Next Article in Journal
Approach to Selenium Application in Different Soil Concentrations for Encouraged Yield, Distribution, and Biofortification of Common Buckwheat Seeds (Fagopyrum esculentum Moench)
Previous Article in Journal
Evaluating Maturity Index IAD for Storability Potential in Mid-Season and Late-Season Apple Cultivars in the Light of Climate Change
Previous Article in Special Issue
Silage Preparation, Processing and Efficient Utilization
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 8
10.3390/agriculture15080890
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Influence of Epiphytic Microorganisms on Silage Quality and Aerobic Exposure Characteristics of Grass Pastures

by
Qi Yan
1,2,3,
Hao Ding
1,2,3,
Chenghuan Qin
1,2,3,
Qichao Gu
1,2,3,
Xin Gao
1,2,3,
Yongqi Tan
1,2,3,
Deshuang Wei
1,2,
Yiqiang Li
1,2,
Nanji Zhang
1,2,3,
Ruizhanghui Wang
1,2,3,
Bo Lin
1,2,3 and
Caixia Zou
1,2,3,*
1
College of Animal Science and Technology, Guangxi University, Nanning 530004, China
2
Guangxi Key Laboratory of Animal Breeding, Disease Control and Prevention, Nanning 530004, China
3
Science and Technology Backyard of Guangxi Fusui Dairy Industry, Chongzuo 532100, China
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(8), 890; https://doi.org/10.3390/agriculture15080890
Submission received: 4 March 2025 / Revised: 12 April 2025 / Accepted: 17 April 2025 / Published: 19 April 2025
(This article belongs to the Special Issue Silage Preparation, Processing and Efficient Utilization—2nd Edition)
Browse Figures
Versions Notes

Abstract

:
In this study, we investigated whether epiphytic microorganisms of fresh forage affect silage quality and aerobic exposure of silage by determining the changes in chemical composition, fermentation characteristics and microbial population of two grass forages (sugarcane tops and corn stover) under aerobic exposure treatments (fresh, end-of-storage and aerobic exposure periods). There were nine replicates for each of the two forage silages. The total silage time was 60 days, after which the cellar was opened for a 12-day period for aerobic exposure measurements. At the end of ensiling, the lactic acid content of corn stover silage (116.78 g/kg DM) was significantly higher than that of sugarcane top silage (16.07 g/kg DM; p < 0.01), and the corn stover (3.53) had a significantly lower pH than sugarcane tops (4.46) (p < 0.01). Weissella was the most abundant epiphytic lactic acid bacteria (LAB) in sugarcane tops and corn stover (19.08% and 11.15%, respectively). The relative abundance of epiphytic Pediococcus was higher in sugarcane tops (0.17%) than in corn stover (0.09%; p < 0.05). The relative abundance of Pediococcus was significantly higher in sugarcane top silage (2.24%) than in corn stover silage during the aerobic exposure period (p < 0.01). The acetic acid content of corn stover silage was significantly reduced during aerobic exposure (p < 0.01) due to the abundance of Paenibacillus (62.38%). The fungal genus Candida affected the aerobic exposure of sugarcane top (37.88%) and corn stover silage (73.52%). In summary, Weissella was the genus of lactic acid bacteria present in the highest abundance in sugarcane tops and corn stover, favoring early and rapid acidification. In addition, Candiada, which consumes organic acids in large numbers, was the fungal genus that influenced the aerobic exposure of sugarcane top silage versus corn stover silage.

Graphical Abstract

1. Introduction

Ensiling is the process of converting carbohydrates into organic acids, mainly lactic, acetic, butyric and valeric acids, by a microbial community dominated by lactic acid bacteria (LAB) under anaerobic conditions [1,2]. Ensiling has been widely used to preserve forage, and the produced silage has been applied in ruminant diets. The number of microorganisms that are harmful to the ensiling process (microorganisms that do not meet silage guidelines) decreases as a result of the decreasing pH within the silage environment due to continuous organic acid accumulation [3].
Silage quality is influenced by epiphytic microorganisms and forage characteristics, such as dry matter content, starch content and soluble carbohydrate content [4]. Researchers have explored the differences in ensiling Paper mulberry harvested in three provincial areas of China, which were distant from each other. Paper mulberry harvested in Henan Province gave the best silage results, with the lowest pH (5.0) and the highest lactic acid concentration (35 g/kg DM). In addition, Enterobacter cloacae and Lactobacillus were the core bacteria responsible for the high silage-fermentation quality [5]. Ali et al. investigated the effects of transplantation and reconstitution of indigenous and exogenous epiphytic microbiota on the fermentation quality and microbial community of red clover silage [6]. The results showed that the lactic acid content (Mean 71.0 g/kg DM) of red clover epiphytic microorganisms was higher during the whole silage period, while corn epiphytic microorganisms (111 g/kg DM) were higher in the late silage period, and both red clover epiphytic microorganisms and corn epiphytic microorganisms were beneficial with respect to improving the quality of red clover silage. In our previous study [7], microorganisms dominated the ensiling process, and aerobic exposure of sugarcane tops led to different nutritional qualities.
According to FAO statistics, sugarcane and corn account for 20% and 12% of global production of major crops, respectively [8]. Sugarcane and corn are grown in large quantities in southern China, generating large quantities of discarded sugarcane tops and corn stover each year, accounting for about 20% of the crop weight [9,10]. This study used sugarcane tops and corn stover, which are common ruminant forage resources in southern China, as forage by-product models. This study is based on the following hypotheses: epiphytic microorganisms affect the silage quality and aerobic exposure quality of forage, and epiphytic microorganisms play a dominant role. The objective of this study was to determine the effect of epiphytic microorganisms on the chemical composition, fermentation parameters and aerobic exposure fermentation parameters of sugarcane top silage and corn stover silage.

2. Materials and Methods

2.1. Forage Plant for Silage

The two forages were collected in three regions that were in close proximity to each other with no significant differences in elevation or climate. In this case, three replicates were collected for each region and each forage. In other words, each forage included nine replicates. Sugarcane tops were collected during the elongation stage from three locations in Nanning City, China. The new ‘Formosa Sugar 22’ variety was harvested in the three areas. The first location was the Guangxi University experimental field in the Xixiangtang Township area (Ground Source 1: GS, 108°17′ E, 22°50′ N). The second location was Lvshanong farmland in the Jiangnan area (Ground Source 1: LS, 107°5′ E, 22°20′ N), and the third location was Kunlun Road farmland in the Xingning area (Ground Source 3: KS, 108°32′ E, 22°82′ N). Similarly, corn stover was collected during the milk ripening stage from three different locations in Nanning City, China. The ‘Guangyu 28’ variety was harvested in the three areas. The first location was Lvshanong farmland in the Jiangnan area (Ground Source 1: LC, 107°5′ E, 22°20′ N), and the second location was Kunlun Road farmland in the Xingning area (Ground Source 2: KC, 108°32′ E, 22°82′ N). The last collection site was the farmland of the Maize Research Institute of Guangxi Zhuang Autonomous Region, Jiangnan District, Nanning City (Ground Source 3: WC, 107°5′ E, 22°20′ N). All forage material was collected on 15 July 2021. There was no difference in temperature between the three areas (close distance apart and belonging to the same climate zone). On the day of the harvest, the maximum temperature was 35 °C and the minimum temperature was 26 °C. The weather was sunny.

2.2. Silage Preparation

Both forages were physically cut to 2–3 cm with a guillotine. To prepare the silage, 2.5 L plastic jars were filled with 1.7 kg of chopped forage material and sealed with two layers of polyethylene plastic film beneath the lid. The density of silage is about 680 kg/m3. There were 9 replicates for each forage. The jars were left at room temperature for 60 days to ferment, and samples were collected immediately after the completion of the silage [7].

2.3. Aerobic Exposure

The aerobic exposure of the silage was determined according to the methods of Nishino et al. [10] and Gu et al. [7]. A silage sample (80 g) from each treatment was placed into a 500 mL plastic bottle at room temperature (25 ± 2 °C) and covered with a layer of gauze. After 4, 8 and 12 days of aerobic exposure, the silage samples in each plastic bottle were thoroughly mixed and subsampled for microbial analyses. Samples were mixed thoroughly using sterile forceps and collected in sterilized sample collection tubes. The samples were divided for analysis as follows: 15 g for chemical analysis, 25 g for short chain fatty acid and NH3-N analysis, 10 g for microbiological analysis and 30 g for DNA extraction.

