Next Article in Journal
Hydrodynamic Analysis and Drag-Reduction Design of an Unmanned Underwater Vehicle Based on Computational Fluid Dynamics
Previous Article in Journal
Experimental Study of Negative Skin Friction of Pile Group Foundations for Offshore Wind Turbines on Artificial Islands
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress

1
Key Laboratory of Efficient Utilization and Processing of Marine Fishery Resources of Hainan Province, Sanya Tropical Fisheries Research Institute, Sanya 572018, China
2
College of Fisheries and Life Sciences, Dalian Ocean University, Dalian 116023, China
3
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Key Laboratory of South China Sea Fishery Resources Exploitation and Utilization, Ministry of Agriculture and Rural Affairs, Guangzhou 510300, China
4
Shenzhen Base of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shenzhen 518108, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
J. Mar. Sci. Eng. 2024, 12(8), 1387; https://doi.org/10.3390/jmse12081387
Submission received: 27 July 2024 / Revised: 8 August 2024 / Accepted: 11 August 2024 / Published: 13 August 2024

Abstract

:
Salinity is a crucial environmental factor influencing the survival, growth, development, and reproduction of aquatic animals. However, the underlying molecular mechanisms of the shrimp’s response to salinity stress are not yet fully understood. Therefore, we used the Illumina NovaSeq 6000 platform to perform transcriptome sequencing of the hepatopancreas of Litopenaeus vannamei under high-salinity (30 PSU), medium-salinity (10 PSU), and low-salinity (0.5 PSU) conditions. We obtained 63.23 Gb of high-quality data and identified 3589 differentially expressed genes (DEGs), including 1638 upregulated and 1951 downregulated genes. Notably, a comparison between the control group (30 PSU) and the low-salinity group (0.5 PSU) revealed that the BBOX1 and CHE1 genes were significantly upregulated, while the ACOX1, MPV, CYP2L1, GCH, MVK, TREt1, and XDH genes were significantly downregulated. These genes are primarily involved in key metabolic pathways, such as fatty acid oxidation, cholesterol metabolism, and hormone synthesis and metabolism. The key genes involved in fatty acid β-oxidation, such as ACOX1, ACAD, HADH, HSD17B4, PECR, CROT, PIPOX, and CG5009, all showed a downward trend, suggesting that L. vannamei may respond to salt stress by regulating fatty acid oxidative metabolism, optimizing energy utilization, and maintaining cell homeostasis under low-salinity conditions. Functional annotation of gene ontology (GO) and KEGG pathway enrichment analysis highlighted the roles of these significant DEGs in the adaptation of L. vannamei to environments of varying salinity, underscoring the importance of metabolic pathways in their adaptive physiological responses. This study provides a crucial molecular biological basis for understanding the molecular mechanisms and physiological protection strategies of L. vannamei under salinity stress.

1. Introduction

Litopenaeus vannamei, which belongs to Arthropoda, Crustacea, Decapoda, and Penaeidae, is one of the most important globally cultured shrimp species [1]. Its excellent adaptability and high yield make it a primary aquaculture species in many countries [2]. As a typical euryhaline shrimp, L. vannamei exhibits strong osmoregulatory capabilities, allowing it to inhabit waters with salinities ranging from 0.5 PSU to 78 PSU and thrive in environments with varying salinity and temperature. However, under long-term salinity stress, L. vannamei exhibits significant physiological responses [3].
Salinity is a critical environmental factor affecting the growth and survival of aquatic animals. It directly influences the growth, physiology, and energy metabolism of crustaceans by altering the composition of body fluids and the homeostasis of their internal environment, significantly impacting the osmoregulatory mechanisms, ion balance, and energy metabolism of L. vannamei [4,5,6]. For instance, Li et al. found that the growth and survival rates of L. vannamei vary significantly at different salinities [7]. Zhou et al. demonstrated that salinity changes affect the ion balance and osmoregulatory ability of Eriocheir sinensis and identified the NKCC gene, a crucial ion channel protein related to osmoregulation, through transcriptomic analysis [8].
Recent studies on the physiological adaptability of L. vannamei under conditions of varying salinity have increased, with notable progress in understanding its stress resistance and immune responses. For example, Zhu et al. showed that severe potassium deficiency affects the antioxidant capacity of gill tissue in L. vannamei, and high Na+/K+ levels significantly impair DNA synthesis and repair mechanisms [9]. Wang et al. found that combined stress from high salinity and ammonia nitrogen significantly affects the antioxidant capacity and immune response of prawns [10]. Liu et al. further demonstrated that salinity stress induces changes in the expression of antioxidant enzymes and immune-related genes in L. vannamei, enhancing its stress resistance [11].
Investigating the transcriptome of L. vannamei under chronic salinity stress and identifying differentially expressed genes will elucidate the species’ salt tolerance mechanisms. This knowledge may enhance its survival rates in conditions of varying salinity and provide guidance for L. vannamei production. In this study, transcriptome analysis and real-time fluorescence real-time PCR were employed to systematically examine gene expression changes in the hepatopancreas of L. vannamei under chronic salinity stress. Salinity-related differential genes were selected for verification and analysis, and key genes and regulatory pathways associated with salinity adaptation were identified. These findings provide a theoretical basis for understanding the low-salinity tolerance mechanisms and selective breeding of L. vannamei.

