New Record of the Grey Cutthroat, Synaphobranchus affinis (Anguilliformes: Synaphobranchidae) from the East Mariana Basin, Western Pacific Ocean
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling Collection
2.2. DNA Extraction, PCR Amplification and DNA Sequencing
2.3. Sequence Alignment and Phylogenetic Analysis
3. Results and Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ramirez-Llodra, E.; Brandt, A.; Danovaro, R.; Mol, B.D.; Escobar, E.; German, C.R.; Levin, L.A.; Arbizu, P.M.; Menot, L.; Buhl-Mortensen, P.; et al. Deep, diverse and definitely different: Unique attributes of the world’s largest ecosystem. Biogeosciences 2010, 7, 2851–2899. [Google Scholar] [CrossRef]
- Rex, M.A. Community structure in the deep-sea Benthos. Annu. Rev. Ecol. Syst. 1981, 12, 331–353. [Google Scholar] [CrossRef]
- Robison, B.H. Deep pelagic biology. J. Exp. Mar. Biol. Ecol. 2004, 300, 253–272. [Google Scholar] [CrossRef]
- Sanders, H.L.; Hessler, R.R. Ecology of the deep-sea benthos. Science 1969, 163, 1419–1424. [Google Scholar] [CrossRef]
- Drazen, J.C.; Sutton, T.T. Dining in the Deep: The Feeding Ecology of Deep-Sea Fishes. Annu. Rev. Mar. Sci. 2017, 9, 337–366. [Google Scholar] [CrossRef]
- Linley, T.D.; Gerringer, M.E.; Yancey, P.H.; Drazen, J.C.; Weinstock, C.L.; Jamieson, A.J. Fishesof the hadal zone including new species, in situ observations and depth records of Liparidae. Deep Sea Res. Part I Oceanogr. Res. Pap. 2016, 114, 99–110. [Google Scholar] [CrossRef]
- Orlov, A.M.; Tokranov, A.M. Checklist of deep-sea fishes of the Russian northwestern Pacific Ocean found at depths below 1000 m. Prog. Oceanogr. 2019, 176, 102143. [Google Scholar] [CrossRef]
- Austen, G.E.; Bindemann, M.; Griffiths, R.A.; Roberts, D.L. Species identification by experts and non-experts: Comparing images from field guides. Sci. Rep. 2016, 20, 33634. [Google Scholar] [CrossRef]
- Elphick, C.S. How you count counts: The importance of methods research in applied ecology. J. Appl. Ecol. 2008, 45, 1313–1320. [Google Scholar] [CrossRef]
- Farnsworth, E.J.; Chu, M.; Kress, W.J.; Neill, A.K.; Best, J.H.; Pickering, J.; Stevenson, R.D.; Courtney, G.W.; VanDyk, J.K.; Ellison, A.M. Next-Generation Field Guides. Bioscience 2013, 63, 891–899. [Google Scholar] [CrossRef]
- Sulak, K.J.; Shcherbachev, Y.N. Zoogeography and systematics of six deep-living genera of synaphobranchid eels, with a key to taxa and description of two new species of Ilyophis. Bull. Mar. Sci. 1997, 60, 1158–1194. [Google Scholar]
- Priede, I.G.; Froese, R. Colonization of the deep sea by fishes. J. Fish Biol. 2013, 83, 1528–1550. [Google Scholar] [CrossRef]
- Eschmeyer, W.N. Catalog of Fishes. Electronic Version. Available online: http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp (accessed on 4 April 2018).
- Ho, H.-C.; Smith, D.G.; McCosker, J.E.; Hibino, Y.; Loh, K.-H.; Tighe, K.A.; Shao, K.-T. Annotated checklist of eels (orders Anguilliformes and Saccopharyngiformes) from Taiwan. Zootaxa 2015, 4060, 140–189. [Google Scholar] [CrossRef]
- Johnson, J.Y. Descriptions of some new genera and species of fishes obtained at Madeira. Proc. Zool. Soc. Lond. 1862, 30, 167–180. [Google Scholar]
- Günther, A. Preliminary notes on new fishes collected in Japan during the Expedition of H.M.S. “Challenger”. Ann. Mag. Nat. Hist. 1877, 20, 433–446. [Google Scholar] [CrossRef]
- Günther, A. Report on the deep-sea fishes collected by H.M.S. Challenger during the years 1873–1876. Zoology 1887, 5, 1–335. [Google Scholar]
- Lea, E. Muraenoid Larvae: From the “Michael Sars” North Atlantic Deep-Sea Expedition, 1910. Rep. Sci. Res. “Michael Sars” N. Atl. Deep-Sea Exped. 1913, 3, 1–59. [Google Scholar]
- Castle, P.H.J. Deep-Water Eels from Cook Strait, New Zealand; Zoology Publications from Victoria University Wellington: Wellington, New Zealand, 1961; Volume 27, pp. 1–30. [Google Scholar]
- Melo, M.R.S. A new synaphobranchid eel (Anguilliformes: Synaphobranchidae) from Brazil, with comments on the species from the Western South Atlantic. Copeia 2007, 2, 315–323. [Google Scholar] [CrossRef]
- Almeida, A.J.; Biscoito, M. New records of Synaphobranchus (Anguilliformes, Synaphobranchidae) from the Azores, (eastern Atlantic Ocean). Cybium 2007, 31, 391–392. [Google Scholar]
- Almeida, A.J.; Biscoito, M.; Santana, J.I.; González, J.A. New records of grey cutthroat, Synaphobranchus affinis (Actinopterygii: Anguilliformes: Synaphobranchidae), from the eastern-central Atlantic Ocean. Acta Ichthyol. Piscat. 2010, 40, 66–70. [Google Scholar] [CrossRef]
- Zhang, J.B.; Hanner, R. DNA barcoding is a useful tool for the identification of marine fishes from Japan. Biochem. Syst. Ecol. 2011, 39, 31–42. [Google Scholar] [CrossRef]
- Ward, R.D.; Zemlak, T.S.; Innes, B.H.; Last, P.R.; Hebert, P.D.N. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2005, 360, 1847–1857. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.; Zhang, H.; Liu, J.; Niu, S.; Xiao, Y.; Chen, Y. DNA barcoding of the family Sparidae along the coast of China and revelation of potential cryptic diversity in the Indo-West Pacific oceans based on COI and 16S rRNA genes. J. Oceanol. Limnol. 2018, 36, 1753–1770. [Google Scholar] [CrossRef]
- Cabezas, P.; Lin, C.W.; Chan, T.Y. Two new species of the deep-sea squat lobster genus Munida Leach, 1820 (Crustacea: Decapoda: Munididae) from Taiwan: Morphological and molecular evidence. Zootaxa 2011, 3036, 26–38. [Google Scholar] [CrossRef]
- Mu, W.; Liu, J.; Zhang, H. Complete mitochondrial genome of Benthodytes marianensis (Holothuroidea: Elasipodida: Psychropotidae): Insight into deep sea adaptation in the sea cucumber. PLoS ONE 2018, 13, e0208051. [Google Scholar] [CrossRef]
- Kim, H.-J.; Han, J.; Kim, B.-J.; Lee, K.-W.; Hyeong, K.; Choi, Y.-U. New records of two deep-sea eels collected from the Western Pacific Ocean based on COI and 16S rRNA genes. Mol. Biol. Rep. 2021, 48, 5795–5801. [Google Scholar] [CrossRef]
- Shen, Y.; Hubert, N.; Huang, Y.; Wang, X.; Gan, X.; Peng, Z.; He, S. DNA barcoding the ichthyofauna of the Yangtze River: Insights from the molecular inventory of a mega-diverse temperate fauna. Mol. Ecol. Resour. 2019, 19, 1278–1291. [Google Scholar] [CrossRef]
- Böhlke, E.B. Fishes of the Western North Atlantic. Number 1. Memoirs of the Sears Foundation of Marine Research Part 9. In Orders Anguilliformes and Saccopharyngiformes; Yale University Press: New Haven, CT, USA, 1989; Volume 1. [Google Scholar]
- Ivanova, N.V.; Zemlak, T.S.; Hanner, R.; Hebert, P.D.N. Universal primer cocktails for fish DNA barcoding. Mol. Ecol. Notes 2007, 7, 544–548. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
- Darriba, D.; Posada, D.; Kozlov, A.M.; Stamatakis, A.; Morel, B.; Flouri, T. ModelTest-NG: A New and Scalable Tool for the Selection of DNA and Protein Evolutionary Models. Mol. Biol. Evol. 2020, 37, 291–294. [Google Scholar] [CrossRef]
- Edler, D.; Klein, J.; Antonelli, A.; Silvestro, D. raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol. Evol. 2021, 12, 373–377. [Google Scholar] [CrossRef]
