Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review
Abstract
:1. Introduction
2. Methodology
2.1. Research Strategy and Data Extraction
2.2. Focus Questions
2.3. Information Sources
3. First Visual Approaches to the Dataset
3.1. Salmonella spp. in Food
3.2. Nanomaterial–Based Biosensor Used for Salmonella spp. Detection
3.3. DNA-Based Nanosensor for Salmonella spp. Detection
3.4. Aptamer-Based Nanosensor for Salmonella spp. Detection
3.5. Nanosensors with Different Transducers for Detection of Salmonella
3.5.1. Electrochemical Transducers
3.5.2. Transducer Colorimetric
3.5.3. Transducer SERS
3.5.4. Transducer Fluorescence
3.6. Magnetic Separation System with Sample Preparation
4. Conclusions and Outlooks
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- dos Santos, A.M.P.; Panzenhagen, P.; Ferrari, R.G.; Rodrigues, G.L.; Conte-Junior, C.A. The pESI megaplasmid conferring virulence and multiple-drug resistance is detected in a Salmonella Infantis genome from Brazil. Infect. Genet. Evol. 2021, 95, 104934. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Xu, X.; Xia, Y.; Wang, Z. SERS aptasensor for Salmonella typhimurium detection based on spiny gold nanoparticles. Food Control 2018, 84, 232–237. [Google Scholar] [CrossRef]
- Ye, Y.; Yan, W.; Liu, Y.; He, S.; Cao, X.; Xu, X.; Zheng, H.; Gunasekaran, S. Electrochemical detection of Salmonella using an invA genosensor on polypyrrole-reduced graphene oxide modified glassy carbon electrode and AuNPs-horseradish peroxidase-streptavidin as nanotag. Anal. Chim. Acta 2019, 1074, 80–88. [Google Scholar] [CrossRef]
- Saini, K.; Kaushal, A.; Gupta, S.; Kumar, D. Rapid detection of Salmonella enterica in raw milk samples using Stn gene-based biosensor. 3 Biotech 2019, 9, 425. [Google Scholar] [CrossRef] [PubMed]
- Thavanathan, J.; Huang, N.M.; Thong, K.L. Colorimetric biosensing of targeted gene sequence using dual nanoparticle platforms. Int. J. Nanomed. 2015, 10, 2711–2722. [Google Scholar]
- dos Santos, A.M.P.; Ferrari, R.G.; Conte-Junior, C.A. Virulence Factors in Salmonella Typhimurium: The Sagacity of a Bacterium. Curr. Microbiol. 2019, 76, 762–773. [Google Scholar] [CrossRef] [PubMed]
- asim, I.; Shen, Z.; Mlaji, Z.; Yuksek, N.S.; Abdullah, A.; Liu, J. Biosensors and Bioelectronics An impedance biosensor for simultaneous detection of low concentration of Salmonella serogroups in poultry and fresh produce samples. Biosens. Bioelectron. 2019, 126, 292–300. [Google Scholar]
- De Abrew, P.; Dhowlaghar, N.; Nannapaneni, R.; Schilling, M.W.; Mahmoud, B.; Sharma, C.S.; Ma, D. International Journal of Food Microbiology Salmonella enterica growth and bio fi lm formation in flesh and peel cantaloupe extracts on four food-contact surfaces. Int. J. Food Microbiol. 2018, 280, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Xu, L.; Li, Y. Biosensors for rapid detection of Salmonella in food: A review. Compr. Rev. Food Sci. Food Saf. 2021, 20, 149–197. [Google Scholar] [CrossRef] [PubMed]
- Du, M.; Li, J.; Liu, Q.; Wang, Y.; Chen, E.; Kang, F.; Tu, C. Rapid detection of trace Salmonella in milk using an effective pretreatment combined with droplet digital polymerase chain reaction. Microbiol. Res. 2021, 251, 126838. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention. Salmonella and Food. 2019. Available online: https://www.cdc.gov/foodsafety/communication/salmonella-food.html (accessed on 3 February 2022).