2. Materials and Methods

2.1. Salinity Stress Test and Sample Collection

Litopenaeus vannamei was obtained from the Lutai Aquatic Seedling Base in Wenchang City, Hainan Province. Healthy and vigorous shrimp, with an average body length of approximately 4.5 cm and weight of about 1 g, were acclimated in indoor culture tanks for one week. The water temperature during acclimation was maintained at 28–29 °C, with a pH of 8.25 and salinity of 30 PSU. Continuous aeration was provided, and feeding occurred at 07:00, 12:00, 18:00, and 23:00 with specialized feed, amounting to 5% of the shrimp’s body weight daily. Residual feed and feces were removed each morning, and 50% of the seawater, pre-aerated and with the same salinity, was replaced.
At the beginning of the experiment, 100 L. vannamei per barrel were randomly selected. Using a salinity of 30 PSU as the control, the experimental salinity was reduced by 1–2 PSU daily until the target salinity was reached, and then the salinity was stabilized for one day. Three salinity groups were established: low salinity (0.5 PSU, LH), medium salinity (10 PSU, MH), and high salinity (30 PSU, HH). The experiment lasted 45 days. Post experiment, hepatopancreas samples were collected, immediately preserved in RNA-later® solution, and sent to Shanghai Ouyi Biotechnology Co., Ltd. (Shanghai, China) for sequencing.

2.2. RNA Extraction and Quality Control

RNA was extracted from the tissues of L. vannamei using the Trizol method. RNA degradation and contamination were assessed via 1% agarose gel electrophoresis. RNA integrity was evaluated using Agilent 2100 expert software (B02.08), while purity and quantification were determined using Nanodrop 2000 software (1.6). The transcriptome library was constructed using the Vahtsu Niver Salv 5 RNA-Seq Library Prep kit (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instructions [12].

2.3. Data Processing and Analysis

Sequencing of the library was performed on the Illumina NovaSeq 6000 platform, generating 150 bp paired-end reads. Raw reads in FASTQ format were processed using Fastp software (0.20.1) to remove low-quality reads, resulting in clean reads for subsequent analysis [13]. HISAT2 software (2.2.1) was employed to align the reads to reference genomes, and gene expression levels (FPKM) were calculated [14]. The read counts for each gene were obtained using HTSeq-count. PCA analysis and mapping were conducted using R (v3.2.0) to evaluate the biological replication of the samples [15]. Differential expression analysis was performed with DESeq2 (https://bioconductor.org/packages/release/bioc/html/DESeq2.html) (accessed on 12 March 2023), using a significance threshold of q < 0.05 and log2(fold change) > 2 or log2(fold change) < 0.5 [16]. Differentially expressed genes were enriched and analyzed using GO, KEGG Pathway, Reactome, and Wiki Pathways based on the hypergeometric distribution algorithm [17]. Gene set enrichment analysis was conducted using GSEA software(4.1.0) [18].

2.4. RT-qPCR Verification

To verify the transcriptome data, we initially identified a series of differentially expressed genes (DEGs) with high significance and then randomly selected nine genes from this pool for validation via fluorescence real-time PCR. The extracted RNA was reverse transcribed into cDNA using the Evo M-MLV Plus cDNA Kit (Hunan Aike Rui Biological Engineering Co., Ltd., Changsha, China) and diluted to 80–100 ng/µL with ultrapure water. Subsequently, RT-qPCR was performed using the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR (Hunan Aike Rui Biological Engineering Co., Ltd., Changsha, China), with 18S rRNA serving as the internal reference gene for normalization. Gene-specific primers were designed using Premier 6.0 software based on the known transcript sequences (Table 1).

3. Results

3.1. Quality Control Statistics of Transcriptome Sequencing Results

High-throughput sequencing using the Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA) generated a total of 63.23 Gb of high-quality data. Nine cDNA libraries (H_H1, H_H2, H_H3, L_H1, L_H2, L_H3, M_H1, M_H2, M_H3) were constructed from L. vannamei under chronic salinity stress. This process yielded a total of 440,562,296 clean reads, averaging 48,951,366 clean reads per sample. The genome alignment efficiency varied between 89.78% and 89.98% (Table 2). The Q30 base distribution ranged from 94.16% to 94.87%, and the average GC content was 52.20% (Table 3), which shows that the data generated by sequencing have high accuracy and can be used to support subsequent experiments.

3.2. Differential Gene Expression Analysis

Analysis of transcripts from the three salinity groups revealed significant changes in hepatopancreatic gene expression in L. vannamei. A total of 3589 differentially expressed genes were identified, with 1638 upregulated and 1951 downregulated (Figure 1A). The control vs. low-salinity group exhibited the highest number of differentially expressed genes at 1662 (706 upregulated and 956 downregulated). The high-salinity vs. medium-salinity group had the fewest, with 281 differentially expressed genes (72 upregulated and 209 downregulated). The low-salinity vs. medium-salinity group had 1646 differentially expressed genes (860 upregulated and 786 downregulated), indicating a significant response to low-salinity stress. The volcano map and cluster heat map (Figure 1B,C) mainly show different expression patterns between the low-salinity group and control group, highlighting clear upregulation and downregulation relationships. These classified genes serve as valuable references for gene enrichment analysis and the elucidation of the salinity adaptation mechanisms in L. vannamei.