2.4. Forage Quality and Nutritive Values

To determine the dry matter (DM) content of chopped fresh sugarcane top silage and corn stover silage, samples were placed in an oven at 65 °C for 72 h. The samples were then weighed to calculate the DM content. The nitrogen (N) content was determined using the Kjeldahl method, according to the Association of Official Analytical Chemists [11]. To estimate the crude protein (CP), the N content was multiplied by 6.25. The ash content was measured following AOAC 942.05 carbonized in a muffle furnace at 550 °C for 3 h [12]. The neutral detergent fiber (NDF) and acid detergent fiber (ADF) were measured using the methods described by Van Soest et al. [13] and a fiber analyzer (2000i, ANKOM Technology, Macedon, NY, USA). The hemicellulose (HC) content was calculated by subtracting the ADF from the NDF [14]. The water-soluble carbohydrate (WSC) content was determined by anthrone-sulfuric acid colorimetry [15].
The dry matter intake (DMI) was calculated using the formula DMI (% of BW) = 120/NDF, (% of DM) [16]. The following formula was used to calculate the dry matter digestibility: (DM digestibility, %) = 88.9 − 0.779 × ADF (% of DM). Following McDonald et al., [17] the digestible crude protein (DCP) was determined using the formula DCP (%) = (0.9115 × CP − 3.62) [18]. The relative feed value (RFV) was calculated using the following formula: RFV = [(120/NDF) × (88.9 − 0.779 × ADF)]/1.29 [19].

2.5. Fermentation Characteristics of Silage and Microbe Enumeration

For fermentation characteristic analysis and microbe enumeration of the silage samples, 25 g of each sample was mixed with 225 mL of ringer’s solution and the mixture was filtered through two layers of cheesecloth [8]. The specific test metrics are listed below. The pH of the obtained extract was measured directly using a pH analyzer (Mettler Toledo Delta 320; Mettler-Toledo, Greifensee, Switzerland). One part of the filtrate was centrifuged at 12,000× g for 15 min at 4 °C to determine the contents of organic acids, namely lactic acid, acetic acid, butyric acid and ammonia-N (NH3-N). The lactic acid and NH3-N contents were measured following the method described by Yan et al. [15]. The other filtered liquids were tested for microbe enumeration after serial dilution (dilutions of 10−1–10−6). LAB were enumerated using De Man, Rogosa and Sharpe agar at 35 °C in an anaerobic incubator for 48 h. Fungi were enumerated using potato dextrose agar (Beijing Land Bridge Technology, Beijing, China) at 25 °C for 72 h. Clostridium was cultivated on Tryptose Sulfite Cycloserine Agar Base (Beijing Land Bridge Technology, Beijing, China) at 37 °C for 24 h.

2.6. Microbial Community Analysis

In this experiment, we selected sugarcane top and corn stover raw material and sugarcane top silage and corn stover silage on the day of jar opening at the end of ensiling and 12 days after aerobic exposure for microbial sequencing analysis. Microbial DNA extracted from the silage samples was sent to Pufei Information Technology Company (Nanning, China) for 16S RNA and ITS gene amplicon sequencing on a NovaSeq6000 (San Diego, CA, USA). The 16S V3–V4 primers (341F: CCTAYGGGRBGCASCAG and 806R: GGACTACHVGGGGTWTCTAAT) were used to identify bacterial diversity. Amplification sequencing of fungal ITS was performed using primers ITS1F (ITS 5173F: GGAAGTAAAAGTCGTAACAAGG) and ITS2 (GCTGCGTTCTTCATCGATGC). The 16S rRNA sequencing data and fungal ITS sequencing data were analyzed as described by Zhang et al. [7] and Gu et al. [9]. Sequential clustering (97% concordance) was performed on the operational taxonomic unit (OTU) data from the samples using Uparse software. Qiime software (Version 1.7.0) was used to calculate Chao1, Shannon, Simpson and Observed species.

2.7. Statistical Analysis and Data Visualization

The experiment was designed using a completely randomized approach and consisted of two forages and three periods (fresh forage, silage forage and forage during the aerobic exposure period). Data were initially collated using Excel 2016 (Microsoft Corp., Redmond, WA, USA) and then analyzed using SPSS version 26.0 (IBM Corp., Armonk, NY, USA). The chemical composition, nutritional quality and fermentation characteristics indexes of the two forages before and after silage were analyzed using independent sample t-test. First, the chemical composition, nutritional quality and fermentation characteristics indexes of fresh sugarcane tops and fresh corn stover were compared. Secondly, the chemical composition, nutritional quality and fermentation characteristics indexes of fresh sugarcane tops and silage sugarcane tops were compared. Finally, the chemical composition, nutritional quality and fermentation characteristics indexes of fresh corn stover and silage corn stover were compared. A level of p < 0.05 is considered statistically significant and p < 0.01 is considered statistically highly significant. Fermentation parameters and microbial counts during the aerobic exposure period were analyzed using two-way analysis of variance (ANOVA), including forage effects and aerobic exposure time (day). In this case, the comparison of the indicators between the two forages in the same period was carried out using the independent samples t-test. Comparison of the indicators of the same forage species between different periods was carried out using one-way analysis of variance (ANOVA). Differences were considered significant at p < 0.05 and highly significant at p < 0.01. Figures were generated using GraphPad Prism version 7 (GraphPad Software Corp., San Diego, CA, USA). The table is organized and presented by Word (Microsoft Corp., Redmond, WA, USA).

3. Results

3.1. Chemical Composition and Microbial Populations of Sugarcane Tops and Corn Stover Before and After Silage

In the current study, there were no significant differences in DM content between fresh sugarcane tops and corn stover (p > 0.05) (Table 1). The NDF, ADF and HC contents in sugarcane tops were 658.9, 350.0 and 308.9 g/kg of DM, respectively, which were significantly higher than those in corn stover, which were 546.7, 291.0 and 255.4 g/kg of DM, respectively (p < 0.01). At the end of silage, the NDF, ADF and HC contents of sugarcane tops remained significantly higher than those of corn stover (p < 0.01). There were no differences in the WSC content between sugarcane tops and corn stover before and after silage (p > 0.05). The CP content of corn stover before and after silage was significantly higher than that of sugarcane tops (p < 0.01 and p < 0.05, respectively). In addition, the enterobacteria (ET) number for sugarcane tops (5.36 log10 CFU/g FM) was significantly higher than that for corn stover (6.12 log10 CFU/g FM; p < 0.01). However, there were no significant differences in the number of ETs between sugarcane tops and corn stover at the end of silage (p > 0.05). In the pH of corn stover, silage was significantly lower than that of sugarcane top silage. The nutritional value indices of sugarcane tops and corn stover before and after silage are shown in Table 2. DCP and RFV were significantly higher for corn stover silage than for sugarcane top silage (p < 0.05). DDM and DMI were significantly lower in sugarcane tops than in corn stover (p < 0.01).

3.2. Fermentation Characteristics of Sugarcane Top and Corn Stover Silage

The final fermentation characteristics of silage are shown in Figure 1. The lactic acid content was significantly higher in corn stover silage (116.78 g/kg DM) than in sugarcane top silage (16.07 g/kg DM; p < 0.01). Propionic acid was not detected in corn stover silage. The butyric acid content in sugarcane top silage was significantly higher than that in corn stover silage (p < 0.01). Furthermore, the NH3-N content of sugarcane top silage was significantly higher than that of corn stover silage (0.628 and 0.37 g/kg DM, respectively; p < 0.01).