- Park, J.Y.; Jeong, H.Y.; Kim, M.I.; Park, T.J. Colorimetric Detection System for Salmonella typhimurium Based on Peroxidase-Like Activity of Magnetic Nanoparticles with DNA Aptamers. J. Nanomater. 2015, 2015. [Google Scholar] [CrossRef] [Green Version]
- Ferrari, R.G.; Panzenhagen, P.H.N.; Conte-Junior, C.A. Phenotypic and genotypic eligible methods for Salmonella Typhimurium source tracking. Front. Microbiol. 2017, 8, 2587. [Google Scholar] [CrossRef] [Green Version]
- Ma, X.; Jiang, Y.; Jia, F.; Yu, Y.; Chen, J.; Wang, Z. An aptamer-based electrochemical biosensor for the detection of Salmonella. J. Microbiol. Methods 2014, 98, 94–98. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.; Hwang, B.H. Plasmonic Biosensor Controlled by DNAzyme for On-Site Genetic Detection of Pathogens. Biotechnol. J. 2020, 15, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Chiu, T.C.; Huang, C.C. Aptamer-functionalized nano-biosensors. Sensors 2009, 9, 10356–10388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, N.; Shen, M.; Qi, S.; Wang, W.; Wu, S.; Wang, Z. A SERS aptasensor for simultaneous multiple pathogens detection using gold decorated PDMS substrate. Spectrochim. Acta-Mol. Biomol. Spectrosc. 2020, 230, 118103. [Google Scholar] [CrossRef] [PubMed]
- Vetrone, S.A.; Huarng, M.C.; Alocilja, E.C. Detection of Non-PCR amplified S. enteritidis genomic DNA from food matrices using a gold-nanoparticle DNA biosensor: A proof-of-concept study. Sensors 2012, 12, 10487–10499. [Google Scholar] [CrossRef] [Green Version]
- Song, S.; Wang, L.; Li, J.; Fan, C.; Zhao, J. Aptamer-based biosensors. TrAC—Trends Anal. Chem. 2008, 27, 108–117. [Google Scholar] [CrossRef]
- Yang, G.; Huang, J.; Meng, W.; Shen, M.; Jiao, X. Analytica Chimica Acta A reusable capacitive immunosensor for detection of Salmonella spp. based on grafted ethylene diamine and self-assembled gold nanoparticle monolayers. Anal. Chim. Acta 2009, 647, 159–166. [Google Scholar] [CrossRef]
- Mercado-lubo, R.; Zhang, Y.; Zhao, L.; Rossi, K.; Wu, X.; Zou, Y.; Castillo, A.; Leonard, J.; Bortell, R.; Greiner, D.L.; et al. A Salmonella nanoparticle mimic overcomes multidrug resistance in tumours. Nat. Commun. 2016, 7, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Zou, D.; Jin, L.; Wu, B.; Hu, L.; Chen, X.; Huang, G. Rapid detection of Salmonella in milk by biofunctionalised magnetic nanoparticle cluster sensor based on nuclear magnetic resonance. Int. Dairy J. 2019, 91, 82–88. [Google Scholar] [CrossRef]
- Park, S.B.; Steadman, C.S.; Chaudhari, A.A.; Pillai, S.R.; Singh, S.R.; Ryan, P.L.; Willard, S.T.; Feugang, J.M. Proteomic analysis of antimicrobial effects of pegylated silver coated carbon nanotubes in Salmonella enterica serovar Typhimurium. J. Nanobiotechnol. 2018, 16, 1–14. [Google Scholar] [CrossRef]
- Punbusayakul, N.; Talapatra, S.; Ajayan, P.M.; Surareungchai, W. Label-free as-grown double wall carbon nanotubes bundles for Salmonella typhimurium immunoassay. Chem. Cent. J. 2013, 7, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Yang, M.; Peng, Z.; Ning, Y.; Chen, Y.; Zhou, Q.; Deng, L. Highly Specific and Cost-Efficient Detection of Salmonella Paratyphi A Combining Aptamers with Single-Walled Carbon Nanotubes. Sensors 2013, 13, 6865–6881. [Google Scholar] [CrossRef]