3.3. Enrichment of GO Functional Annotation and KEGG Pathway Analysis of Differentially Expressed Genes

Gene Ontology (GO) function enrichment analysis and KEGG pathway enrichment analysis were performed on the differentially expressed genes (DEGs) identified in the transcriptome. In the GO analysis (Figure 2A), 1104 out of 3589 DEGs were successfully annotated with GO functions, which were classified into 64 different functional subclasses, including molecular functions (MF), cellular components (CC), and biological processes (BP). In the molecular functions category, most DEGs were enriched in binding and catalytic activity. For cellular components, most DEGs were involved in cell and cell part. In biological processes, cellular processes, biological regulation, and metabolic processes were the main GO subcategories.
Following functional annotation and enrichment of the DEGs, the KEGG database was used to perform functional enrichment analysis on the DEGs from the three experimental groups: LH vs. HH, LH vs. MH, and HH vs. MH. The results indicated that the DEGs involved 34 metabolic pathways. After excluding pathways related to human diseases, the largest number of DEGs were found in signal transduction (193 genes), followed by transport and catabolism (164 genes), carbohydrate metabolism (129 genes), endocrine system (126 genes), and immune system (53 genes).
In this experiment, we analyzed the differentially expressed genes between the control group and the salinity treatment groups. The specific information about these genes and the pathways they are involved in is presented in Table 4. Peroxidase was the primary response pathway in L. vannamei post salinity stress, with 50 DEGs identified across the three salinity comparison groups. Amino acid biosynthesis involved 44 DEGs, while lysine degradation was associated with 41 DEGs. Pathways related to drug metabolism and amino acid metabolism also contributed to the organism’s response to salinity stress. Among the signaling pathways, the PPAR signaling pathway was prominent, with 25 genes differentially expressed under varying salinity stresses.
KEGG enrichment analysis, using a corrected p-value (p-value < 0.05 was used as the screening condition), identified 28 significantly different metabolic pathways among the three salinity stress groups. The KEGG pathway enrichment diagrams for the control group versus the low-salinity group, the control group versus the medium-salt group, and the low-salinity group versus the medium-salt group are shown in Figure 2A–C. DEGs in the control group versus the low-salinity group were primarily enriched in metabolism-related pathways, including peroxidase, retinol metabolism, cytochrome P450-mediated drug metabolism, and exogenous drug metabolism (Figure 2A). In the control group versus the medium-salt group, DEGs were mainly enriched in lysosomal pathways, sphingolipid metabolism, linoleic acid metabolism, and polysaccharide degradation (Figure 2B). In the low-salinity versus medium-salinity groups, DEGs were mainly enriched in peroxidase, carbon metabolism pathways, amino acid biosynthesis, and cysteine and methionine metabolism pathways (Figure 2C).
Comprehensive analysis of the KEGG pathways (Figure 2D) in the three comparison groups revealed that L. vannamei primarily involved three critical pathways during low-salinity stress: peroxidase, amino acid biosynthesis, and lysine degradation. The peroxidase pathway, a cellular process, is vital for reducing oxidative damage and protecting the liver, functioning as a key pathway in the biological defense system. Amino acid biosynthesis, an energy metabolism pathway, affects organismal development and immunity [19]. The enrichment of the peroxidase pathway in the hepatopancreas under different salinity stress conditions highlighted its crucial role in salinity adaptation.
We used the gene set enrichment analysis (GSEA) tool to screen for the top six gene sets with significant changes after different salinity treatments (FDR q-value < 0.05 and p-value < 0.01) (Figure 2E). These gene sets are peroxisome (ko04146), glutathione metabolism (ko00480), metabolism of xenobiotics by cytochrome P450 (ko00980), protein processing in endoplasmic reticulum (ko04141), oxidative phosphorylation (ko00190), and drug metabolism—cytochrome P450 (ko00982). As shown in Figure 2E, all six gene sets showed a significant enrichment with a downward trend (NES < 0). The downregulation of these gene sets indicates that under different salinity treatments, the physiological functions of L. vannamei, such as overall metabolic activity, antioxidant defense, detoxification capacity, protein folding processing, and nucleic acid metabolism, are significantly affected.

3.4. Verification of RNA-Seq Results by qPCR

To validate the RNA-Seq results, nine DEGs with significant differential expression under salinity stress were selected for RT-qPCR verification. These DEGs included ACOX1 (acyl-CoA oxidase 1), XDH (xanthine dehydrogenase), BBOX1 (gamma-butyrobetaine dioxygenase 1), CHE1 (choline esterase 1), MPV17 (MPV17 mitochondrial inner membrane protein), CYP2L1 (cytochrome P450 2L1), GCH1 (GTP cyclohydrolase 1), MVK (mevalonate kinase), and TRET1 (testis-specific transcript 1). The RT-qPCR validation of nine differentially expressed genes (DEGs) showed trends consistent with the transcriptome analysis (Figure 3). Generally, the expression of these genes exhibited significant changes under conditions of varying salinity. For instance, several genes, including BBOX1, MPV, and MVK, showed significantly higher expression under low salinity (LH) compared to high (HH) and medium salinity (MH). Conversely, genes such as CHE1, ACOX1, CYP2L1, and Tret1 were significantly downregulated under low-salinity (LH) conditions. These patterns corroborate the transcriptome data, thereby confirming the reliability of the transcriptome analysis in reflecting the gene expression changes due to salinity stress in L. vannamei. The consistent downregulation or upregulation trends of these genes under different salinity treatments highlight the shrimp’s adaptive response mechanisms to salinity stress, involving critical pathways such as fatty acid metabolism, amino acid biosynthesis, and oxidative stress response.