- Kozlov, A.M.; Darriba, D.; Flouri, T.; Morel, B.; Stamatakis, A. RAxML-NG: A fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 2019, 35, 4453–4455. [Google Scholar] [CrossRef]
- Tang, K.L.; Fielitz, C. Phylogeny of moray eels (Anguilliformes: Muraenidae), with a revised classification of true eels (Teleostei: Elopomorpha: Anguilliformes). Mitochondrial DNA 2013, 24, 55–66. [Google Scholar] [CrossRef]
- Zhang, K.; Zhu, K.; Liu, Y.; Zhang, H.; Gong, L.; Jiang, L.; Liu, L.; Lü, Z.; Liu, B. Novel gene rearrangement in the mitochondrial genome of Muraenesox cinereus and the phylogenetic relationship of Anguilliformes. Sci. Rep. 2021, 11, 2411. [Google Scholar] [CrossRef]
- Robins, C.H. The Comparative Morphology of the Synaphobranchid Eels of the Straits of Florida. Proc. Acad. Nat. Sci. Phila. 1971, 123, 153–204. [Google Scholar]
- Smith, M.A.; Wood, D.M.; Janzen, D.H.; Hallwachs, W.; Hebert, P.D.N. DNA barcodes affirm that 16 species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are not all generalists. Proc. Natl. Acad. Sci. USA 2007, 104, 4967–4972. [Google Scholar] [CrossRef]
- Matarese, A.C.; Spies, I.B.; Busby, M.S.; Orr, J.W. Early larvae of Zesticelus profundorum (family Cottidae) identified using DNA barcoding. Ichthyol. Res. 2011, 58, 170–174. [Google Scholar] [CrossRef]
- Triantafyllidis, A.; Bobori, D.; Koliamitra, C.; Gbandi, E.; Mpanti, M.; Petriki, O.; Karaiskou, N. DNA barcoding analysis of fish species diversity in four north Greek lakes. Mitochondrial DNA 2011, 22, 37–42. [Google Scholar] [CrossRef]




| Years | ID Code | Geographical Area | Latitude | Longitude | Depth (m) |
|---|---|---|---|---|---|
| 2020 | BT02 | OSM9-1 | 16°54′ N~17°27′ N | 149°54′ E~150°12′ E | 1572 |
| 2020 | BT05 | OSM17 | 19°27′ N~19°36’ N | 151°27′ E~151°45′ E | 1298 |
| Morphometric Characters | BT02 | BT05 |
|---|---|---|
| Total length (mm, TL) | 948.0 | 1023.0 |
| In% TL | ||
| Head length | 14.1 | 14.5 |
| Trunk | 18.4 | 17.1 |
| Preanal-fin distance | 32.2 | 31.1 |
| Predorsal-fin distance | 51.6 | 52.1 |
| Body depth | 9.7 | 10.3 |
| Pectoral fin length | 5.1 * | 5.2 |
| Snout length | 28.0 | 28.6 |
| Eye diameter | 10.3 | 10.5 |
| Upper jaw length | 70.2 | 68.8 |
| Lower jaw length | 69.9 | 71.4 |
| Interorbtial width | 20.3 | 21.1 |
| Gill opening | 21.1 | 25.5 |
| Laterosensory Canal | BT02 | BT05 |
|---|---|---|
| Adnasal | 1 | 1 |
| Infraorbital canal | 7 | 7 |
| Preopercular-mandubula canal | 12 | 12 |
| Ethmoid | 1 | 1 |
| Supraorbtial canal | 5 | 5 |
| Frontal | 2 | 2 |
| Supratemporal canal | 2 | 2 |
| Lateral-line pores to anal-fin origin | 34 | 32 |
| Lateral-line pores to dorsal-fin origin | 58 | 57 |
| Total lateral-line pores | 134 | 131 |
| Total vertebrae | 139 | 135 |
| Genes | Oligo Name | Sequence |
|---|---|---|
| 16S | 16S_F (16Sar-5′) 16S_R (16Sbr-3′) | CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT |
| CO1-3 | VF2_t1 FishF2_t1 FishR2_t1 FR1d_t1 | TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, J.; Kim, H.-J.; Kim, B.-J.; Hyeong, K.; Noh, C.; Choi, Y.-U. New Record of the Grey Cutthroat, Synaphobranchus affinis (Anguilliformes: Synaphobranchidae) from the East Mariana Basin, Western Pacific Ocean. J. Mar. Sci. Eng. 2022, 10, 1567. https://doi.org/10.3390/jmse10111567
Han J, Kim H-J, Kim B-J, Hyeong K, Noh C, Choi Y-U. New Record of the Grey Cutthroat, Synaphobranchus affinis (Anguilliformes: Synaphobranchidae) from the East Mariana Basin, Western Pacific Ocean. Journal of Marine Science and Engineering. 2022; 10(11):1567. https://doi.org/10.3390/jmse10111567
Chicago/Turabian StyleHan, Jeonghoon, Han-Jun Kim, Byung-Jik Kim, Kiseong Hyeong, Choonghwan Noh, and Young-Ung Choi. 2022. "New Record of the Grey Cutthroat, Synaphobranchus affinis (Anguilliformes: Synaphobranchidae) from the East Mariana Basin, Western Pacific Ocean" Journal of Marine Science and Engineering 10, no. 11: 1567. https://doi.org/10.3390/jmse10111567
APA StyleHan, J., Kim, H.-J., Kim, B.-J., Hyeong, K., Noh, C., & Choi, Y.-U. (2022). New Record of the Grey Cutthroat, Synaphobranchus affinis (Anguilliformes: Synaphobranchidae) from the East Mariana Basin, Western Pacific Ocean. Journal of Marine Science and Engineering, 10(11), 1567. https://doi.org/10.3390/jmse10111567