- Amaro, M.; Oaew, S.; Surareungchai, W. Biosensors and Bioelectronics Scano-magneto immunoassay based on carbon nanotubes/gold nanoparticles nanocomposite for Salmonella enterica serovar Typhimurium detection. Biosens. Bioelectron. 2012, 38, 157–162. [Google Scholar] [CrossRef]
- Moher, D.; Liberati, A.; Tetzlaff, J.; Altman, D.G.; Altman, D.; Antes, G.; Atkins, D.; Barbour, V.; Barrowman, N.; Berlin, J.A.; et al. Preferred reporting items for systematic reviews and meta-analyses: The PRISMA statement. PLoS Med. 2009. [Google Scholar] [CrossRef] [Green Version]
- Majdinasab, M.; Aminlari, M.; Sheikhi, M.H.; Niakousari, M.; Shekarforoosh, S. Detection of inv A gene of Salmonella by DNA-gold nanoparticles biosensor and its comparison with PCR. J. Exp. Nanosci. 2013, 8, 223–239. [Google Scholar] [CrossRef]
- Quintela, I.A.; De Los Reyes, B.G.; Lin, C.S.; Wu, V.C.H. Simultaneous colorimetric detection of a variety of Salmonella spp. In food and environmental samples by optical biosensing using oligonucleotide-gold nanoparticles. Front. Microbiol. 2019, 10, 1138. [Google Scholar] [CrossRef]
- Ying, N.; Ju, C.; Li, Z.; Liu, W.; Wan, J. Visual detection of nucleic acids based on lateral flow biosensor and hybridization chain reaction amplification. Talanta 2017, 164, 432–438. [Google Scholar] [CrossRef]
- Xu, S.; Duo, H.; Zheng, C.; Zhao, S.; Song, S.; Simon, G. Novel approach to fabrication of DNA biosensor based on a carboxylated graphene oxide decorated with Fe3O4 NPs for the detection of typhoidal Salmonella. Int. J. Electrochem. Sci. 2019, 14, 1248–1269. [Google Scholar] [CrossRef]
- Zhu, D.; Yan, Y.; Lei, P.; Shen, B.; Cheng, W.; Ju, H.; Ding, S. A novel electrochemical sensing strategy for rapid and ultrasensitive detection of Salmonella by rolling circle amplification and DNA-AuNPs probe. Anal. Chim. Acta 2014, 846, 44–50. [Google Scholar] [CrossRef]
- Zhang, P.; Song, M.; Dou, L.; Xiao, Y.; Li, K.; Shen, G.; Ying, B.; Geng, J.; Yang, D.; Wu, Z. Development of a fluorescent DNA nanomachine for ultrasensitive detection of Salmonella enteritidis without labeling and enzymes. Microchim. Acta 2020, 187, 1–8. [Google Scholar] [CrossRef]
- Melaine, F.; Saad, M.; Faucher, S.; Tabrizian, M. Selective and High Dynamic Range Assay Format for Multiplex Detection of Pathogenic Pseudomonas aeruginosa, Salmonella typhimurium, and Legionella pneumophila RNAs Using Surface Plasmon Resonance Imaging. Anal. Chem. 2017, 89, 7802–7807. [Google Scholar] [CrossRef]
- Kurt, H.; Yüce, M.; Hussain, B.; Budak, H. Dual-excitation upconverting nanoparticle and quantum dot aptasensor for multiplexed food pathogen detection. Biosens. Bioelectron. 2016, 81, 280–286. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ma, X.; Liu, Y.; Duan, N.; Wu, S.; Wang, Z.; Xu, B. Gold nanoparticles enhanced SERS aptasensor for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus. Biosens. Bioelectron. 2015, 74, 872–877. [Google Scholar] [CrossRef] [PubMed]
- Oh, S.Y.; Heo, N.S.; Shukla, S.; Cho, H.J.; Vilian, A.T.E.; Kim, J.; Lee, S.Y.; Han, Y.K.; Yoo, S.M.; Huh, Y.S. Development of gold nanoparticle-aptamer-based LSPR sensing chips for the rapid detection of Salmonella typhimurium in pork meat. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, S.; Ranganathan, V.; DeRosa, M.C.; Murari, B.M. Label-free aptasensors based on fluorescent screening assays for the detection of Salmonella typhimurium. Anal. Biochem. 2018, 559, 17–23. [Google Scholar] [CrossRef]