4. Discussion

Although L. vannamei is known to tolerate a wide range of salinities, the molecular mechanisms underlying its adaptation to chronic hyposmotic stress remain inadequately explored. This study aimed to elucidate the mechanisms of adaptation of L. vannamei to long-term salinity changes through full-length transcriptome sequencing. The results of the GO analysis were consistent with findings in L. vannamei [20] from other studies, as well as in other species such as Penaeus monodon [21] and Pelteobagrus fulvidraco [22], showing changes in biological processes, molecular functions, and cellular components. KEGG analysis further revealed that 1925 DEGs across the three experimental groups (LH vs. HH, LH vs. MH, and MH vs. HH) were enriched in five major categories: metabolism, genetic information processing, environmental information processing, cellular processes, and biological systems. Salinity changes significantly affected the metabolic and signal transduction pathways of L. vannamei, which was consistent with the transcriptome analysis results of Litopenaeus vannamei [3,23] and Macrobrachium nipponense [24]. Therefore, this study focused on the adaptation of the metabolism and signal transduction pathway mechanisms related to salinity.
Salinity stress markedly altered the metabolic state of L. vannamei [4,25]. Our study showed that metabolism-related genes were significantly affected during prolonged low-salinity stress, leading to metabolic imbalances. Previous studies have reported similar findings, primarily focusing on osmotic physiological responses [26]. In our study, four significantly enriched metabolic pathways were detected in the LH vs. HH comparison: peroxidase, glutathione metabolism, lysine degradation, and amino acid biosynthesis. The LH vs. MH comparison revealed four significant pathways: amino acid biosynthesis, peroxidase, lysine degradation, and cytochrome P450 metabolism of exogenous substances. In the MH vs. HH comparison, three significant pathways were identified: lysosome, sphingolipid metabolism, and polysaccharide degradation.
These pathways are mainly associated with the regulation of glutathione, amino acids, and lipid metabolism. Crustaceans exposed to salinity changes require additional energy for osmoregulation and ion exchange [27]. Glutathione might increase reactive oxygen species (ROS) production, leading to oxidative stress, which provides antioxidant protection and helps organisms adapt to external salinity changes by maintaining intracellular solute balance [28]. Free amino acids act as osmolytes, providing energy and promoting cell growth [29], while lipids offer sufficient energy to maintain ion balance and regulate membrane permeability, playing a crucial role in osmoregulation [30].
The classification of DEGs revealed that peroxidase, amino acid biosynthesis, lysine degradation, and drug metabolism were key pathways in the response of L. vannamei to salinity stress. Peroxidase activity, as the primary response pathway, suggests a crucial role in managing oxidative stress. The significant involvement of amino acid biosynthesis and lysine degradation indicates adaptive metabolic adjustments to maintain cellular homeostasis. Additionally, the PPAR signaling pathway, with 25 differentially expressed genes, is important in regulating lipid metabolism and energy homeostasis under conditions of varying salinity. These pathways collectively underscore the complex physiological adaptations of L. vannamei to salinity stress.
Peroxisomes play a crucial role in the response of crustaceans to salinity stress, particularly in redox signaling and lipid homeostasis, and are intricately connected to glutathione metabolism. These organelles contribute to several essential metabolic processes, including fatty acid oxidation, ether lipid biosynthesis, and free radical detoxification. Following salinity stress, the key genes involved in fatty acid β-oxidation in L. vannamei, such as ACOX1, ACAD, HADH, HSD17B4, PECR, CROT, PIPOX, and CG5009, exhibited a downward trend. Acyl-CoA oxidase 1 (ACOX1) is the initial and rate-limiting enzyme in fatty acid β-oxidation and is responsible for the initial step in this metabolic pathway [31]. It is also a primary producer of hydrogen peroxide (H2O2), facilitating the desaturation of long-chain acyl-CoA to 2-trans-alkenyl-CoA and transferring electrons from its cofactor FADH2 to molecular oxygen, resulting in H2O2 production [32]. By contrast, PECR is involved in the final step of fatty acid β-oxidation [33], with both ACOX1 and PECR being pivotal in mediating inflammatory responses and reactive oxygen species (ROS) metabolism in mammals. The downregulation of ACOX1 and PECR reduces the number of peroxisomes and the mRNA expression of antioxidant genes, thereby reducing fatty acid oxidation in liver mitochondria and significantly decreasing ROS generation. Additionally, ACAD, HADH, HSD17B4, and CROT play key roles in the adaptive physiological response. These enzymes, involved in the metabolic pathways of fatty acids primarily within mitochondria and peroxisomes, are vital for regulating energy metabolism and maintaining cell membrane stability [34].
In this study, these enzymes exhibited a downward trend, consistent with the significant downregulation observed in L. vannamei under chronic low-salinity stress [3], paralleling findings from similar experiments on Portunus trituberculatus [35] and Scylla paramamosain [34]. In this study, the gene expression profiles of L. vannamei under three different salinity conditions were analyzed using gene set enrichment analysis (GSEA). The results revealed that several key metabolic pathways, including peroxisome, glutathione metabolism, and cytochrome P450, were significantly downregulated. Specifically, the downregulation of glutathione metabolism and the peroxisome pathway suggests that L. vannamei may experience increased oxidative stress under low-salinity conditions. Additionally, the downregulation of the cytochrome P450 metabolic pathway could impair the shrimp’s ability to detoxify exogenous toxic substances. These findings lead us to speculate that L. vannamei may respond to salt stress by regulating fatty acid oxidative metabolism, optimizing energy utilization, and maintaining cell homeostasis under low-salinity conditions. This adaptive mechanism likely serves to modulate metabolic activities, thereby reducing energy expenditure, mitigating oxidative stress, and regulating protein processing. Such adjustments are crucial for crustaceans to cope with environmental stressors and enhance their adaptability to changing environmental conditions [36]. By decreasing the expression levels of these enzymes, the fatty acid β-oxidation process is slowed, leading to a lower overall metabolic rate and energy expenditure. This reduction in fatty acid metabolism may also diminish the production of pro-inflammatory mediators, thus playing an immunomodulatory role under low-salinity stress [37]. The transcriptome analysis of L. vannamei revealed that most DEGs related to metabolism and immune signaling showed significant differences following low-salinity stress, indicating that the abundance of genes involved in these pathways is closely linked to salinity stress tolerance.