3.3. Fermentation Characteristics and Microbiome Count of Sugarcane Top and Corn Stover Silage with Different Aerobic Exposure Times

The fermentation characteristics and microbiome count of sugarcane top silage and corn stover silage under different aerobic exposure times are shown in Figure 2. The lactic acid content of corn stover silage was higher than that of sugarcane top silage under all aerobic exposure times (p < 0.01; Figure 2A). The lactic acid content of corn stover silage was 45.97, 30.41 and 18.99 g/kg DM after 4, 8 and 12 days of aerobic exposure, respectively, which was significantly higher than that of sugarcane top silage at 4.86, 3.57 and 2.42 g/kg DM, respectively. Moreover, the lactic acid content of both silages decreased significantly with prolonged exposure time (p < 0.01). The acetic acid content of sugarcane top silage was higher than that of corn stover silage in 4, 8 and 12 days of aerobic exposure times (p < 0.01) (Figure 2B). In addition, propionic acid was not detected in corn stover silage with aerobic exposure. The butyric acid content of corn stover silage was not detected during the aerobic exposure period. The butyric acid content of sugarcane tops decreased continuously with time, from 0.74 g/kg DM at 4 days to 0.32 g/kg DM at 12 days (p < 0.01).
Similarly, the number of LAB showed a consistent trend; the number of LAB in corn stover was significantly higher than that in sugarcane tops at all time points (p < 0.01) (Figure 2G). In addition, the number of LAB in maize stover decreased significantly over time (6.92, 6.09 and 6.05 log10 cfu/g FM; p < 0.05). The number of LAB in sugarcane tops also decreased significantly over time (5.02, 3.76 and 3.12 log10 cfu/g FM; p < 0.01). Yeast and ET numbers were significantly higher for corn stover silage than for sugarcane top silage at all aerobic exposure durations (p < 0.01) (Figure 2H,I).

3.4. Bacterial Taxa Structure of Sugarcane Top and Corn Stover Silage

The bacterial taxa structure of sugarcane top silage and corn stover silage is shown in Figure 3. Bacterial diversity differed between sugarcane tops and corn stover with different exposure durations. Epiphytic microbial diversity (observed species, Shannon, Simpson and Chao1) was higher in fresh corn stover than in fresh sugarcane tops (p < 0.01) (p < 0.05) (Figure 3A). Shannon and Simpson indices were significantly higher for sugarcane top silage than corn stover silage.
The dominant bacterial genera in fresh sugarcane tops were Pantoea, Weissella and Pseudomonas, whose relative abundance reached 63.73, 19.08 and 4.95%, respectively (Figure 3B). The dominant bacterial genera in fresh corn stover were Pseudomonas, Pantoea and Weissella, whose relative abundance reached 29.03, 18.65 and 11.15%, respectively. The higher abundance of epiphytic Weissella in both forages was also reflected in the silage samples (3.29% in sugarcane top silage and 3.38% in corn stover silage). In addition, significant amounts of Clostridium were found in sugarcane tops, reaching a relative abundance of 27.34% at the end of the silage and 19.41% after the aerobic exposure period. However, epiphytic Clostridium was rare in sugarcane tops, at only 0.1% abundance.
To better characterize the effect of epiphytic LAB on silage quality and aerobic exposure quality, we discuss the relationship between the composition of common epiphytic LAB. The composition of LAB in silage samples and the composition of LAB in aerobically exposed samples was analyzed. Five common LAB, namely Lactobacillus, Lactococcus, Weissella, Pediococcus and Sporolactoballus, were analyzed in silage (Figure 3C). Sugarcane top and corn stover silage showed significant differences in the relative abundance of Lactobacillus over time. Overall, the relative abundance of Lactobacillus increased from fresh to silage to aerobically exposed samples (p < 0.01) (Figure 3C). The relative abundance of Pediococcus was significantly higher in sugarcane tops than in corn stover when they were fresh and during the aerobic exposure period (p < 0.01), but there were no differences after silage.

3.5. Fungal Taxa Structure of Sugarcane Top Silage and Corn Stover Silage

The fungal taxa structure of sugarcane top and corn stover silage is shown in Figure 4. A significant difference in fungal diversity (observed species, Shannon and Simpson) was observed between sugarcane tops and corn stover during different periods (p < 0.05) (p < 0.01) (Figure 4A,B,D). A highly significant difference was found in observed species between sugarcane top silage and corn stover silage (p < 0.01) (Figure 4A). The same genera of epiphytic fungi were present in fresh sugarcane tops and fresh corn stover. However, these fungi differed in relative abundance in their respective hosts (Figure 4B). The fungus with the highest relative abundance in fresh sugarcane tops was Penicillium, which reached a relative abundance of 22.24%, but it only reached a relative abundance of 5.60% in fresh corn stover. Meyerozyma had a relative abundance of 18.12% in fresh sugarcane tops and 5.81% in fresh maize stover. Candida reached a relative abundance of 0.29% in fresh sugarcane tops and 4.16% in fresh corn stover.
The relative abundance of fungal composition of the two forages showed a trend similar to that of epiphytic fungi. Meyerozyma reached a relative abundance of 22.84 and 19.99% in sugarcane top and corn stover silage, respectively. Candida had the highest relative abundance in corn stover silage (59.16%) and only reached a relative abundance of 14.89% in sugarcane top silage.
After aerobic exposure, the composition of the fungi was further changed compared to the fresh and silage samples. Meyerozyma accounted for 13.76% of the relative abundance in sugarcane top silage. Candida had the highest relative abundance in the two forage grasses, accounting for 37.88% in sugarcane top silage and 73.52% in corn straw silage. Monascus was the second most abundant fungus in corn stover silage, accounting for 23.29%. Candida and Monascus comprised most of the fungal community in corn stover silage during the aerobic exposure period.

4. Discussion

4.1. Chemical Composition and Microbial Populations of Sugarcane Tops and Corn Stover Before and After Silage

In this study, the effects of epiphytic microorganisms on silage quality and aerobic exposure characteristics of grass forage were investigated using sugarcane tops and corn stover. The DM of sugarcane tops range from 18.05 to 24.15%, indicating that sugarcane tops are a high moisture content silage material [19,20]. The DM of 220.15 g/kg fresh weight of sugarcane tops in this study fits this range. The sugarcane top moisture was similar to that of Hundal et al. [21]. The DM of the corn stover harvested in this study was 231.7 g/kg FW, indicating that it is also a high-moisture raw material. The DM of corn stover harvested in this study was 231.7 g/kg FW, indicating that it is also a high-moisture raw material, similar to 19.24% reported by Li et al., 2024 [22]. The fiber fraction content (NDF, ADF) in corn stover in this study is similar to that in Xie et al. [10]. The fiber fraction in sugarcane tops is similar to that in Du et al. [23]. The WSC content of forage is a crucial factor in determining silage fermentation quality because WSC serves as a substrate for LAB during the fermentation process [24]. In this study, the WSC content of sugarcane tops was 227 g kg/FW. This content corresponds to the minimum WSC content of well-fermented sugarcane top silage (55 g/kg DM) and is also higher than the WSC content of sugarcane tops in several other studies, suggesting that sugarcane tops are a suitable substrate for LAB during fermentation [4,24]. The nutritional value index ratings were not reversed by silage. Consistent with the results for fresh sugarcane, DDM, DMI, DCP and RFV were significantly lower for silage tops than for corn stover. This is due to the different initial chemical composition of the two forages. This is because DDM, DMI, DCP and RFV were obtained based on chemical index measurements.
The number of LAB in sugarcane tops and corn stover (4.86 and 4.93 log10 CFU/g FM) in the present study is higher than that in other plants, such as alfalfa and Leymus chinesis [25,26]. This suggests that the two forages in this study may be easier to ensile. Harrison et al. [27] showed that inoculation of forage with different doses (log5 CFU/g, log6 CFU/g) of LAB led to an increase in the quality of forage silage with the increase in the amount of LAB added. Furthermore, Chen et al. [2] concluded that the higher the dose of epiphytic lactic acid bacteria, the better the silage quality will be. This may be due to the fact that more epiphytic LAB produced more organic acids to promote forage acidification during the early silage period, leading to a rapid entry into the anaerobic fermentation period. The NDF, ADF and HC of sugarcane tops at the end of ensiling were significantly higher than those of corn stover. This was similar to the data obtained during the previous harvest. A decrease in the WSC content of ensiled silage seems to be inevitable. LAB can utilize the conversion of one molecule of glucose into two molecules of lactic acid, resulting in a decrease in pH [5]. Significant differences in pH but not in WSC content were observed between the two silages in this study, likely because LAB in the two forages produced different metabolites, such as lactic acid, acetic acid and ethanol, by utilizing WSC. Fungal growth is inhibited by short-chain fatty acids in silage and acid molecules enter fungal cells by passive diffusion, releasing H+ ions to lower intracellular pH and killing certain cells [27]. This explains the decrease in the number of fungi after silage.