- Wang, Q.Y.; Kang, Y.J. Bioprobes Based on Aptamer and Silica Fluorescent Nanoparticles for Bacteria Salmonella typhimurium Detection. Nanoscale Res. Lett. 2016, 11, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Ren, J.; Liang, G.; Man, Y.; Li, A.; Jin, X.; Liu, Q.; Pan, L. Aptamer-based fluorometric determination of Salmonella Typhimurium using Fe3O4 magnetic separation and CdTe quantum dots. PLoS ONE 2019, 14, e0218325. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.H.; Li, M.; Wang, Y.; Ouyang, H.X.; Wang, L.; Li, X.C.; Cao, Y.C.; Meng, Q.H.; Lu, J.X. Aptasensors for rapid detection of Escherichia coli O157: H7 and Salmonella typhimurium. Nanoscale Res. Lett. 2012, 7, 1–7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duan, N.; Xu, B.; Wu, S.; Wang, Z. Magnetic nanoparticles-based aptasensor using gold nanoparticles as colorimetric probes for the detection of Salmonella typhimurium. Anal. Sci. 2016, 32, 431–436. [Google Scholar] [CrossRef] [Green Version]
- dos Santos, A.M.P.; Ferrari, R.G.; Panzenhagen, P.; Rodrigues, G.L.; Conte-Junior, C.A. Virulence genes identification and characterization revealed the presence of the Yersinia High Pathogenicity Island (HPI) in Salmonella from Brazil. Gene 2021, 787, 145646. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, G.L.; Panzenhagen, P.; Ferrari, R.G.; dos Santos, A.; Paschoalin, V.M.F.; Conte-Junior, C.A. Frequency of Antimicrobial Resistance Genes in Salmonella From Brazil by in silico Whole-Genome Sequencing Analysis: An Overview of the Last Four Decades. Front. Microbiol. 2020, 11, 1864. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention. Salmonella and food. 2021. Available online: https://www.cdc.gov/salmonella/ (accessed on 3 February 2022).
- dos Santos, A.M.P.; Ferrari, R.G.; Conte-Junior, C.A. Type three secretion system in Salmonella Typhimurium: The key to infection. Genes Genom. 2020, 42, 495–506. [Google Scholar] [CrossRef] [PubMed]
- Cabral, C.; Panzenhagen, P.; Delgado, K.; Rodrigues, G.; Mercês, A.; Rodrigues, D.; Franco, R.; Conte-junior, C. Genetic diversity and multidrug-resistance among Salmonella Typhimurium isolated from swine carcasses and slaughterhouses in Rio de Janeiro, Brazil. Vet. Ital. 2020, 56, 245–250. [Google Scholar] [CrossRef]
- Rodrigues, G.L.; Panzenhagen, P.; Ferrari, R.G.; Margaret, V.; Paschoalin, F.; Conte-junior, C.A. Antimicrobial Resistance in Nontyphoidal Salmonella Isolates from Human and Swine Sources in Brazil: A Systematic Review of the Past Three Decades. Microb. Drug Resist. 2020, 26, 1260–1270. [Google Scholar] [CrossRef] [PubMed]
- Food, E.; Authority, S. The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2017/2018. EFSA J. 2020, 18, e06007. [Google Scholar] [CrossRef] [Green Version]
- Ferrari, R.G.; Rosario, D.K.A.; Cunha-Neto, A.; Mano, S.B.; Figueiredo, E.E.S.; Conte-Juniora, C.A. Worldwide epidemiology of Salmonella serovars in animal-based foods: A meta-analysis. Appl. Environ. Microbiol. 2019, 85, e00591-19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- da Cunha-Neto, A.; Albuês Carvalho, L.; Cêsar Tavares Carvalho, R.; dos Prazeres Rodrigues, D.; Mano, S.B.; de Souza Figueiredo, E.E.; Conte-Junior, C.A. Salmonella isolated from chicken carcasses from a slaughterhouse in the state of Mato Grosso, Brazil: Antibiotic resistance profile, serotyping, and characterization by repetitive sequence-based PCR system. Poult. Sci. 2018, 97, 1373–1381. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.; Ye, Y.; Liu, S. Gold nanoparticle-based signal amplification for biosensing. Anal. Biochem. 2011, 417, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Loiseau, A.; Zhang, L.; Hu, D.; Salmain, M.; Mazouzi, Y.; Flack, R.; Liedberg, B.; Boujday, S. Core-Shell Gold/Silver Nanoparticles for Localized Surface Plasmon Resonance-Based Naked-Eye Toxin Biosensing. ACS Appl. Mater. Interfaces 2019, 11, 46462–46471. [Google Scholar] [CrossRef] [PubMed]
- Matea, C.T.; Mocan, T. Quantum dots in imaging, drug delivery and sensor applications. Int. J. Nanomed. 2017, 12, 5421–5431. [Google Scholar] [CrossRef] [Green Version]
- Wang, Q.; Yin, Q.; Fan, Y.; Zhang, L.; Xu, Y.; Hu, O.; Guo, X.; Shi, Q.; Fu, H.; She, Y. Double quantum dots-nanoporphyrin fluorescence-visualized paper-based sensors for detecting organophosphorus pesticides. Talanta 2019, 199, 46–53. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.; Yue, Z.; Bing, Z.; Yiwei, T.; Xiuying, L.; Jianrong, L. Highly-sensitive organophosphorus pesticide biosensors based on CdTe quantum dots and bi-enzyme immobilized eggshell membranes. Analyst 2016, 141, 1105–1111. [Google Scholar] [CrossRef] [PubMed]
- Kim Thanh, N.T.; Rosenzweig, Z. Development of an aggregation-based immunoassay for anti-protein A using gold nanoparticles. Anal. Chem. 2002, 74, 1624–1628. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Rycenga, M.; Skrabalak, S.E.; Wiley, B.; Xia, Y. Chemical synthesis of novel plasmonic nanoparticles. Annu. Rev. Phys. Chem. 2009, 60, 167–192. [Google Scholar] [CrossRef] [PubMed]
- B Ventura, B.D.; Iannaccone, M.; Funari, R.; Ciamarra, M.P.; Altucci, C.; Capparelli, R.; Roperto, S.; Velotta, R. Effective antibodies immobilization and functionalized nanoparticles in a quartzcrystal microbalance-based immunosensor for the detection of parathion. PLoS ONE 2017, 12, e0171754. [Google Scholar]
- Elghanian, R.; Storhoff, J.J.; Mucic, R.C.; Letsinger, R.L.; Mirkin, C.A. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science 1997, 277, 1078–1081. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, V.T.; Bin Seo, H.; Kim, B.C.; Kim, S.K.; Song, C.S.; Gu, M.B. Highly sensitive sandwich-type SPR based detection of whole H5Nx viruses using a pair of aptamers. Biosens. Bioelectron. 2016, 86, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Ronkainen, N.J.; Halsall, H.B.; Heineman, W.R. Electrochemical biosensors. Chem. Soc. Rev. 2010, 39, 1747–1763. [Google Scholar] [CrossRef]
- Nie, L.; Liu, F.; Ma, P.; Xiao, X. Applications of gold nanoparticles in optical biosensors. J. Biomed. Nanotechnol. 2014, 10, 2700–2721. [Google Scholar] [CrossRef] [PubMed]
- Tessaro, L.; Aquino, A.; de Carvalho, A.P.A.; Conte-Junior, C.A. A systematic review on gold nanoparticles based-optical biosensors for Influenza virus detection. Sens. Actuators Rep. 2021, 3, 100060. [Google Scholar] [CrossRef]
- Peng, L.; Li, B.L.; Zhou, C.W.; Li, N.B.; Setyawati, M.I.; Zou, H.L. “Naked-eye” recognition: Emerging gold nano-family for visual sensing. Appl. Mater. Today 2018, 11, 166–188. [Google Scholar] [CrossRef]