5. Conclusions

In this study, the key genes and metabolic pathways in the hepatopancreas of L. vannamei under chronic low-salinity stress were comprehensively analyzed at the transcriptome level. We observed differentially expressed genes related to metabolism and immune signals, which indicated that significant physiological adjustments occurred in response to salinity changes. In particular, many downregulated genes are involved in fatty acid β-oxidation and glutathione metabolism, indicating that L. vannamei might respond to salt stress by regulating fatty acid oxidative metabolism, optimizing energy utilization, and maintaining cell homeostasis under low-salinity conditions. Our data also clearly show that salinity stress induces oxidative stress, which was confirmed by the differential expression of antioxidant enzymes and ROS-related genes. This indicates that the antioxidant system is activated to protect cells from oxidative damage. In addition, the downregulation of the cytochrome P450 pathway shows that the ability of L. vannamei to detoxify exogenous substances is reduced under low-salinity stress. In summary, this study provides important insights into the molecular mechanisms and physiological adaptations of L. vannamei under salinity stress. It emphasizes the critical role of metabolic and oxidative stress responses in maintaining internal balance and enhancing stress tolerance.

Author Contributions

F.Z. and G.W. conceived the project and supervised the work. S.C. and Y.L. performed the bioinformatics analysis and prepared the manuscript, the table, and the figures. Q.Y., J.H. and J.S. conducted the experiment. L.Y., S.J. (Song Jiang) and S.J. (Shigui Jiang) collected the samples and performed sequencing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Key R&D Program of China (2022YFD2401900); Project of Sanya Yazhou Bay Science and Technology City (SCKJ-JYRC-2022-01); Central Public-interest Scientific Institution Basal Research Fund, CAFS (2023TD34); China Agriculture Research System (CARS-48); Guangdong Basic and Applied Basic Research Foundation (2023A1515012410); Hainan Provincial Natural Science Foundation of China (323MS127); earmarked fund for HNARS (HNARS-10-ZJ01); project funded by China Postdoctoral Science Foundation (2023T160178); and Central Public-interest Scientific Institution Basal Research Fund, South China Sea Fisheries Research Institute, CAFS (NO. 2024RC06).

Institutional Review Board Statement

The animal study was reviewed and approved by the Animal Care and Use Committee of the South China Sea Fisheries Research Institute.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the findings of this study are openly available in Figshare at https://doi.org/10.6084/m9.figshare.26538694.v1 with the DOI 10.6084/m9.figshare.26538694.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zheng, Y.; Liu, Y.; Liu, A. Optimization of culture system about Litopenaeus vannamei hepatopancreas primary cell. Feed. Ind. 2015, 36, 47–50. [Google Scholar] [CrossRef]
  2. Li, E.; Chen, L.; Zeng, C.; Chen, X.; Yu, N.; Lai, Q.; Qin, J.G. Growth, body composition, respiration and ambient ammonia nitrogen tolerance of the juvenile white shrimp, Litopenaeus vannamei, at different salinities. Aquaculture 2007, 265, 385–390. [Google Scholar] [CrossRef]
  3. Chen, K.; Li, E.; Li, T.; Xu, C.; Wang, X.; Lin, H.; Qin, J.G.; Chen, L. Transcriptome and Molecular Pathway Analysis of the Hepatopancreas in the Pacific White Shrimp Litopenaeus vannamei under Chronic Low-Salinity Stress. PLoS ONE 2015, 10, e0131503. [Google Scholar] [CrossRef] [PubMed]
  4. Sun, Z.; Lou, F.; Zhang, Y.; Song, N. Gill Transcriptome Sequencing and De Novo Annotation of Acanthogobius ommaturus in Response to Salinity Stress. Genes 2020, 11, 631. [Google Scholar] [CrossRef]
  5. Zhang, X.; Yuan, J.; Sun, Y.; Li, S.; Gao, Y.; Yu, Y.; Liu, C.; Wang, Q.; Lv, X.; Zhang, X.; et al. Penaeid shrimp genome provides insights into benthic adaptation and frequent molting. Nat. Commun. 2019, 10, 356. [Google Scholar] [CrossRef]
  6. Wang, Y.; Li, E.; Long, L.; Yu, N.; Zhang, F.Y.; Chen, L.Q. Review on the osmoregulation and adaptation to salinity changes of Chinese mitten crab Eriocheir sinensis. Mar. Fish. 2011, 33, 352–360. [Google Scholar] [CrossRef]
  7. Li, C.; Li, N.; Dong, T.; Fu, Q.; Cui, Y.; Li, Y. Analysis of differential gene expression in Litopenaeus vannamei under High salinity stress. Aquac. Rep. 2020, 18, 100423. [Google Scholar] [CrossRef]
  8. Zhou, J. Preliminary Investigation on Osmoregulation of Chinese Mitten crab, Eriocheir sinensis Based on Omics. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2019. [Google Scholar] [CrossRef]
  9. Zhu, H. Effects of ambient Na+/K+ on Growth and Physiological Characteristics of Litopenaeus vannamei in Low-Salinity Waters. Master’s Thesis, Shanghai Ocean University, Shanghai, China, 2023. [Google Scholar] [CrossRef]
  10. Wang, L.; Li, X.; Xie, J.; Feng, Q.; Wang, C.; Dai, X. Effects of salinity, temperature, ammonia and nitrite stress on growth and physiological biochemical indices of Litopenaeus vannamei. J. Shanghai Ocean. Univ. 2024, 1–17. Available online: https://link.cnki.net/urlid/31.2024.S.20240514.1352.002 (accessed on 26 July 2024).
  11. Liu, Q.; Wang, W.; Huang, X. Effects of dietary energy sources and levels on growth, antioxidant capacity and protein utilization of Litopenaeus vannamei. J. Fish. Sci. China 2023, 30, 1067–1079. [Google Scholar] [CrossRef]
  12. Liang, F.; Liang, H.; Zhuo, H.; Sun, R.; Wang, P.; Wen, C. Transcriptomics analysis of response of scalloped spiny lobster Panulirus homarus to nitrite stress. J. Dalian Ocean Univ. 2022, 37, 809–816. [Google Scholar] [CrossRef]
  13. Zhong, W.; Li, E.; Li, Q. Effects of Mulberry Leaf Oligosaccharides on Growth Performance, Intestinal Digestive Enzyme Activity, Immune Function and Microflora of Largemouth Bass (Micropterus salmoides). J. Anim. Nutr. 2024, 36, 1795–1805. [Google Scholar] [CrossRef]
  14. Dai, T.; Ma, X.; Zhan, Y. Exploration on the impact of fever on polarization of macrophage infected with Salmonella based on RNA-sequencing. Mod. Pract. Med. 2024, 36, 288–293. [Google Scholar] [CrossRef]
  15. Xu, S.; Chen, K.; Luo, Q.; Liu, H.; Ou, M.; Shangguan, Q.; Zhao, J. Microbial community in intestine of snakehead based on 16S rRNA high-throughput sequencing. J. Dalian Ocean Univ. 2020, 35, 693–700. [Google Scholar] [CrossRef]
  16. Li, W. Identification of Genomic Variation Landscape of Cervical Adenocarcinoma and Differential Transcriptome Expression of Cervical Adenocarcinoma and Squamous Cell Carcinoma. Ph.D. Thesis, Peking Union Medical College, Beijing, China, 2020. [Google Scholar] [CrossRef]
  17. Liu, L. Screening of Lipid Raft Protein LvFlotillin Interacting Protein and Study on Its Gene Function in Litopenaeus vannamei. Master’s Thesis, Third Institute of Oceanography, Ministry of Natural Resources, Xiamen, China, 2024. [Google Scholar] [CrossRef]
  18. Liu, M.; Liu, X.; Zeng, T.; Chen, S.; Li, Y.; Zhou, G. MDC1 promotes proliferation, migration and invasion of cholangio-carcinoma cells by suppressing p53 signaling pathway. Mil. Med. 2024, 48, 434–444. Available online: https://link.cnki.net/urlid/11.5950.r.20240511.1143.006 (accessed on 26 July 2024).
  19. Zhang, Y. Genetic Variation Analysis of Different Population Mantis Shrimp Oratosquilla oratoria Based on Mitochondrial DNA Control Region and Transcriptome. Master’s Thesis, Zhejiang Ocean University, Zhoushan, China, 2018. [Google Scholar]
  20. Yu, D.; Zhai, Y.; He, P.; Jia, R. Comprehensive Transcriptomic and Metabolomic Analysis of the Litopenaeus vannamei Hepatopancreas After WSSV Challenge. Front. Immunol. 2022, 13, 826794. [Google Scholar] [CrossRef]
  21. Li, Y.-D.; Si, M.-R.; Jiang, S.-G.; Yang, Q.-B.; Jiang, S.; Yang, L.-S.; Huang, J.-H.; Chen, X.; Zhou, F.-L.; Li, E. Transcriptome and molecular regulatory mechanisms analysis of gills in the black tiger shrimp Penaeus monodon under chronic low-salinity stress. Front. Physiol. 2023, 14, 1118341. [Google Scholar] [CrossRef]
  22. Wang, M.; Li, B.; Wang, J.; Xie, S.; Zhang, L. Skin transcriptome and physiological analyses reveal the metabolic and immune responses of yellow catfish (Pelteobagrus fulvidraco) to acute hypoxia. Aquaculture 2022, 546, 737277. [Google Scholar] [CrossRef]
  23. Luo, Z.; Yu, Y.; Zhang, Q.; Bao, Z.; Xiang, J.; Li, F. Comparative Transcriptome Analysis Reveals the Adaptation Mechanism to High Salinity in Litopenaeus vannamei. Front. Mar. Sci. 2022, 9, 864338. [Google Scholar] [CrossRef]
  24. Ling, F.; Fan, Y.; Wang, Z.; Xie, N.; Li, J.; Wang, G.; Feng, J. Combined transcriptome and metabolome analysis reveal key regulatory genes and pathways of feed conversion efficiency of oriental river prawn Macrobrachium nipponense. BMC Genom. 2023, 24, 267. [Google Scholar] [CrossRef]
  25. Liu, Z.; Ma, A.; Yuan, C.; Zhao, T.; Chang, H.; Zhang, J. Transcriptome analysis of liver lipid metabolism disorders of the turbot Scophthalmus maximus in response to low salinity stress. Aquaculture 2021, 534, 736273. [Google Scholar] [CrossRef]
  26. Guo, T.; Yang, Y.; Meng, F.; Wang, S.; Xia, S.; Qian, Y.; Li, M.; Wang, R. Effects of low salinity on gill and liver glycogen metabolism of great blue-spotted mudskippers (Boleophthalmus pectinirostris). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2020, 230, 108709. [Google Scholar] [CrossRef] [PubMed]
  27. Chen, K.; Li, E.; Gan, L.; Wang, X.; Xu, C.; Lin, H.; Qin, J.G.; Chen, L. Growth and Lipid Metabolism of the Pacific White Shrimp Litopenaeus vannamei at Different Salinities. J. Shellfish Res. 2014, 33, 825–832. [Google Scholar] [CrossRef]
  28. Wang, Y.; Li, H.; Wei, J.; Hong, K.; Zhou, Q.; Liu, X.; Hong, X.; Li, W.; Liu, C.; Zhu, X.; et al. Multi-Effects of Acute Salinity Stress on Osmoregulation, Physiological Metabolism, Antioxidant Capacity, Immunity, and Apoptosis in Macrobrachium rosenbergii. Antioxidants 2023, 12, 1836. [Google Scholar] [CrossRef] [PubMed]
  29. Lemos, D.; Phan, V.N.; Alvarez, G. Growth, oxygen consumption, ammonia-N excretion, biochemical composition and energy content of Farfantepenaeus paulensis Pérez-Farfante žCrustacea, Decapoda, Penaeidae/early postlarvae in different salinities. J. Exp. Mar. Biol. Ecol. 2001, 261, 55–74. [Google Scholar] [CrossRef]
  30. Tseng, Y.-C.; Hwang, P.-P. Some insights into energy metabolism for osmoregulation in fish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2008, 148, 419–429. [Google Scholar] [CrossRef]
  31. Mounia, T.; Pierre, A.; Sailesh, S.; Nasser, B.; Cherkaoui-Malki, M.; Latruffe, N. Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid Beta-Oxidation by PPARα. Int. J. Mol. Sci. 2021, 22, 8969. [Google Scholar] [CrossRef] [PubMed]
  32. Zeng, J.; Li, D. Expression and purification of his-tagged rat peroxisomal acyl-CoA oxidase I wild-type and E421 mutant proteins. Protein Expr. Purif. 2004, 38, 153–160. [Google Scholar] [CrossRef]
  33. Lu, Q.; Zong, W.; Zhang, M.; Chen, Z.; Yang, Z. The Overlooked Transformation Mechanisms of VLCFAs: Peroxisomal β-Oxidation. Agriculture 2022, 12, 947. [Google Scholar] [CrossRef]
  34. Zhang, Y.; Wu, Q.; Fang, S.; Li, S.; Zheng, H.; Zhang, Y.; Ikhwanuddin, M.; Ma, H. mRNA profile provides novel insights into stress adaptation in mud crab megalopa, Scylla paramamosain after salinity stress. BMC Genom. 2020, 21, 559. [Google Scholar] [CrossRef]
  35. Wang, J.; Liu, Q.; Zhang, X.; Gao, G.; Niu, M.; Wang, H.; Chen, L.; Wang, C.; Mu, C.; Wang, F. Metabolic Response in the Gill of Portunus trituberculatus Under Short-Term Low Salinity Stress Based on GC-MS Technique. Front. Mar. Sci. 2022, 9, 881016. [Google Scholar] [CrossRef]
  36. Zhang, K.; Wang, Y.; Zhang, Z. Research progress on mechanism of response to hypoxia stress in abalone. J. Fish. China 2023, 47, 3–28. [Google Scholar] [CrossRef]
  37. Calder, P.C. Omega-3 Fatty Acids and Inflammatory Processes. Nutrients 2010, 2, 355–374. [Google Scholar] [CrossRef] [PubMed]
Figure 1. (A) Statistics of differentially expressed genes. (B) Volcanic map of differential gene expression. (C) Differential comparison cluster heat map.
Figure 1. (A) Statistics of differentially expressed genes. (B) Volcanic map of differential gene expression. (C) Differential comparison cluster heat map.
Jmse 12 01387 g001
Figure 2. (A) Bubble diagram of KEGG enrichment analysis (LH vs. HH). (B) Bubble diagram of KEGG enrichment analysis (LH vs. MH). (C) Bubble diagram of KEGG enrichment analysis (MH vs. HH). (D) Use GO analysis to perform functional enrichment on differentially expressed genes. (E) GSEA analysis of Litopenaeus vannamei under salinity stress.
Figure 2. (A) Bubble diagram of KEGG enrichment analysis (LH vs. HH). (B) Bubble diagram of KEGG enrichment analysis (LH vs. MH). (C) Bubble diagram of KEGG enrichment analysis (MH vs. HH). (D) Use GO analysis to perform functional enrichment on differentially expressed genes. (E) GSEA analysis of Litopenaeus vannamei under salinity stress.
Jmse 12 01387 g002
Figure 3. Validation of differentially expressed genes (DEGs) using RT-qPCR under different salinity treatments. The genes validated include BBOX1, CHE1, ACOX1, MPV, CYP2L1, GCH1, MVK, Tret1, and XDH. Each bar represents the relative mRNA expression levels (mean ± SD) of these genes in the hepatopancreas of Litopenaeus vannamei under high-salinity (HH), medium-salinity (MH), and low-salinity (LH) conditions. Statistical significance is indicated by ns (not significant), * (p < 0.05), ** (p < 0.01), *** (p < 0.001), and **** (p < 0.0001).
Figure 3. Validation of differentially expressed genes (DEGs) using RT-qPCR under different salinity treatments. The genes validated include BBOX1, CHE1, ACOX1, MPV, CYP2L1, GCH1, MVK, Tret1, and XDH. Each bar represents the relative mRNA expression levels (mean ± SD) of these genes in the hepatopancreas of Litopenaeus vannamei under high-salinity (HH), medium-salinity (MH), and low-salinity (LH) conditions. Statistical significance is indicated by ns (not significant), * (p < 0.05), ** (p < 0.01), *** (p < 0.001), and **** (p < 0.0001).
Jmse 12 01387 g003
Table 1. Gene primers used for real-time PCR.
Table 1. Gene primers used for real-time PCR.
Primer NameNucleotide Sequence (5′ → 3′)
GCH1-qFCATCGAGATGTTCTCCACGTG
GCH1-qRTCTTGGACTTGCAATCTACGG
BBOX1-qFTCGACTTGAATGTGAAGCCTG
BBOX1-qRCTATAATGCCCGTCTGTCCAC
CHE1-qFGTGGATCTCTGGACCAACTTC
CHE1-qRCCCTGTCGTAGAGCTTCATG
TRet1-qFAAAGTCTTCCAAACATGCACG
TRet1-qRTGAAGTGTATGTTGGAGTCTGG
ACOX1-qFTCATCCCTTCATTGTCCAGC
ACOX1-qRATCTCGCCAACAGTAACACC
MVK-qFTCGACAATTCCATCTGCACG
MVK-qRACCTTCGTGTTCACTAGCAG
CYP2L1-qFGCTGTTCGTGTTCCTCTCC
CYP2L1-qRTCGTAATCACAACGTCGATGG
XDH-qFACAGGGCATAAACACCAAGG
XDH-qRCTATAGGAAGCCACATCTGACC
MPV-qFTGACTAACTGGACTGTTTGGC
MPV-qRTCTGCTCCTTTACTCCTGTATTTG
18S FCCTCGGTTCTATTTTGTCGGTTTT
18S RGCAGATGCTTTCGCAGTAGGT
Table 2. Sequence alignment results.
Table 2. Sequence alignment results.
SampleHHLHMH
Total reads48,568,564.6750,082,047.3348,203,486.67
Total mapped43,215,286 (89.78%)45,061,647 (89.98%)43,287,722 (89.80%)
Multiple mapped12,355,276 (25.4%)12,541,736 (25.04%)11,476,955 (23.80%)
Uniquely mapped31,254,727 (64.38%)32,519,911 (64.92%)31,810,767 (65.99%)
Table 3. Quality control of sequencing data.
Table 3. Quality control of sequencing data.
HHLHMH
Raw reads152146147
Raw bases222221
Clean reads150144145
Clean bases202120
Valid Bases (%)94.294.594.5
Q30 (%)94.394.694.7
GC content (%)52.2452.3552
Table 4. Classification and statistics of differentially expressed genes.
Table 4. Classification and statistics of differentially expressed genes.
PathwayNumber of Differentially Expressed Genes in Each Group (n)
LH vs. HHLH vs. MHMH vs. HH
Metabolism of xenobiotics by cytochrome P45020160
Peroxisome30200
Drug metabolism—cytochrome P45018140
Retinol metabolism1492
Glutathione metabolism2704
Glycine, serine, and threonine metabolism17140
Cysteine and methionine metabolism15150
Lysine degradation21173
Biosynthesis of unsaturated fatty acids880
Pentose and glucuronate interconversions14110
Drug metabolism—other enzymes15140
Steroid hormone biosynthesis1090
Arachidonic acid metabolism13103
PPAR signaling pathway13120
Biosynthesis of amino acids21230
Caffeine metabolism650
Amino sugar and nucleotide sugar metabolism1700
Starch and sucrose metabolism13160
Fatty acid metabolism1102
Porphyrin and chlorophyll metabolism10100
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Cao, S.; Li, Y.; Jiang, S.; Yang, Q.; Huang, J.; Yang, L.; Shi, J.; Jiang, S.; Wen, G.; Zhou, F. Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress. J. Mar. Sci. Eng. 2024, 12, 1387. https://doi.org/10.3390/jmse12081387

AMA Style

Cao S, Li Y, Jiang S, Yang Q, Huang J, Yang L, Shi J, Jiang S, Wen G, Zhou F. Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress. Journal of Marine Science and Engineering. 2024; 12(8):1387. https://doi.org/10.3390/jmse12081387

Chicago/Turabian Style

Cao, Siyao, Yundong Li, Song Jiang, Qibin Yang, Jianhua Huang, Lishi Yang, Jianzhi Shi, Shigui Jiang, Guoliang Wen, and Falin Zhou. 2024. "Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress" Journal of Marine Science and Engineering 12, no. 8: 1387. https://doi.org/10.3390/jmse12081387

APA Style

Cao, S., Li, Y., Jiang, S., Yang, Q., Huang, J., Yang, L., Shi, J., Jiang, S., Wen, G., & Zhou, F. (2024). Transcriptome Analysis Reveals the Regulatory Mechanism of Lipid Metabolism and Oxidative Stress in Litopenaeus vannamei under Low-Salinity Stress. Journal of Marine Science and Engineering, 12(8), 1387. https://doi.org/10.3390/jmse12081387

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop