; Park, C.Y. Review of the potential glycemic markers glycated albumin and 1, 5-anhydroglucitol. J. Korean Diabetes 2012, 13, 1–6. [Google Scholar] [CrossRef]
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef]
- Huizenga, D.E.; Szostak, J.W. A DNA aptamer that binds adenosine and ATP. Biochemistry 1995, 34, 656–665. [Google Scholar] [CrossRef]
- Spiga, F.M.; Maietta, P.; Guiducci, C. More DNA–aptamers for small drugs: A capture–SELEX coupled with surface plasmon resonance and high-throughput sequencing. ACS Comb. Sci. 2015, 17, 326–333. [Google Scholar] [CrossRef]
- Bock, L.C.; Griffin, L.C.; Latham, J.A.; Vermaas, E.H.; Toole, J.J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 1992, 355, 564–566. [Google Scholar] [CrossRef]
- Mendonsa, S.D.; Bowser, M.T. In Vitro selection of high-affinity DNA ligands for human IgE using capillary electrophoresis. Anal. Chem. 2004, 76, 5387–5392. [Google Scholar] [CrossRef]
- Hicke, B.J.; Marion, C.; Chang, Y.F.; Gould, T.; Lynott, C.K.; Parma, D.; Schmidt, P.G.; Warren, S. Tenascin-C aptamers are generated using tumor cells and purified protein. J. Biol. Chem. 2001, 276, 48644–48654. [Google Scholar] [CrossRef]
- Kumar, P.K.R.; Machida, K.; Urvil, P.T.; Kakiuchi, N.; Vishnuvardhan, D.; Shimotohno, K.; Taira, K.; Nishikawa, S. Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA. Virology 1997, 237, 270–282. [Google Scholar] [CrossRef]
- Hamula, C.L.; Zhang, H.; Guan, L.L.; Li, X.F.; Le, X.C. Selection of aptamers against live bacterial cells. Anal. Chem. 2008, 80, 7812–7819. [Google Scholar] [CrossRef]
- Saito, S.; Hirose, K.; Tsuchida, M.; Wakui, K.; Yoshimoto, K.; Nishiyama, Y.; Shibukawa, M. Rapid acquisition of high-affinity DNA aptamer motifs recognizing microbial cell surfaces using polymer-enhanced capillary transient isotachophoresis. ChemComm 2016, 52, 461–464. [Google Scholar] [CrossRef] [PubMed]
- Jayasena, S.D. Aptamers: An emerging class of molecules that rival antibodies in diagnostics. Clin. Chem. 1999, 45, 1628–1650. [Google Scholar] [CrossRef] [PubMed]
- Chen, A.; Yang, S. Replacing antibodies with aptamers in lateral flow immunoassay. Biosens. Bioelectron. 2015, 71, 230–242. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Huang, P.J.J.; Ding, J.; Liu, J. Aptamer-based biosensors for biomedical diagnostics. Analyst 2014, 139, 2627–2640. [Google Scholar] [CrossRef]
- Zhang, Y.; Lai, B.S.; Juhas, M. Recent advances in aptamer discovery and applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [PubMed]
- McConnell, E.M.; Nguyen, J.; Li, Y. Aptamer-Based Biosensors for Environmental Monitoring. Front. Chem. 2020, 8, 434. [Google Scholar] [CrossRef]
- Drolet, D.W.; Jenison, R.D.; Smith, D.E.; Pratt, D.; Hicke, B.J. A high throughput platform for systematic evolution of ligands by exponential enrichment (SELEX). Comb. Chem. High. Throughput Screen. 1999, 2, 271–278. [Google Scholar]
- Stoltenburg, R.; Reinemann, C.; Strehlitz, B. FluMag-SELEX as an advantageous method for DNA aptamer selection. Anal. Bioanal. Chem. 2005, 383, 83–91. [Google Scholar] [CrossRef]
- Park, J.W.; Tatavarty, R.; Kim, D.W.; Jung, H.T.; Gu, M.B. Immobilization-free screening of aptamers assisted by graphene oxide. ChemComm 2012, 48, 2071–2073. [Google Scholar] [CrossRef]
- Wu, M.; Kempaiah, R.; Huang, P.J.J.; Maheshwari, V.; Liu, J. Adsorption and desorption of DNA on graphene oxide studied by fluorescently labeled oligonucleotides. Langmuir 2011, 27, 2731–2738. [Google Scholar] [CrossRef]
- Apiwat, C.; Luksirikul, P.; Kankla, P.; Pongprayoon, P.; Treerattrakoon, K.; Paiboonsukwong, K.; Fucharoen, S.; Dharakul, T.; Japrung, D. Graphene based aptasensor for glycated albumin in diabetes mellitus diagnosis and monitoring. Bosens. Bioelectron. 2016, 82, 140–145. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.H.; Li, J.; Lin, M.H.; Wang, Y.W.; Yang, H.H.; Chen, X.; Chen, G.N. Amplified aptamer-based assay through catalytic recycling of the analyte. Angew. Chem. Int. Ed. 2010, 122, 8632–8635. [Google Scholar] [CrossRef]
- He, S.; Song, B.; Li, D.; Zhu, C.; Qi, W.; Wen, Y.; Wang, L.; Song, S.; Fang, H.; Fan, C. A graphene nanoprobe for rapid, sensitive, and multicolor fluorescent DNA analysis. Adv. Funct. Mater. 2010, 20, 453–459. [Google Scholar] [CrossRef]
- Castro Neto, A.H.; Guinea, F.; Peres, N.M.R.; Novoselov, K.S.; Geim, A.K. The electronic properties of graphene. Rev. Mod. Phys. 2009, 81, 109–162. [Google Scholar] [CrossRef]
- Datta, D.; Sarkar, K.; Mukherjee, S.; Meshik, X.; Stroscio, M.A.; Dutta, M. Graphene oxide and DNA aptamer based sub-nanomolar potassium detecting optical nanosensor. Nanotechnology 2017, 28, 325502. [Google Scholar] [CrossRef]
- Darbandi, A.; Datta, D.; Patel, K.; Lin, G.; Stroscio, M.A.; Dutta, M. Molecular beacon anchored onto a graphene oxide substrate. Nanotechnology 2017, 28, 375501. [Google Scholar] [CrossRef]
- Swathi, R.S.; Sebastian, K.L. Resonance energy transfer from a dye molecule to graphene. J. Chem. Phys. 2008, 129, 054703. [Google Scholar] [CrossRef]
- Kim, A.R.; Ha, N.R.; Jung, I.P.; Kim, S.H.; Yoon, M.Y. Development of a ssDNA aptamer system with reduced graphene oxide (rGO) to detect nonylphenol ethoxylate in domestic detergent. J. Mol. Recognit. 2019, 32, e2746. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Liu, B.; Ding, J.; Liu, J. Fluorescent sensors using DNA-functionalized graphene oxide. Anal. Bioanal. Chem. 2014, 406, 6885–6902. [Google Scholar] [CrossRef] [PubMed]
- Chang, H.; Tang, L.; Wang, Y.; Jiang, J.; Scott, H.; Li, J. Graphene fluorescence resonance energy transfer aptasensor for the thrombin detection. Anal. Chem. 2010, 82, 2341–2346. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhou, X.; Guo, S.; Wu, N. Detection of lead (II) with a “turn-on” fluorescent biosensor based on energy transfer from CdSe/ZnS quantum dots to graphene oxide. Biosens. Bioelectron. 2013, 43, 69–74. [Google Scholar] [CrossRef] [PubMed]
- Raston, N.A.H.; Gu, M.B. Highly amplified detection of visceral adipose tissue-derived serpin (vaspin) using a cognate aptamer duo. Biosens. Bioelectron. 2015, 70, 261–267. [Google Scholar] [CrossRef]
- Anguizola, J.; Matsuda, R.; Barnaby, O.S.; Hoy, K.S.; Wa, C.; De Bolt, E. Glycation of human serum albumin. Clin. Chim. Acta 2013, 425, 64–76. [Google Scholar] [CrossRef]
- Danese, E.; Montagnana, M.; Nouvenne, A.; Lippi, G. Advantages and pitfalls of fructosamine and glycated albumin in the diagnosis and treatment of diabetes. J. Diabetes Sci. Technol. 2015, 9, 169–176. [Google Scholar] [CrossRef]
- Ueda, Y.; Matsumoto, H. Recent topics in chemical and clinical research on glycated albumin. J. Diabetes Sci. Technol. 2015, 9, 177–182. [Google Scholar] [CrossRef]
- Lapolla, A.; Fedele, D.; Reitano, R.; Aricò, N.C.; Seraglia, R.; Traldi, P.; Marotta, E. Enzymatic digestion and mass spectrometry in the study of advanced glycation end products/peptides. J. Am. Soc. Mass Spectrom. 2004, 15, 496–509. [Google Scholar] [CrossRef]
- Wa, C.; Cerny, R.L.; Clarke, W.A.; Hage, D.S. Characterization of glycation adducts on human serum albumin by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Clin. Chim. Acta 2007, 385, 48–60. [Google Scholar] [CrossRef]
- Arasteh, A.; Farahi, S.; Habibi-Rezaei, M.; Moosavi-Movahedi, A.A. Glycated albumin: An overview of the In Vitro models of an In Vivo potential disease marker. J. Diabetes Metab. Disord. 2014, 13, 49. [Google Scholar] [CrossRef] [PubMed]
- Gelamo, E.; Tabak, M. Spectroscopic studies on the interaction of bovine (BSA) and human (HSA) serum albumins with ionic surfactants. Spectrochim. Acta Mol. Biomol. Spectrosc. 2000, 56, 2255–2271. [Google Scholar] [CrossRef]
- Kohzuma, T.; Yamamoto, T.; Uematsu, Y.; Shihabi, Z.K.; Freedman, B. Basic performance of an enzymatic method for glycated albumin and reference range determination. J. Diabetes Sci. Technol. 2011, 5, 1455–1462. [Google Scholar] [CrossRef] [PubMed]
- Testa, R.; Guerra, E.; Bonfigli, A.R.; Di Gaetano, N.; Santini, G.; Ceriotti, F. Analytical performances of an enzymatic assay for the measurement of glycated albumin. J. Appl. Lab. Med. AACC Publ. 2016, 1, 162–171. [Google Scholar] [CrossRef]
Publisher′s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
Round | ssDNA (pmole) | Binding Condition | Binding Time (min) | Elution Condition | Target Amount (μg) | Elution Time (min) |
---|---|---|---|---|---|---|
1 | 200 | 1 Binding buffer with 100 μg of rGO and 500 μg of albumin | 60 | 1 PBS | 500 | 60 |
2 | 45 | |||||
3 | 1.5 PBS | |||||
4 | 30 | |||||
5 | 2 PBS |
Name | Sequence | Frequency |
---|---|---|
GABAS-01 | ATGCGGATCCCGCGCGCAGTGCAGGGAGCCGCTCCACGTACGTTGCGCGAAGCTTGCGC | 14 |
GABAS-02 | ATGCGGATCCCGCGCGCGGTGGCGAGGGGCCGACGGCGGCTGGGTGCGCGAAGCTTGCGC | 9 |
GABAS-03 | ATGCGGATCCCGCGCGGGTCTGAGGAGTGCGGCGGTGCCAGTGAGTGCGCGAAGCTTGCGC | 5 |
GABAS-04 | ATGCGGATCCCGCGCCGTGTTAGGCTAGATGTAGAGTTGGTCTGGTGCGCGAAGCTTGCGC | 4 |
GABAS-05 | ATGCGGATCCCGCGCGACCAACGGAAGCGCGGCACCACAACGGTGGCGCGAAGCTTGCGC | 4 |
GABAS-06 | ATGCGGATCCCGCGCCGAGTCAGTGCGAGGCGCTCCCCTGTCGGTGCGCGAAGCTTGCGC | 3 |
GABAS-07 | ATGCGGATCCCGCGCGACTGGACAGGTAATACGGCAGCGGCCGAGGCGCGAAGCTTGCGC | 2 |
GABAS-08 | ATGCGGATCCCGCGCGCAATAGGTAAGAATCAGGAGACTGCGTGGGCGCGAAGCTTGCGC | 2 |
GABAS-09 | ATGCGGATCCCGCGCTTCTCAAACGCCGGAATGGTTGTTAGTGTGGCGCGAAGCTTGCGC | 2 |
GABAS-10 | ATGCGGATCCCGCGCACCTGAAAGCCGCAATGCCAGTGGTCCGTGGCGCGAAGCTTGCGC | 1 |
GABAS-11 | ATGCGGATCCCGCGCCGACTACCTTATTTATCCGGGGGAATCCTTGCGCGAAGCTTGCGC | 1 |
GABAS-12 | ATGCGGATCCCGCGCGAACATGGAGATGATCACCTTGTGGACTATGCGCGAAGCTTGCGC | 1 |
GABAS-13 | ATGCGGATCCCGCGCGAGGTAGGTCCAGGATGAATACGTGGTCTGGCGCGAAGCTTGCGC | 1 |
GABAS-14 | ATGCGGATCCCGCGCGCACGATAATTTCCCTTCTCCTGCTGGTCAGCGCGAAGCTTGCGC | 1 |
Detection Method | Spiked (µg/mL) | Measured (µg/mL) | Recovery (%) | RSD (%) |
---|---|---|---|---|
1 PBS | 15.625 | 15.811 | 101.20 | 2.52 |
31.25 | 31.535 | 100.91 | 1.91 | |
62.5 | 62.689 | 100.30 | 1.64 | |
125 | 125.15 | 100.12 | 1.14 | |
Human serum solution diluted by 1 PBS | 15.625 | 16.879 | 108.03 | 1.03 |
31.25 | 33.502 | 107.21 | 2.70 | |
62.5 | 62.937 | 100.70 | 1.33 | |
125 | 127.34 | 101.87 | 1.90 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, A.-R.; Choi, Y.; Kim, S.-H.; Moon, H.-S.; Ko, J.-H.; Yoon, M.-Y. Development of a Novel ssDNA Sequence for a Glycated Human Serum Albumin and Construction of a Simple Aptasensor System Based on Reduced Graphene Oxide (rGO). Biosensors 2020, 10, 141. https://doi.org/10.3390/bios10100141
Kim A-R, Choi Y, Kim S-H, Moon H-S, Ko J-H, Yoon M-Y. Development of a Novel ssDNA Sequence for a Glycated Human Serum Albumin and Construction of a Simple Aptasensor System Based on Reduced Graphene Oxide (rGO). Biosensors. 2020; 10(10):141. https://doi.org/10.3390/bios10100141
Chicago/Turabian StyleKim, A-Ru, Yeongmi Choi, Sang-Heon Kim, Hyun-Seok Moon, Jae-Ho Ko, and Moon-Young Yoon. 2020. "Development of a Novel ssDNA Sequence for a Glycated Human Serum Albumin and Construction of a Simple Aptasensor System Based on Reduced Graphene Oxide (rGO)" Biosensors 10, no. 10: 141. https://doi.org/10.3390/bios10100141
APA StyleKim, A.-R., Choi, Y., Kim, S.-H., Moon, H.-S., Ko, J.-H., & Yoon, M.-Y. (2020). Development of a Novel ssDNA Sequence for a Glycated Human Serum Albumin and Construction of a Simple Aptasensor System Based on Reduced Graphene Oxide (rGO). Biosensors, 10(10), 141. https://doi.org/10.3390/bios10100141