- Saviñon-Flores, F.; Méndez, E.; López-Castaños, M.; Carabarin-Lima, A.; López-Castaños, K.A.; González-Fuentes, M.A.; Méndez-Albores, A. A Review on SERS-Based Detection of Human Virus Infections: Influenza and Coronavirus. Biosensors 2021, 11, 66. [Google Scholar] [CrossRef] [PubMed]
- Jain, P.K.; Lee, K.S.; El-Sayed, I.H.; El-Sayed, M.A. Calculated absorption and scattering properties of gold nanoparticles of different size, shape, and composition: Applications in biological imaging and biomedicine. J. Phys. Chem. 2006, 110, 7238–7248. [Google Scholar] [CrossRef] [Green Version]
- Shah, N.; Osea, E.A.; Martinez, G.J. Accuracy of noninvasive hemoglobin and invasive point-of-care hemoglobin testing compared with a laboratory analyzer. Int. J. Lab. Hematol. 2014, 36, 56–61. [Google Scholar] [CrossRef] [Green Version]
- Kumar, N.; Bhatia, S.; Pateriya, A.K.; Sood, R.; Nagarajan, S.; Murugkar, H.V.; Kumar, S.; Singh, P.; Singh, V.P. Label-free peptide nucleic acid biosensor for visual detection of multiple strains of influenza A virus suitable for field applications. Anal. Chim. Acta 2020, 1093, 123–130. [Google Scholar] [CrossRef]
- Veigas, B.; Giestas, L.; Almeida, C.; Baptista, P.V.; De Lisboa, N.; De Caparica, C.; Esquillor, M.; De Lisboa, U.N.; De Caparica, C.; Nova, U.; et al. Noble Metal Nanoparticles for Biosensing Applications. Sensors 2012, 12, 1657–1687. [Google Scholar]
- Hong, H.; Krause, H.; Song, K.; Choi, C.; Chung, M.; Son, S.; Offenhäusser, A. Detection of two different in fl uenza A viruses using a nitrocellulose membrane and a magnetic biosensor. J. Immunol. Methods 2011, 365, 95–100. [Google Scholar] [CrossRef]
Biorecognition Material | Salmonella Species | Nanomaterial | Type Transducer | Linear Range | Sequence | LOD | Sample | Ref. |
---|---|---|---|---|---|---|---|---|
DNA | Salmonella Choleraesuis | AuNPs-1 AuNPs-2 | Colorimetric | - | 5′-HS-AAAAAAAAAACTTAGCTGACATCATG-3′ (imm1) 5′-CGAGTCAGAGTAGTTTAAAAAAAAAA-SH 3′ (imm2) | 50 nM | - | [15] |
Salmonella Typhimurium | AuNPs | Colorimetric | - | 5′-GAACGGCGAAGCGTACTGGAA-3 (RP) 5′-CATCGCACCGTCAAAGGAACC-3′ (FP) | 21.78 ng/mL | - | [28] | |
Salmonella spp. | AuNPs | Colorimetric | 10–103 CFU/mL | 5′ -ACCCACGCGTTTCATCGGTT-3′ 5′ -GCCGGCAATCCCTATCACCC-3′ | <10 CFU/mL | [29] | ||
Salmonella Enteritidis | AuNPs-SA | Colorimetric | 102–107 CFU/mL | 5′CGGGGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTA CC-3′ | 3 × 103 CFU/mL | - | [30] | |
Salmonella enterica | c-MWCNT/AuNP | Eletrochemical | 0–31.7 pg/μL | 5′-GTCCGGGTCAGCCTGAAT -3′ | 0.3 pg/mL | milk | [4] | |
Salmonella enterica | MNPs-DNA-AuNPs | Eletrochemical | 7–50 ng/mL | 5′-CTAACAGGCGCATACGATCTGACA-3 (FP) 5′-TACGCATAGCGATCTCCTTCGTTG-3′ (RP) | <100 ng/mL | Milk and orange juice | [18] | |
typhoidal Salmonella | Fe3O4-NPs/CGO/GCE | Eletrochemical | 1–1 × 10−8 nmol/L | 5′-GGCGGCGGGCGTCGCGCACG-3′ | 3.16 aM | [31] | ||
Salmonella | AuNPs-HRP-SA | Eletrochemical | 9.6–9.6 × 104 PFU/mL | 5′-TCGGCATCAATACTCATC-3′ | 8.07 PFU/mL | - | [3] | |
Salmonella-specific | AuNPs | Eletrochemical | 10 aM–10 pM | 5′-GCATCCGCATCAATAATACCG-3′ (FP) 5′ TTCTCTGGATGGTATGCCC-3′ (RP) | 6.76 aM | milk | [32] | |
Salmonella Enteritidis | CuNPs | Fluorescence | 50–104 CFU/mL | 5′-TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCA-3′ | 25 CFU/mL | [33] | ||
Salmonella Typhimurium | AuNPs | Reflectivity | 1 × 103–1 × 108 ng/mL | HS-T10-CAATCCGGACTACGACGCAC (CP) TTTATGAGGTCCGCTTGCTCTTTTTT-SH (DP) | 0.01−100 ng/mL | - | [34] | |
APTAMER | Salmonella-specific | AuNPs | Eletrochemical | 2.4–2.4 × 103 CFU/mL | 5′-HS-TATGGC GGC GTC ACC CGA CGG GGA CTT GAC ATT ATG ACA-G-3′. | 3 CFU/mL | pork | [14] |
Salmonella Typhimurium | QD/UCNP-MB | Luminescence | 50–106 CFU/mL | 5′-TATGGCGGCGTCACCCGACGG GGACTTGACATTATGACAG-3′ 5′-GGCGGTGTGAGGCTGGGAGGACGGACTGGG-3′ (cDNA) | 28 CFU/mL | [35] | ||
Salmonella Typhimurium | AuNPs (Apt-Au-PDMS film) | SERS | 27–2.7 × 105 CFU/mL | 5′-SH-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-3′ | 27 CFU/mL | - | [17] | |
Salmonella Typhimurium | AuNPs | SERS | 101–105 CFU/mL | 5′ -TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACA G-3′ | 4 CFU/mL. | pork | [2] | |
Salmonella | MGNPs (Fe3O4) and AuNPs | SERS | 102–107 CFU/mL | 5′-SH-TAT GGC GGC GTC ACC CGA CGG GGA CTT GAC ATT ATG ACA G-3′ | 15 CFU/mL | pork | [36] | |
Salmonella Typhimurium | AuNPs | LSPR | 104–106 CFU/mL | 5′-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-SH-3′ | 104 CFU/mL | pork | [37] | |
Salmonella Typhimurium | AuNPs | Fluorescence | 1.5 × 102–9.6 × 104 CFU/mL | 5′-CCAAAGGCTACGCGTTAACGTGGTGTTGG−3′(Apt1) 5′-ATAGGAGTCACGACGACCAGAAAGTAATGCCCGGTAGTTATTCAAAGATGA GTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT-3′(Apt2) | 464 CFU/mL | [38] | ||
Salmonella Typhimurium | SA-FSiNPs | Fluorescence | - | 5′-biotin-(CH2)6-AGTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGA-3′ 5′-biotin-(CH2)6-TGTCATGACCCGTAGGTAGTCTTAGAAGACTAGGCACGTT-3′ | 80 CFU/mL | [39] | ||
Salmonella Typhimurium | MNPs (Fe3O4) and CdTe QDs | Fluorescence | 10–1010 CFU/mL | 5′-biotin-C6-TATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG-3′(ssDNA1) 5′-C6-NH2-CTGTCATAATGTCAAGTC-3′(ssDNA2) | 1 CFU/mL | [40] | ||
Salmonella Typhimurium | AuNPs | Colorimetric | - | 50 -CCAAAGGCTACGCGTTAACGTGGTGTTGG −30 | 105 CFU/mL | - | [41] | |
Salmonella Typhimurium | MNPs (Fe3O4) | Colorimetric | - | 5′-GAGGAAAGTCTA- TAGCAGAGGAGATGTGTGAACCGAGTAA-3 | 7.5 × 105 CFU/mL | [12] | ||
Salmonella Typhimurium | AuNPs and MNPs (Fe3O4) | UV/Vis | 25 to 105 CFU/mL | 5′-SH-ATAGGAGTCACGACGAC-CAGAAAGTAATGCCCGGTAGTTATTCAAAGATGAGTAG-GAAAAGATATGTGCGTCTACCTCTTGACTAAT-3′ (apt 1) 5′-Bio-ATAGGAGTCACGACGACCAGAAAGTAATGCG-CGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGC-GTCTACCTCTTGACTAAT-3′ (apt2) | 10 CFU/mL | milk | [42] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tessaro, L.; Aquino, A.; de Almeida Rodrigues, P.; Joshi, N.; Ferrari, R.G.; Conte-Junior, C.A. Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review. Nanomaterials 2022, 12, 821. https://doi.org/10.3390/nano12050821
Tessaro L, Aquino A, de Almeida Rodrigues P, Joshi N, Ferrari RG, Conte-Junior CA. Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review. Nanomaterials. 2022; 12(5):821. https://doi.org/10.3390/nano12050821
Chicago/Turabian StyleTessaro, Leticia, Adriano Aquino, Paloma de Almeida Rodrigues, Nirav Joshi, Rafaela Gomes Ferrari, and Carlos Adam Conte-Junior. 2022. "Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review" Nanomaterials 12, no. 5: 821. https://doi.org/10.3390/nano12050821
APA StyleTessaro, L., Aquino, A., de Almeida Rodrigues, P., Joshi, N., Ferrari, R. G., & Conte-Junior, C. A. (2022). Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review. Nanomaterials, 12(5), 821. https://doi.org/10.3390/nano12050821