4.2. Fermentation Characteristics of Sugarcane Top and Corn Stover Silage

An important feature of silage is the conversion of carbohydrates into organic acids by LAB that predominantly uses the monosaccharides and some disaccharides [28]. The significantly higher lactic acid content in corn stover silage than in sugarcane top silage may explain the pH difference between them. Previous studies have shown that lactic acid produced by LAB is the most concentrated acid during silage and contributes the most to pH reduction during fermentation. This is due to the chemical properties of lactic acid (pKa of 3.86), which is more acidic than other major acids, such as acetic acid (pKa of 4.75) and propionic acid (pKa of 4.87) [4]. In general, the acetic acid content in silage is significantly higher than that of propionic acid, a phenomenon that results from the metabolism of hetero-fermentative LAB [28]. The acetic acid content in corn stover silage was higher than that of sugarcane top silage in this study and propionic acid was not detected in corn stover silage. This may have been caused by the low pH of corn stover silage (less than 4.8), as bacteria for propionic acid in silage are less tolerant to a pH lower than 4.8 and, thus, may have been inhibited [29,30].

4.3. Fermentation Characteristics and Microbe Count in Sugarcane Top and Corn Stover Silage Under Different Aerobic Exposure Times

Silage is inherently unstable when exposed to air. In aerobically deteriorating silage, the temperature is higher than the ambient temperature due to acid oxidation and conversion of WSC to CO2 and H2O by microorganisms. During this period, microorganism activity and acid content undergo drastic changes [31,32]. In the present study, the lactic acid content in sugarcane top and corn stover silage decreased continuously with the duration of aerobic exposure. Based on the WSC and lactic acid content in the two silages in this study and the results of previous studies, it is likely that part of the lactic acid during the aerobic exposure period is utilized by the required yeasts, partially undergoing dissociation. The acetic acid content in corn stover silage decreased in the same trend as lactic acid. However, the acetic acid content of sugarcane tops did not change significantly over time, which may favor the maintenance of aerobic exposure of sugarcane top silage. It can be concluded that the aerobic exposure of sugarcane top silage may be superior to that of corn stover silage. In addition, the NH−3N content of both silages did not show a significant decrease, which is in agreement with previous research [7]. The reason for this may be the relatively limited role of clostridial fermentation or amino acid deamination activity of endogenous plant proteolytic enzymes [4].

4.4. Bacterial Taxa Structure of Sugarcane Top and Corn Stover Silage

Fermentation during ensiling is mainly driven by microbial growth and metabolism and the use of sequencing technology can help to explore the mechanisms underlying silage fermentation. Species richness (Shannon, Simpson) of sugarcane tops and corn stover differed significantly between periods. Species diversity was significantly lower in fresh sugarcane tops than in fresh corn stover. This may be due to differences in the microorganisms in the environment and also differences in plant species [33,34]. The main source of nutrients for epiphytic microorganisms is plant secretions and the relationship between the host and epiphytic microorganisms is mostly symbiotic [35].
Enterobacter was detected in fresh sugarcane tops and fresh corn stover. Enterobacter are non-spore-forming, facultative anaerobes that ferment glucose to a mixture of acids, resulting in energy and DM losses. Weissella was the LAB with the highest relative abundance in fresh sugarcane tops and fresh corn stover. Weissella is a common LAB species in the ensiled plant mass and promotes a rapid drop in pH during the early (aerobic) ensiling period [36]. The abundant presence of Weissella may promote rapid acidification of sugarcane tops and corn stover during ensiling, thus safeguarding ensiling quality. However, the presence of large amounts of heterofermentative LAB may also lead to fermentation anomalies during ensiling, e.g., a more favorable production of acetic and butyric acid [7]. The presence of large amounts of Weissella in both fresh forages may have a lasting effect on the forage until the end of ensiling.
Clostridium plays a role in silage as a butyric acid-producing bacterium, and the production of large amounts of butyric acid leads to a decreased lactic acid content [37]. A certain relative abundance of Clostridium was detected in sugarcane top silage in this study and its presence explained the higher butyric acid content in sugarcane top silage compared to corn stover silage [37,38]. In addition, we hypothesized that certain strains of Clostridium in fresh sugarcane tops would have a strong ability to utilize lactic acid for growth [38]. This explains why fresh sugarcane tops contained a small amount of Clostridium, whereas there was a large amount of Clostridium after silage and during the aerobic exposure phase.
Lactobacillus, Lactococcus, Pediococcus and Sporolactobacillus, which are common LAB associated with plants [34], were also found in fresh sugarcane tops and corn stover. Of these, the number of Pediococcus in sugarcane tops was higher than that in corn stover. Due to the higher lactic acid production capacity of Pediococcus, it could occupy the dominant ecological niche in the early stages of silage, promoting the reduction of pH and the growth of Lactobacillus. Thus, we hypothesized that the effect of Pediococcus on sugarcane tops might last until the end of ensiling or even during the period of aerobic exposure. The relative abundance of epiphytic Lactococcus was higher in corn stover than in sugarcane tops. However, Lactococcus is usually more active in the early stages of silage and its ecological niche is occupied by other LAB when the pH drops. The effect of Lactococcus on corn stover may only occur during the pre-silage period.
The microbial composition of silage plays a crucial role in the aerobic exposure of the silage. The bacterial composition of sugarcane top silage and corn stover silage in this study changed during the period of aerobic exposure. The growth of bacteria, yeasts and molds can be inhibited if the silage contains acetic, propionic and butyric acids [39]. The most drastic change in microorganisms occurred in corn stover silage at 12 days of aerobic exposure, which may be attributed to the higher contents of lactic acid and non-detectable propionic acid as significantly lower butyric acid content in corn stover silage than in sugarcane top silage. Typically, during aerobic exposure of silage, Paenibacillus proliferates, causing a huge decrease in acetic acid, which leads to aerobic deterioration of the silage [40]. In our study, the acetic acid content of corn stover silage showed a significant decreasing trend with increasing aerobic exposure time, which may explain the value added by Paenibacillus. The relative abundance of Paenibacillus in fresh corn stover was higher than that in sugarcane tops. Oxygen infusion might be the cause of the renewed huge value addition of Paenibacillus in corn stover silage during the period of aerobic exposure, further illustrating that epiphytic Paenibacillus affects the aerobic exposure of corn stover, even after experiencing anaerobic environmental changes during ensiling. Similar to Paenibacillus, Pediococcus may continue to act from the epiphytic stage until the aerobic exposure stage. The relative abundance of Pediococcus was significantly higher in sugarcane top silage than in corn stover silage during the aerobic exposure period. Pediococcus is an LAB that produces lactic acid to lower the pH in early fermentation and is replaced by Lactobacillus after decreasing the pH [41]. Despite the low pH environment during the fermentation period, Pediococcus still occupied a certain relative abundance in sugarcane tops. The large amount of Pediococcus present in sugarcane tops at the end of ensiling may be due to the presence of acid-resistant strains [42]. However, there is still a significant amount of Pediococcus in sugarcane top silage. This further suggests that the effect of epiphytic Pediococcus on forage may be persistent.
Lactobacillus is the most common LAB in silage and most are adapted to a wide range of carbohydrates and environments and are usually present during ensiling [2]. However, not all strains of Lactobacillus are homofermentative LAB. Some strains, such as Lactobacillus plantarum and Lactobacillus casei, are heterofermentative LAB that ferment pentose sugar to produce lactic and acetic acids [43]. This may be the main reason that a higher acetic acid content was detected in both forages after silages. The dominance of Lactobacillus in sugarcane top silage during periods of aerobic exposure is consistent with previous studies [8,14,44]. Lactobacillus may improve the aerobic exposure of silage [45]. Based on the results of the present study, the more stable acetic acid content in sugarcane tops during the aerobic exposure period may be due to Lactobacillus. However, Bradyrhizobium, a major producer of acetic acid, was a dominant bacterial genus found in corn stover silage and its presence may explain the higher content of acetic acid in corn stover silage compared to sugarcane top silage [46]. The stabilized acetic acid content further inhibited the value addition of bacteria, such as Paenibacillus.
Combining the fermentation characteristics with the bacterial taxa data, it was observed that sugarcane top silage may include a large number of heterogeneous fermenting lactic acid bacteria species. The enrichment of Sporolactobacillus in sugarcane top silage in the present study is consistent with previous studies and may be the main strain that provides lactic acid in sugarcane top silage [9]. Sporolactobacillus is a parthenogenetic anaerobe, a spore-producing Gram-positive bacterium that is usually found during silage and aerobic exposure [47]. This may explain why the lactic acid content of sugarcane top silage was lower than that of corn stover silage at all stages and why the acetic acid content of sugarcane tops was higher than that of corn stover silage during the aerobic exposure phase and did not decrease with time.

4.5. Fungal Taxa Structure of Sugarcane Top and Corn Stover Silage

Among the epiphytic microorganisms of forage, yeasts and filamentous fungi have always been the key microorganisms receiving attention in the field of silage because the continuous growth of common plant epiphytic fungi, such as Eurotium, Penicillium and Aspergillus, for example, leads to an increase in forage temperature, which in turn leads to malodorous fermentation of the forage. Penicillium is very common in sugarcane tops and roots and usually secretes a variety of cellulose-degrading enzymes that play a role in depolymerizing cell walls [48]. In addition, certain Penicillium strains have been implicated as undesirable fungi that contaminate silage to produce mycotoxins [49]. Paecilomyces and Candida were present in fresh sugarcane tops and fresh corn stover. Candida is a common genus of yeast found in sugarcane tops and corn stover [50]. Candida mainly parasitizes plants and insects; most strains utilize xylose and some utilize cellobiose [51]. Candida had a high relative abundance in sugarcane top and corn stover silage, especially corn stover silage, which agrees with results previously reported in corn silage [52]. Hooker et al. reported that 70 days of corn ensiling with a bacterial community dominated by Lactobacillus and a fungal community dominated by yeasts, such as Candida, resulted in good silage-fermentation quality [53]. Currently, there are mixed reports on the effects of Candida on silage quality. Entering the period of aerobic exposure, Candida, Paecilomyces and Penicillium dominated in sugarcane top silage. Candida and Paecilomyces were dominant in corn stover silage. These fungi utilize lactic acid as the substrate for growth metabolism. The more stable acetic acid content during aerobic exposure in sugarcane top silage may explain why Candida is less abundant in corn stover. Paecilomyces, Candida and Penicillium may be the main fungal genera affecting the aerobic exposure of sugarcane tops and corn stover [54,55]. In the future, it may be necessary to add large quantities of beneficial microorganisms or to add specific inhibitors of these fungi to remove them due to their role during aerobic exposure of silage.

5. Conclusions

The epiphytic microorganisms affect the silage quality and aerobic exposure of ensiled sugarcane top and corn stover. Epiphytic LAB may play a crucial role in the early acidification of silage. Pediococcus and Lactoococcus, characteristic epiphytic LAB, affected the silage quality of sugarcane tops and corn stover, respectively. Weissella and Lactobacillus in epiphytic microbiota were beneficial for silage quality. Paecilomyces, Candida and Penicillium were the main fungal genera affecting the aerobic exposure of sugarcane tops and corn stover. The corn stover silage was characterized by a high lactic acid content, which weakened its aerobic exposure. Paenibacillus also affected the aerobic exposure of corn stover silage. In the future, targeted inhibitors of undesirable silage microorganisms may be added to inhibit these microorganisms to ensure successful silage fermentation. In addition, beneficial microorganisms can be added to ensure successful silage fermentation.

Author Contributions

Methodology, formal analysis, visualization, writing-original draft preparation, Q.Y.; validation, methodology, software, Q.Y. and H.D.; investigation, formal analysis, N.Z. and C.Q.; methodology, visualization, Q.G., R.W., D.W., Y.T., Y.L. and X.G.; conceptualization, project administration, resources, data curation, supervision, funding acquisition, writing—review, and editing, C.Z. and B.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China [grant number 2022YFD1300602], National Natural Science Foundation of China [grant numbers 31860661 and 312360851], the Innovation Project of Guangxi Graduate Education [grant number YCBZ2023050], the Innovation Project of Guangxi Graduate Education [grant number YCBZ2024025].

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The sequence data reported in this study have been submitted to the NCBI Sequence Read Archive (SRA) database under the accession number PRJNA1168484.

Conflicts of Interest

All data generated or analyzed during this study are included in this published article. The authors declare no conflict of interest.

References

  1. Wang, S. Silage Preparation, Processing and Efficient Utilization. Agriculture 2025, 15, 128. [Google Scholar] [CrossRef]
  2. Chen, L.; Wang, Y.; Li, X.; MacAdam, J.W.; Zhang, Y. Interaction between plants and epiphytic lactic acid bacteria that affect plant silage fermentation. Front. Microbiol. 2023, 14, 1164904. [Google Scholar] [CrossRef] [PubMed]
  3. Yin, X.; Zhao, J.; Wang, S.; Dong, Z.; Li, J.; Shao, T. The effects of epiphytic microbiota and chemical composition of Italian ryegrass harvested at different growth stages on silage fermentation. J. Sci. Food Agric. 2023, 103, 1385–1393. [Google Scholar] [CrossRef] [PubMed]
  4. Kung Jr, L.; Shaver, R.D.; Grant, R.J.; Schmidt, R.J. Silage review: Interpretation of chemical, microbial, and organoleptic components of silages. J. Dairy Sci. 2018, 101, 4020–4033. [Google Scholar] [CrossRef]
  5. Guo, L.; Wang, Y.; Wang, X.; Li, X.; Xiong, Y.; Lin, Y.; Yang, F. Dynamic fermentation quality and bacterial community structure of paper mulberry silage from three regions of China. Chem. Biol. Technol. Agric. 2023, 10, 51. [Google Scholar] [CrossRef]
  6. Ali, N.; Wang, S.; Zhao, J.; Dong, Z.; Li, J.; Nazar, M.; Shao, T. Microbial diversity and fermentation profile of red clover silage inoculated with reconstituted indigenous and exogenous epiphytic microbiota. Bioresour. Technol. 2020, 314, 123606. [Google Scholar] [CrossRef]
  7. Zhang, L.; Zhou, X.; Gu, Q.; Liang, M.; Mu, S.; Zhou, B.; Zou, C. Analysis of the correlation between bacteria and fungi in sugarcane tops silage prior to and after aerobic exposure. Bioresour. Technol. 2019, 291, 121835. [Google Scholar] [CrossRef]
  8. FAO. World Food and Agriculture—Statistical Yearbook; FAO: Rome, Italy, 2024. [Google Scholar]
  9. Gu, Q.; Zhang, L.; Zhou, X.; Lin, B.; Zou, C. Effects of sugarcane variety and nitrogen application level on the quality and aerobic exposure of sugarcane tops silage. Front. Plant 2023, 14, 1148884. [Google Scholar] [CrossRef]
  10. Xie, H.; Peng, L.; Li, M.; Guo, Y.; Liang, X.; Peng, K.; Yang, C. Effects of mixed sugarcane tops and napiergrass silages on fermentative quality, nutritional value, and milk yield in water buffaloes. Anim. Sci. J. 2023, 94, e13824. [Google Scholar] [CrossRef]
  11. Nishino, N.; Touno, E. Ensiling characteristics and aerobic exposure of direct-cut and wilted grass silages inoculated with Lactobacillus casei or Lactobacillus buchneri. J. Sci. Food Agric. 2005, 85, 1882–1888. [Google Scholar] [CrossRef]
  12. Association of Official Analytical Chemists. Official Methods of Analysis, 15th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1990. [Google Scholar]
  13. Thiex, N.; Novotny, L.; Crawford, A. Determination of Ash in Animal Feed: AOAC Official Method 942.05 Revisited. J. AOAC Int. 2012, 95, 1392–1397. [Google Scholar] [CrossRef] [PubMed]
  14. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [PubMed]
  15. Yan, Q.; Lin, M.; Huang, Y.; Datsomor, O.; Wang, K.; Zhao, G. Effects of solid-state fermentation pretreatment with single or dual culture white rot fungi on white tea residue nutrients and in vitro rumen fermentation parameters. Fermentation 2022, 8, 557. [Google Scholar] [CrossRef]
  16. Ren, F.; He, R.; Zhou, X.; Gu, Q.; Xia, Z.; Liang, M.; Zou, C. Dynamic changes in fermentation profiles and bacterial community composition during sugarcane top silage fermentation: A preliminary study. Bioresour. Technol. 2019, 285, 121315. [Google Scholar] [CrossRef]
  17. Jeranyama, P.; Garcia, A.D. Understanding Relative Feed Value (RFV) and Relative Forage Quality (RFQ); SDSU: Brookings, SD, USA, 2004. [Google Scholar]
  18. McDonald, P.; Edwards, R.A.; Greenhalgh, J.F.; Morgan, C.A. Animal Nutrition, 5th ed.; Longman Scientific and Technical: New York, NY, USA; John Wiley and Sons: Hoboken, NJ, USA, 1995; p. 33. [Google Scholar]
  19. Bo, P.T.; Dong, Y.; Zhang, R.; Soe Htet, M.N.; Hai, J. Optimization of alfalfa-based mixed cropping with winter wheat and ryegrass in terms of forage yield and quality traits. Plants 2022, 11, 1752. [Google Scholar] [CrossRef]
  20. Zhao, N.; Hao, X.; Yin, M.; Li, C.; Wang, C.; Han, H. Influence of growth stages and additives on the fermentation quality and microbial profiles of whole-plant millet silage. Agriculture 2024, 14, 1323. [Google Scholar] [CrossRef]
  21. Hundal, J.S.; Sharma, A.; Pal, R.; Grewal, R.S. Harnessing the in vitro nutritional potential of different varieties of sugarcane tops silages enriched with molasses and bacterial inoculants as an unconventional feed resource. Sugar Tech 2020, 23, 923–932. [Google Scholar] [CrossRef]
  22. Li, J.; Wu, K.; Wu, J.; Yang, C.; Sun, B.; Deng, M.; Liu, D.; Li, Y.; Liu, G.; Guo, Y. Effects of Fresh Corn Stover to Corn Flour Ratio on Fermentation Quality and Bacterial Community of Mixed Silage. Fermentation 2024, 10, 654. [Google Scholar] [CrossRef]
  23. Du, Z.; Yamasaki, S.; Oya, T.; Nguluve, D.; Euridse, D.; Tinga, B.; Cai, Y. Microbial network and fermentation modulation of Napier grass and sugarcane top silage in southern Africa. Microbiol. Spectr. 2024, 12, e03032-23. [Google Scholar] [CrossRef]
  24. Bernardes, T.F.; Daniel, J.L.P.; Adesogan, A.T.; McAllister, T.A.; Drouin, P.; Nussio, L.G.; Cai, Y. Silage review: Unique challenges of silages made in hot and cold regions. J. Dairy Sci. 2018, 101, 4001–4019. [Google Scholar] [CrossRef]
  25. Wu, S.; Wang, C.; Chen, D.; Zhou, W.; Chen, X.; Wang, M.; Zhang, Q. Effects of pyroligneous acid as silage additive on fermentation quality and bacterial community structure of waste sugarcane tops. Chem. Biol. Technol. Agric. 2022, 9, 67. [Google Scholar] [CrossRef]
  26. Li, P.; Liao, C.; Yan, L.; Zhang, C.; Chen, L.; You, M.; Chen, C. Effects of small-scale silo types and additives on silage fermentation and bacterial community of high moisture alfalfa on the qinghai-tibetan plateau. Anim. Feed Sci. Technol. 2023, 299, 115594. [Google Scholar] [CrossRef]
  27. Harrison, J.H.; Soderlund, S.O.; Loney, K.A. Effect of inoculation rate of selected strains of lactic acid bacteria on fermentation and in vitro digestibility of grass-legume forage. J. Dairy Sci. 1989, 72, 2421–2426. [Google Scholar] [CrossRef] [PubMed]
  28. Wilkinson, J.M.; Davies, D.R. The aerobic exposure of silage: Key findings and recent developments. Grass Forage Sci. 2013, 68, 1–19. [Google Scholar] [CrossRef]
  29. Pahlow, G.; Muck, R.E.; Driehuis, F.; Elferink, S.J.O.; Spoelstra, S.F. Microbiology of ensiling. Silage Sci. Technol. 2003, 42, 31–93. [Google Scholar] [CrossRef]
  30. Wolthusen, E.; Weissbach, F.; Derno, M. Fermentation acid content and aerobic exposure of silages. In Proceedings of the an International Symposium on Production, Evaluation and Feeding of Silage, Rostock, Germany, 12–16 June 1989; pp. 123–132. [Google Scholar]
  31. Pahlow, G.; Honig, H. The role of microbial additives in the aerobic exposure of silage. In Workshop Proceedings of the 15th General Meeting European Grassland Federation, Wageningen, The Netherlands, 6–9 June 1994; Mannetje, L.T., Ed.; Netherlands Society for Grassland and Fodder Crops: Wageningen, The Netherlands, 1994; pp. 149–151. [Google Scholar]
  32. Merry, R.J.; Davies, D.R. Propionbacteria and their role in the biological control of aerobic spoilage in silage. Le Lait 1999, 79, 149–164. [Google Scholar] [CrossRef]
  33. Finkel, O.M.; Burch, A.Y.; Lindow, S.E.; Post, A.F.; Belkin, S. Geographical location determines the population structure in phyllosphere microbial communities of a salt-excreting desert tree. Appl. Environ. Microbiol. 2011, 77, 7647–7655. [Google Scholar] [CrossRef]
  34. Kim, M.; Singh, D.; Lai-Hoe, A.; Go, R.; Abdul Rahim, R.; An, A.; Adams, J.M. Distinctive phyllosphere bacterial communities in tropical trees. Microb. Ecol. 2012, 63, 674–681. [Google Scholar] [CrossRef]
  35. Huang, S.; Zha, X.; Fu, G. Affecting factors of plant phyllosphere microbial community and their responses to climatic warming—A Review. Plants 2023, 12, 2891. [Google Scholar] [CrossRef] [PubMed]
  36. Cai, Y.; Benno, Y.; Ogawa, M.; Ohmomo, S.; Kumai, S.; Nakase, T. Influence of Lactobacillus spp. from an inoculant and of Weissella and Leuconostoc spp. from forage crops on silage fermentation. Appl. Environ. Microbiol. 1998, 64, 2982–2987. [Google Scholar] [CrossRef]
  37. Dos Santos Vieira, C.F.; Codogno, M.C.; Maugeri Filho, F.; Maciel Filho, R.; Mariano, A.P. Sugarcane bagasse hydrolysates as feedstock to produce the isopropanol-butanol-ethanol fuel mixture: Effect of lactic acid derived from microbial contamination on Clostridium beijerinckii DSM 6423. Bioresour. Technol. 2021, 319, 124140. [Google Scholar] [CrossRef]
  38. Li, R.; Jiang, D.; Zheng, M.; Tian, P.; Zheng, M.; Xu, C. Microbial community dynamics during alfalfa silage with or without clostridial fermentation. Sci. Rep. 2020, 10, 17782. [Google Scholar] [CrossRef] [PubMed]
  39. Pérez-Rangel, M.; Barboza-Corona, J.E.; Navarro-Díaz, M.; Escalante, A.E.; Valdez-Vazquez, I. The duo Clostridium and Lactobacillus linked to hydrogen production from a lignocellulosic substrate. Water Sci. Technol. 2021, 83, 3033–3040. [Google Scholar] [CrossRef]
  40. Liu, Q.H.; Shao, T.; Zhang, J.G. Determination of aerobic deterioration of corn stover silage caused by aerobic bacteria. Anim. Feed Sci. Technol. 2013, 183, 124–131. [Google Scholar] [CrossRef]
  41. Yin, X.; Tian, J.; Zhang, J. Effects of re-ensiling on the fermentation quality and microbial community of napier grass (Pennisetum purpureum) silage. J. Sci. Food Agric. 2021, 101, 5028–5037. [Google Scholar] [CrossRef]
  42. Saarisalo, E.; Skyttä, E.; Haikara, A.; Jalava, T.; Jaakkola, S. Screening and selection of lactic acid bacteria strains suitable for ensiling grass. J. Appl. Microbiol. 2007, 102, 327–336. [Google Scholar] [CrossRef]
  43. Zhang, J.G.; Cai, Y.; Kobayashi, R.; Kumai, S. Characteristics of lactic acid bacteria isolated from forage crops and their effects on silage fermentation. J. Sci. Food Agric. 2000, 80, 1455–1460. [Google Scholar] [CrossRef]
  44. Wang, M.; Yu, Z.; Wu, Z.; Hannaway, D.B. Effect of Lactobacillus plantarum ‘KR107070’and a propionic acid-based preservative on the fermentation characteristics, nutritive value and aerobic exposure of alfalfa-corn mixed silage ensiled with four ratios. Grassl. Sci. 2018, 64, 51–60. [Google Scholar] [CrossRef]
  45. Li, M.; Zi, X.; Sun, R.; Ou, W.; Chen, S.; Hou, G.; Zhou, H. Co-ensiling whole-plant cassava with corn stover for excellent silage production: Fermentation characteristics, bacterial community, function profile, and microbial ecological network features. Agronomy 2024, 14, 501. [Google Scholar] [CrossRef]
  46. Carvalho, B.F.; Ávila, C.L.S.; Miguel, M.G.C.P.; Pinto, J.C.; Santos, M.C.; Schwan, R.F. Aerobic exposure of sugar-cane silage inoculated with tropical strains of lactic acid bacteria. Grass Forage Sci. 2015, 70, 308–323. [Google Scholar] [CrossRef]
  47. Guan, H.; Yan, Y.; Li, X.; Li, X.; Shuai, Y.; Feng, G.; Zhang, X. Microbial communities and natural fermentation of corn silages prepared with farm bunker-silo in Southwest China. Bioresour. Technol. 2018, 265, 282–290. [Google Scholar] [CrossRef] [PubMed]
  48. Hu, Z.; Chang, J.; Yu, J.; Li, S.; Niu, H. Diversity of bacterial community during ensiling and subsequent exposure to air in whole-plant maize silage. Asian-Australas. J. Anim. Sci. 2018, 31, 1464–1473. [Google Scholar] [CrossRef] [PubMed]
  49. Boonyuen, N.; Manoch, L.; Luangsa-ard, J.J.; Piasai, O.; Chamswarng, C.; Chuaseeharonnachai, C.; Sri-indrasutdhi, V. Decomposition of sugarcane bagasse with lignocellulose-derived thermotolerant and thermoresistant Penicillia and Aspergilli. Int. Biodeterior. Biodegrad. 2014, 92, 86–100. [Google Scholar] [CrossRef]
  50. Alonso, V.A.; Pereyra, C.M.; Keller, L.A.M.; Dalcero, A.M.; Rosa, C.A.R.; Chiacchiera, S.M.; Cavaglieri, L.R. Fungi and mycotoxins in silage: An overview. J. Appl. Microbiol. 2013, 115, 637–643. [Google Scholar] [CrossRef]
  51. Rosa-Magri, M.M.; Tauk-Tornisielo, S.M.; Ceccato-Antonini, S.R. Bioprospection of yeasts as biocontrol agents against phytopathogenic molds. Braz. Arch. Biol. Technol. 2011, 54, 1–5. [Google Scholar] [CrossRef]
  52. Schauer, F.; Hanschke, R. Zur Taxonomie und Ökologie der Gattung Candida: Taxonomy and ecology of the genus Candida. Mycoses 1999, 42 (Suppl. 1), 12–21. [Google Scholar] [CrossRef]
  53. Bai, C.; Wang, C.; Sun, L.; Xu, H.; Jiang, Y.; Na, N.; Xue, Y. Dynamics of bacterial and fungal communities and metabolites during aerobic exposure in whole-plant corn silages with two different moisture levels. Front. Microbiol. 2021, 12, 663895. [Google Scholar] [CrossRef]
  54. Hooker, K.; Forwood, D.L.; Caro, E.; Huo, Y.; Holman, D.B.; Chaves, A.V.; Meale, S.J. Microbial characterization and fermentative characteristics of crop maize ensiled with unsalable vegetables. Sci. Rep. 2019, 9, 13183. [Google Scholar] [CrossRef]
  55. Wang, T.; Teng, K.; Cao, Y.; Shi, W.; Xuan, Z.; Zhou, J.; Zhong, J. Effects of Lactobacillus hilgardii 60TS-2, with or without homofermentative Lactobacillus plantarum B90, on the aerobic exposure, fermentation quality and microbial community dynamics in sugarcane top silage. Bioresour. Technol. 2020, 312, 123600. [Google Scholar] [CrossRef]
Agriculture 15 00890 g001
Figure 1. Fermentation characteristics of sugarcane top and corn stover silage: (A) lactic acid content, (B) acetic acid content, (C) propionic acid content, (D) butyric acid content and (E) NH3-N content. ST, sugarcane tops; CS, corn stover; ‘**’ represent significant differences in the values for different forages at p < 0.01, according to an independent samples t-test. ND, not detected.
Figure 1. Fermentation characteristics of sugarcane top and corn stover silage: (A) lactic acid content, (B) acetic acid content, (C) propionic acid content, (D) butyric acid content and (E) NH3-N content. ST, sugarcane tops; CS, corn stover; ‘**’ represent significant differences in the values for different forages at p < 0.01, according to an independent samples t-test. ND, not detected.
Agriculture 15 00890 g001
Agriculture 15 00890 g002
Figure 2. Fermentation characteristics and microbe count in sugarcane top and corn stover silage under different aerobic exposure times. ST, sugarcane tops; CS, corn stover, aerobic exposure; (A) Lactic acid content; (B) Acetic acid content; (C) Propionic acid content; (D) Butyric acid content; (E) NH3-N content; (F) Number of lactic acid bacteria; (G) Number of yeast; (H) Number of Mold; (I) Number of Enterobacteria; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘*’ and ‘**’ indicate significant differences in the values for sugarcane tops under different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘*’ and ‘**’ indicate significant differences in the values for corn stover under different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. ND, not detected.
Figure 2. Fermentation characteristics and microbe count in sugarcane top and corn stover silage under different aerobic exposure times. ST, sugarcane tops; CS, corn stover, aerobic exposure; (A) Lactic acid content; (B) Acetic acid content; (C) Propionic acid content; (D) Butyric acid content; (E) NH3-N content; (F) Number of lactic acid bacteria; (G) Number of yeast; (H) Number of Mold; (I) Number of Enterobacteria; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘*’ and ‘**’ indicate significant differences in the values for sugarcane tops under different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘*’ and ‘**’ indicate significant differences in the values for corn stover under different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. ND, not detected.
Agriculture 15 00890 g002
Agriculture 15 00890 g003
Figure 3. Bacterial taxa structure of sugarcane tops and corn stover. (A) Genus-level bacterial alpha diversity in sugarcane top and corn stover silage during different processing periods. (Aa) operational taxonomic units; (Ab) Shannon index; (Ac) Simpson index; (Ad) Chao1 index; (B) Genus-level bacterial communities in sugarcane top and corn stover silage during different processing periods. (C) Genus-level lactic acid bacteria communities in sugarcane top and corn stover silage during different processing periods. (Ca) Relative abundance of lactobacillus; (Cb) Relative abundance of lactococcus; (Cc) Relative abundance of Weissella; (Cd) Relative abundance of Pediococcus; (Ce) Relative abundance of Sporolactobacillus; ST, sugarcane tops; CS, corn stover; FF, fresh forage; ES, ensiled forage; AE, aerobic exposure; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘**’ indicate significant differences in the values for sugarcane tops during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘**’ indicate significant differences in the values for corn stover during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively.
Figure 3. Bacterial taxa structure of sugarcane tops and corn stover. (A) Genus-level bacterial alpha diversity in sugarcane top and corn stover silage during different processing periods. (Aa) operational taxonomic units; (Ab) Shannon index; (Ac) Simpson index; (Ad) Chao1 index; (B) Genus-level bacterial communities in sugarcane top and corn stover silage during different processing periods. (C) Genus-level lactic acid bacteria communities in sugarcane top and corn stover silage during different processing periods. (Ca) Relative abundance of lactobacillus; (Cb) Relative abundance of lactococcus; (Cc) Relative abundance of Weissella; (Cd) Relative abundance of Pediococcus; (Ce) Relative abundance of Sporolactobacillus; ST, sugarcane tops; CS, corn stover; FF, fresh forage; ES, ensiled forage; AE, aerobic exposure; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘**’ indicate significant differences in the values for sugarcane tops during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘**’ indicate significant differences in the values for corn stover during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively.
Agriculture 15 00890 g003
Agriculture 15 00890 g004
Figure 4. Fungal taxa structure of sugarcane tops and corn stover. (A) Genus-level fungal alpha diversity in sugarcane top and corn stover silage during different processing periods. (Aa) operational taxonomic units; (Ab) Shannon index; (Ac) Simpson index; (Ad) Chao1 index; (B) Genus-level fungal communities in sugarcane top and corn stover silage during different processing periods. ST, sugarcane tops; CS, corn stover; FF, fresh forage; ES, end of ensiling; AE, aerobic exposure; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘*’ indicate significant differences in the values for sugarcane tops during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘**’ indicate significant differences in the values for corn stover during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively.
Figure 4. Fungal taxa structure of sugarcane tops and corn stover. (A) Genus-level fungal alpha diversity in sugarcane top and corn stover silage during different processing periods. (Aa) operational taxonomic units; (Ab) Shannon index; (Ac) Simpson index; (Ad) Chao1 index; (B) Genus-level fungal communities in sugarcane top and corn stover silage during different processing periods. ST, sugarcane tops; CS, corn stover; FF, fresh forage; ES, end of ensiling; AE, aerobic exposure; ‘*’ and ‘**’ represent significant differences in the values for different forages at p < 0.05 and p < 0.01, respectively. Red ‘*’ indicate significant differences in the values for sugarcane tops during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively. Blue ‘**’ indicate significant differences in the values for corn stover during different aerobic exposure periods at p < 0.05 and p < 0.01, respectively.
Agriculture 15 00890 g004
Table 1. Chemical composition of sugarcane tops and corn stover before and after silage.
Table 1. Chemical composition of sugarcane tops and corn stover before and after silage.
ItemsTreatmentp-Values
STCS
Chemical Composition of Fresh Samples
DM (g kg/FW)220.15 ± 12.75231.79 ± 15.850.58
NDF (g/kg DM)658.97 ± 17.45546.56 ± 14.36<0.01
ADF (g/kg DM)350.06 ± 4.50291.07 ± 12.76<0.01
HC (g/kg DM)308.92 ± 14.08255.49 ± 3.84<0.01
CP (g/kg DM)64.82 ± 2.5277.85 ± 2.10<0.01
WSC (g/kg DM)227.09 ± 0.96225.29 ± 14.050.90
pH6.62 ± 0.006.97 ± 0.00<0.01
LAB (log10 CFU/g FM)4.86 ± 0.224.93 ± 0.390.87
Yeast (log10 CFU/g FM)5.55 ± 0.175.94 ± 0.400.05
Mold (log10 CFU/g FM)4.14 ± 0.384.37 ± 0.270.64
ET (log10 CFU/g FM)5.36 ± 0.316.12 ± 0.70<0.01
Chemical Composition of Samples After Silage
DM (g kg/FW)194.74 ± 9.41218.29 ± 10.600.12
NDF (g/kg DM)710.26 ± 7.36535.60 ± 12.02<0.01
ADF (g/kg DM)412.08 ± 7.03278.20 ± 4.68<0.01
HC (g/kg DM)298.18 ± 8.93257.40 ± 14.53<0.05
CP (g/kg DM)64.26 ± 1.0673.46 ± 3.58<0.05
WSC (g/kg DM)41.82 ± 4.1342.18 ± 4.240.97
pH4.46 ± 0.103.53 ± 0.03<0.01
LAB (log10 CFU/g FM)5.79 ± 0.075.91 ± 0.200.56
Yeast (log10 CFU/g FM)3.35 ± 0.444.25 ± 0.200.08
Mold (log10 CFU/g FM)2.70 ± 0.302.47 ± 0.190.53
ET (log10 CFU/g FM)2.96 ± 0.743.00 ± 0.850.96
ST, sugarcane tops; CS, corn stover; DM, dry matter; CP, crude protein; NDF, neutral detergent fiber assayed with a heat stable amylase and expressed inclusive of residual ash; ADF, acid detergent fiber expressed inclusive of residual ash; HC, hemicellulose; WSC, water-soluble carbohydrates; LAB, lactic acid bacteria; ET, enterobacteria; FW, Fresh weight; FM, Fresh matter.
Table 2. Evaluation of nutritional quality index of sugarcane tops and corn stover before and after silage.
Table 2. Evaluation of nutritional quality index of sugarcane tops and corn stover before and after silage.
ItemsTreatmentp-Values
STCS
Fresh Samples
DDM (%)61.63 ± 0.3566.23 ± 0.99<0.01
DMI (%/BW)1.83 ± 0.052.20 ± 0.06<0.01
DCP (%)2.29 ± 0.233.47 ± 0.19<0.01
RFV87.35 ± 2.62113.30 ± 4.49<0.01
Silage Samples
DDM (%)56.80 ± 0.5567.23 ± 0.36<0.01
DMI (%/BW)1.69 ± 0.022.25 ± 0.49<0.01
DCP (%)2.24 ± 0.103.08 ± 0.33<0.05
RFV74.47 ± 1.16117.17 ± 2.37<0.05
ST, sugarcane tops; CS, corn stover; DDM, digestible dry matter; DMI, dry matter intake; DCP, digestible crude protein; RFV, relative feed value.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yan, Q.; Ding, H.; Qin, C.; Gu, Q.; Gao, X.; Tan, Y.; Wei, D.; Li, Y.; Zhang, N.; Wang, R.; et al. Influence of Epiphytic Microorganisms on Silage Quality and Aerobic Exposure Characteristics of Grass Pastures. Agriculture 2025, 15, 890. https://doi.org/10.3390/agriculture15080890

AMA Style

Yan Q, Ding H, Qin C, Gu Q, Gao X, Tan Y, Wei D, Li Y, Zhang N, Wang R, et al. Influence of Epiphytic Microorganisms on Silage Quality and Aerobic Exposure Characteristics of Grass Pastures. Agriculture. 2025; 15(8):890. https://doi.org/10.3390/agriculture15080890

Chicago/Turabian Style

Yan, Qi, Hao Ding, Chenghuan Qin, Qichao Gu, Xin Gao, Yongqi Tan, Deshuang Wei, Yiqiang Li, Nanji Zhang, Ruizhanghui Wang, and et al. 2025. "Influence of Epiphytic Microorganisms on Silage Quality and Aerobic Exposure Characteristics of Grass Pastures" Agriculture 15, no. 8: 890. https://doi.org/10.3390/agriculture15080890

APA Style

Yan, Q., Ding, H., Qin, C., Gu, Q., Gao, X., Tan, Y., Wei, D., Li, Y., Zhang, N., Wang, R., Lin, B., & Zou, C. (2025). Influence of Epiphytic Microorganisms on Silage Quality and Aerobic Exposure Characteristics of Grass Pastures. Agriculture, 15(8), 890. https://doi.org/10.3390/agriculture15080890

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop