Next Article in Journal
Regenerative Agritourism: Embarking on an Evolutionary Path or Going Back to Basics?
Next Article in Special Issue
The Molecular Mechanism of Mycelial Incubation Time Effects on Primordium Formation of Pleurotus tuoliensis Through Transcriptome and Lipidomic Analyses
Previous Article in Journal
Antioxidant System of Scutellum During Germination and Early Growth of Maize Seedlings
Previous Article in Special Issue
Genetic Diversity and Genome-Wide Association Study of Pleurotus pulmonarius Germplasm
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Study of the Degradation and Utilization of Cellulose from Auricularia heimuer and the Gene Expression Level of Its Decomposition Enzyme

1
Engineering Research Centre of Chinese Ministry of Education for Edible and Medicinal Fungi, Jilin Agricultural University, Changchun 130118, China
2
Laboratory of the Genetic Breeding of Edible Mushroom, College of Horticulture, Jilin Agricultural University, Changchun 130118, China
3
Hangzhou Academy of Agricultural Sciences, Hangzhou 310024, China
*
Author to whom correspondence should be addressed.
Agriculture 2024, 14(11), 2027; https://doi.org/10.3390/agriculture14112027
Submission received: 16 October 2024 / Revised: 30 October 2024 / Accepted: 4 November 2024 / Published: 11 November 2024
(This article belongs to the Special Issue Genetics and Breeding of Edible Mushroom)

Abstract

:
Auricularia heimuer is a wood-rotting edible mushroom, and with the continuous development of the industry, the research on its grass-rotting cultivation is becoming more and more important. In this study, A. heimuer was cultivated using herbaceous substrate (reed) completely replacing the traditional woody substrate (oak), and the correlation between the relative expression of cellulase gene, cellulase activity, cellulose degradation and yield of different strains of A. heimuer were studied by combining qRT-PCR technology at different growth stages. The results showed that the cellulose degradation were positively correlated with the yield of reed and sawdust substrate at two growth stages, and were positively correlated with three cellulase activities. The relative expression of four cellulase genes were positively correlated with enzyme activity. There were inter-strain differences in the expression of the enzyme genes, which were basically consistent with the trend of the enzyme activity of the strains; g5372 and g7270 were more actively expressed in the mycelium period, while g9664 and g10234 were more actively expressed in the fruiting period. The results of SEM showed that the mycelium of A15 and A125 were different in their ability to degrade and utilize lignocellulose in reed substrate. The parental hybridization test further verified that qRT-PCR could be used as a rapid method to evaluate the cellulose degradation ability of A. heimuer strains. Seven strains (A12, A15, A184, A224, Z6, Z12, and Z18) with high cellulose degradation ability were screened. This study provides a reference for further understanding the role of A. heimuer cellulase genes in the degradation and metabolism of cellulose and for breeding new varieties more suitable for herbaceous substrate cultivation.

1. Introduction

Auricularia heimuer [1] is an edible and medicinal fungus [2]. It is widely distributed naturally in China and has a long history of cultivation. It has now become the second largest edible mushroom species in China [3]. A. heimuer is a typical wood-rotting edible mushroom, which mainly uses wood chips of broad-leaved trees as the substrate for cultivation and domestication, and obtains nutrients and energy by decomgenerating lignin, cellulose and hemicellulose in wood residues in the form of secreting extracellular enzymes. However, with the gradual halt of natural forests, sawdust resources are increasingly tight, and prices are rising, which has become a major factor limiting the development of the heimuer industry [4]. At the same time, wetland lakes have a large amount of reed straw (herbaceous substrate) that is not well utilized and discarded, and it has a high cellulose content and a low lignin content, which makes it a good substrate for wood-rotting edible-mushroom grass-rotting cultivation research [5,6].
Cellulase is one of the many extracellular enzymes secreted by edible mushrooms. According to their catalytic methods, which can be divided into Endo-β-1, 4-glucanase (EC, 3.2.1.4), Exo-β-1, 4-glucanase (EC, 3.2.1.91) and β-1, 4-glucosidase (EC, 3.2.1.21) [7,8]. They are mixtures of glycoside hydrolases (GHs) that completely degrade cellulose into glucose [9]. Specifically, there are three main types of enzymes, carboxymethyl cellulase (CMCase), filter-paper cellulase (FPase) and β-glucosidase (β-Gase), and the three enzymes work together to complete the decomposition of cellulose components in the substrate [10,11]. Therefore, the level of enzyme activity will directly affect the growth of mycelia and the formation and development of fruiting bodies, and will also have a huge impact on yield [12]. Cellulase mainly degrades cellulose in a cultivated substrate, and its activity is closely related to the growth and development of edible mushrooms [13]. Fan et al. [14] found that different carbon and nitrogen sources would lead to changes in extracellular enzyme activity of Hericium erinaceus, and there was a positive correlation between extracellular enzyme activity and mycelial dry weight. In general, the higher the activity of extracellular enzymes in mycelia, the stronger the ability of substrate degradation [15], the faster the growth rate of edible mushroom mycelium [16], and the higher its yield [17]. The extracellular enzyme activity secreted by the mycelia of edible mushrooms is closely related to the regulation of enzyme genes [18,19], and there is also a strong internal correlation between the expression level of enzyme genes, enzyme activity and substrate degradation ability [20]. Therefore, it is necessary to study the relative expression of enzyme genes by means of real-time quantitative PCR. [18,21,22]. Real-time quantitative PCR can theoretically be used to evaluate the relative expression of the cellulase gene of the A. heimuer strain growing on reed substrate, but no relevant studies have been reported. However, Bai et al. [23] studied the relationship between Morchella esculenta antioxidant enzymes and their gene expression at different temperatures by using real-time quantitative PCR technology. Mao [24] studied the expression levels of 11 laccase-coding genes (lac1-11) in Volvariella Volvacea at different developmental stages of fruiting bodies by using real-time quantitative PCR. Using qRT-PCR, Zhang [25] showed that 18S rRNA, β-TUB, EF1-a and 28S rRNA could be used as internal reference genes of different strains of A. heimuer. Xiang et al. [26] found in the screening and analysis of Lentinula edodes genome data that RpI4 was the most stable internal reference gene in all experimental conditions. These studies provided a theoretical basis for real-time quantitative PCR to evaluate the relative expression of the cellulase gene of the A. heimuer strain growing in reed substrate. Therefore, it is possible to study the expression level of the cellulase gene and the relationship between the cellulase activity of A. heimuer grown on different substrates, by qRT-PCR [18,27,28].
Based on the scientific research concept of “Research on the cultivation of wood-rotting edible-mushroom grass-rotting” proposed by the team [4,5], the laboratory has used corn cob and reed to partially or completely replace wood chips in the cultivation experiment of A. heimuer in the early stage, and studied the influence of different proportions of cultivation substrate on the degradation rate of extracellular enzymes and lignocellulose of the A. heimuer strain [29,30]. However, there were few studies on the relative expression of the cellulase gene in the A. heimuer strain and its correlation with cellulase activity and cellulose degradation in different cultivation substrates. Through previous laboratory studies on the A. heimuer genome [31] and transcriptome [32], key genes controlling cellulose degradation have been identified, and the ability of strains to degrade cellulose in the substrate could be evaluated by gene expression; it could lay a foundation for the rapid auxiliary breeding of the A. heimuer strain more suitable for herbaceous substrate (agricultural waste such as reed straw and corn cob) cultivation in the future.

2. Materials and Methods

2.1. Materials

2.1.1. Test Strain

The 28 A. heimuer strains used in this experiment were provided by the A. heimuer Variety Improvement Post of the National Modern Edible Mushroom Industry technical system. It is now preserved in the College of Horticulture, Jilin Agricultural University, including cultivated strains and wild strains. Specific information is shown in Table 1.

2.1.2. Sample Preparation and Preservation

The 28 strains of A. heimuer were activated with PDA plates, then transferred to a new PDA plate culture. The tested strains were inoculated on a glass plate containing reed and wood chips, incubated at 25 °C for 25 days, and the mycelium was collected and stored at −80 °C. At the same time, fruiting bodies were obtained by a fruiting test, stored at −80 °C, and used to study the relative expression of cellulase gene in different strains at different stages. During the fruiting experiment, the tested strains were stored at −80 °C at the full-bag stage of the mycelium and fruiting-body maturity stage for the determination of cellulose content in cultivation materials and the preparation of crude enzyme solution. The medium used in the experiment was the following: the formula of PDA solid medium was peeled potato 200 g (boiled filter juice), glucose 20 g, AGAR powder 10 g, and distilled water 1.0 L, pH natural. The formula of sodium carboxymethyl cellulose Congo red culture medium was KCl 0.5 g, MgSO4·7H2O 0.5 g, KH2PO4 1.0 g, (NH4)2SO4 2.0 g, sodium carboxymethyl cellulose 10 g, AGAR 10 g, and distilled water 1.0 L, pH natural [33]. The formula of the reed culture medium was reed 88%, wheat bran 10%, lime 1%, gypsum 1%, and water content about 55%. The formula of the wood chips culture medium (CK) was reed 88%, wheat bran 10%, lime 1%, gypsum 1%, and water content about 55%.

2.2. Methods

2.2.1. Preliminary Screening of Cellulase Production Capacity of A. heimuer Strain

The 5 mm diameter strains were cut with a hole punch at the edge of the activated plate colony and inoculated in the center of sodium carboxymethyl cellulose Congo red medium. After 7 days of constant temperature culture at 25 °C, the hydrolytic ring D and colony diameter d were measured by staining with 1 g/L Congo red for 30 min and decolorization with 1 mol/L NaCl for 30 min, and the D/d value was calculated. The ratio of the two was used as an index to measure the cellulose degradation ability of the strain [33,34]. Three repetitions were set for each process.

2.2.2. A. heimuer Cellulase Gene Mining and Primer Design

According to the previous whole-genome sequencing analysis of A. heimuer and transcriptome sequencing analysis at different stages based on different substrate conditions [32], enrichment analysis and screening of differential genes involved in cellulose metabolic pathways were performed, and combined with annotation of the gene database of carbohydrate-active enzymes (CAZymes), and 5 key coding genes related to cellulose degradation were identified. They were g5372, g6295, g7270, g9664 and g10234 [35]. Combined with NCBI-BLAST-blastx gene information annotation, it was confirmed that g5372 and g9664 were related to encoding cellobiose hydrolase (exo-glucanase), g7270 was related to encoding endo-glucanase, and g10234 was related to encoding β-glucosidase [36]. In combination with the whole-genome annotation results of A. heimuer and the sequences of 5 cellulase genes, NCBI-BLAST-Primer was used for primer design, requiring the amplified product to span introns, be 80–300 bp long, and contain 45–55% GC % [37]. At the same time, EF1-a was selected as the internal reference gene according to previous laboratory results [25,26].

2.2.3. Determination of Relative Expression of A. heimuer Cellulase Gene

Extraction of Total RNA and Synthesis of cDNA

The frozen sample was ground into a fine powder in liquid nitrogen, and 0.1000 g sample was extracted by the Trizol method [38]. RNA purity and concentration were measured using a nano-spectrophotometer, and RNA integrity was detected by agarose gel electrophoresis. Total RNA was reverse-transcribed into cDNA using the TRNA AT-341 reverse transcription kit (Transgen Biotech, Beijing, China).

Real-Time Quantitative PCR

Real-time amplification response detection in 96-well plates was performed using SYBR Green. The reaction system consisted of 1 μL cDNA template, 0.4 μL amplification primers, 0.4 μL passive Reference Dye (50×, 10 μL Top Green qPCR supermix and 7.8 μL RNase-free water. The final volume was 20 μL. Reaction conditions were predenaturation at 95 °C for 2 min, denaturation at 95 °C for 15 s, annealing at 60 °C for 20 s, and extension at 72 °C for 26 s, a total of 40 cycles. A melt curve analysis was generated by heating the amplicon from 60 °C to 95 °C to confirm that each reaction produced a single product. Thermal cycling was performed to collect fluorescence data.

Calculation of Gene Relative Expression

Ct values of cellulolytic enzyme genes were obtained by qRT-PCR, and the relative expression levels of genes on two substrates in the mycelium stage and fruiting-body mature stage were calculated by the formula F = 2−ΔΔCt by comparing Ct values. In formula F = 2−ΔΔCt, ΔΔCt = (Ct value of the target gene in the test group − Ct value of the reference gene in the test group) − (Ct value of the target gene in the control group − Ct value of the reference gene in the control group). The control group in this formula is the following: the strain with the lowest relative expression of each enzyme gene calculated by using sawdust substrate as the control in the previous experiment was used as the control group to calculate the relative expression of each enzyme gene between different strains. The replication of the study was a technical replication.

2.2.4. Cultivation Seed Preparation

This was carried out using a 17 × 33 cm polypropylene folding bag as an edible-mushroom bag, and each bag contained about 1 kg of wet material. The bags were sterilized at 121 °C for 4 h in an autoclave. After the edible-mushroom bags were sterilized out of the pot, they were transferred to the cooling room to cool down to room temperature, and the original species (secondary species) were used for inoculation. The two substrate formulations for each strain were ten bags of replicates.

2.2.5. Fruiting Test

After the bag was full of mycelium, the A. heimuer mechanical piercing machine was used for piercing after 6–7 days of post-ripening, and the method of piercing the ear through small holes was adopted [39]. After the mycelia at the perforated area recovered and turned white 3–5 days later, the bags were transferred to the mushroom-extraction chamber for the ear-extraction test. Water spray 3–5 times a day, ventilation 2–3 times a day, and see dry and wet dry and wet alternately, kept the humidity of the mushroom greenhouse about 85–95%. When the ear piece was fully unfolded, the edge was slightly shrunken and rolled in, and the villi on the back of the ear piece were erect, which indicated that the fruiting body of A. heimuer was mature, and it could be harvested.
Yield determination: the actual yield of each edible-mushroom bag was converted to the mass of dry ear produced per 100 kg of dry material (kg).

2.2.6. Hybrid Breeding

General Steps of Hybrid Breeding

Select suitable parents ➡ Monospore isolation ➡ Hybrid pairing ➡ Microscopic examination ➡ Tube propagation ➡ Primary screening ➡ Rescreening ➡ Fruiting test.

Monospore Isolation

Plate dilution separation method: the collected spores were picked up with a vaccination needle on a super-clean workbench and loaded into a pre-prepared plastic plate containing 5 mL sterile water, and thoroughly mixed to obtain the original spore suspension. A pipette gun to was used absorb 100 μL spore suspension and to transfer it into a small test tube filled with 900 μL sterile water; this was thoroughly mixed to obtain a spore suspension diluted 10−2 times, and dilution was continued until 10−5 times the spore suspension was obtained. A pipette gun was used to take about 100 μL of the spore diluent from 10−5, 10−4, 10−3, and 10−2 dilution times, these were transferred to the new PDA-plate-culture medium with a spore diluent coated evenly, and were then put in a constant temperature incubator at 25 °C. The spore germination on the plate was checked at regular intervals, and the small colonies of single spores were transferred to the new PDA-plate-culture medium for culture and to wait for hybridization.

Monospore Hybridization

One piece of the mononuclear mycelia from each of the two parental spores to be hybridized were picked up by inoculation needle and placed at both ends of fresh PDA solid medium, with a distance of about 1.5–2 cm between the two, and cultured in a constant-temperature incubator at 25 °C. When the mononuclear mycelia of the two parents came into contact, they were transferred to a new PDA medium with a cover slide inserted at an angle for further culture. After the mycelia climbed on the slide, the mycelia were stained with a drop of 1% Congo red solution and a drop of 10% KOH solution after mixing, and they were left for 30 min before the microscopic examination (Objective lens 40×, eyepiece 10× began. If the mycelium had a lock-like joint structure observed during microscopic examination, it was a successfully hybridized dikaryotic mycelium, which could be transferred to a new PDA plate medium for culture and use [40].

2.2.7. Determination of A. heimuer Cellulase Activity and Degradation Amount

Determination of Cellulase Activity

Preparation of crude enzyme solution: samples were taken at the full-bag period of mycelium and the first fruiting-body collection period, and 5 g fresh samples were placed in a small beaker containing 45 mL distilled water at a distance of 3–5 cm below the feed surface. The samples were extracted on a shaker at 15 °C for 4 h and centrifuged at 4000 r/min for 10 min. The supernatant, i.e., crude enzyme solution, was stored in a refrigerator at 4 °C for later use [29].
Carboxymethyl cellulase enzyme activity determination: 0.6 mL sodium 0.5% carboxymethyl cellulose solution (prepared with a PH 4.6, 0.1 mol /L acetate buffer) was added into a 10 mL tube, then 0.2 mL enzyme solution was added. This was mixed well, and held in a water bath at 50 °C for 30 min. A total of 0.6 mL DNS reagent was added immediately after removal, and was boiled for 5 min. This was removed and allowed to stand, with distilled water was fixed to 10 mL. The OD520 value was measured by an enzymoleter, the inactivated enzyme solution was boiled as a blank control (only 1–2 times), the glucose standard curve was substituted for calculation, with 3 replicates for each group [29,41].
Filter-paper cellulase-enzyme activity determination: 0.25 mL of enzyme liquid and 0.75 mL of 0.05 mol /L of citric acid buffer at PH 4.6 were added to each of the four numbered test tubes, and they were mixed them well and preheated in a 50 °C water bath for 5–10 min. Then 25 mg of filter-paper strip was added to each tube, and they were held in a 50 °C water bath for 1 h. A total of 0.75 mL DNS reagent was immediately added to stop the enzyme reaction, and was shaken well, boiling water bath for 5 min, and then taken out and fixed to 10 mL. The OD540 value was measured by enzymoleter, and the inactivated enzyme solution was boiled as a blank control (only 1–2 times); and the glucose standard curve was substituted for calculation, with 3 replicates for each group [42,43].
β-glucosidase enzyme activity determination: 0.75 mL of 0.5% salicylate citrate buffer was added to each of the four numbered test tubes, and 0.75 mL DNS reagent was added to test tube No. 1 to deactivate the enzyme activity as a blank control (only 1–2 times). Four test tubes were preheated in a 50 °C water bath for 5–10 min, then 0.25 mL of enzyme solution was added to each, and they were kept warm in a 50 °C water bath for 30 min. Immediately after removal, 0.75 mL of DNS reagent was added to each of the test tubes No. 2, No. 3 and No. 4, to terminate the enzyme reaction. This was mixed well, and the color was developed in a boiling water bath for 5 min, and then taken out and fixed to 10 mL. The OD540 value was measured by an enzyme-labeled instrument and calculated by glucose standard curve. The amount of enzyme required to produce 1 umol glucose per hour from the substrate was defined as one unit of enzyme activity (U) [44,45].

Cellulose Content Determination

Samples of the tested strains were taken from the edible-mushroom bag at the mycelium full-bag period and the fruiting-body mature period, and the fresh cultivated materials were mixed and put into the oven to dry, and each of them was taken three times that is, three times of repetition, and the unused cultivated materials of reed and wood chips were used as the control group. The cellulose content of the cultivated material was determined by the cellulose (CLL) content-detection kit method of Beijing Box Sheng-gong Technology Co., Ltd., Beijing, China.

2.2.8. SEM Observation

Strains A15 and A125, which had the highest and lowest yield on the reed substrate, were selected as the experimental group, and the reed cultivation material at the maturation stage of its fruiting body was sampled and observed by scanning electron microscope, while the wet reed material with unused mycelium was selected as the control group. The samples to be tested were stored at 4 °C in the refrigerator. The scanning electron microscopy was completed by Wuhan Xavier Biotechnology Co., Ltd., Wuhan, China.

2.2.9. Statistical Analysis

The experimental results were expressed as mean ± standard deviation (n ≥ 3). SPSS 26.0 and Origin-Pro 2022 software were used for statistical analysis and mapping. SPSS 26.0 was used to conduct one-way ANOVA and Duncan’s multiple range test to determine the significant differences between samples, SPSS 26.0 and Origin-Pro 2022 were used to analyze the correlation between the data, and the correlation results were represented by Pearson correlation coefficient (p < 0.05, p < 0.01).

3. Results

3.1. Analysis Preliminary Screening Results of Cellulase Production Capacity of A. heimuer Strain

According to the characteristics of cellulose use by extracellular enzymes secreted by mycelium, the strains were screened by the Congo red plate method of carboxymethyl cellulose sodium medium [34,46,47]. Under the same conditions, 28 A. heimuer test strains were cultured in plates, and the growth rate was measured by colony diameter(d). The larger the diameter, the faster the growth rate of the strain on the plates. Carboxymethyl cellulose was degraded in areas where cellulase was produced, so that it could not be stained by Congo red, that is, a transparent ring(D) was formed, and the width of the transparent ring indicated the enzyme-producing capacity of different strains. As shown in Table 2, the colony diameters of 28 strains ranged from 0.78–3.10 cm, and D/d ranged from 0.77–1.62, with significant differences among strains. Strains with a colony diameter greater than 1.90 cm and a ratio greater than 0.80 were screened for subsequent tests [34]. By combining the two sets of data, 13 strains were obtained, accounting for about 46% of the total tested strains.

3.2. Screening and Analysis of Cellulase Gene Primers

First, the test strains were used for PCR amplification of the designed five cellulase gene primers, and the PCR products were analyzed by agarose gel electrophoresis. Finally, qualified primers of genes g5372, g7270, g9664 and g10234 were initially screened: the products were all single bands with non-specific amplification, indicating strong primer specificity (Figure 1A), and no qualified primer was screened for g6295. qRT-PCR was performed on the selected qualified primers using different strains and samples at different growth stages, and the melting curves obtained were all single melting peaks, which further verified the strong specificity of the primers (Figure 1B). The primer sequences of the four cellulase genes obtained by screening are shown in Table 3.

3.3. Analysis of Cellulose Degradation and Yield in Different Strains

3.3.1. Determination and Correlation Analysis of Cellulose Degradation and Yield in Different Strains

The correlation between the yield of fruit bodies and cellulose degradation in two growth stages (mycelium full- bag period and fruiting period) of 13 selected strains on the reed substrate and the sawdust substrate was analyzed. Results are as shown in Table 4: the yield of the strain on the reed substrate was positively correlated with the amount of cellulose degradation in the two growth stages, and the correlation coefficients were 0.387 and 0.506. The yield on the sawdust substrate was positively correlated with the degradation amount of cellulose in the two growth stages, and the correlation coefficients were 0.310 and 0.444. The degradation of cellulose in the reed substrate and the sawdust substrate at the full-bag period was positively correlated with the degradation of cellulose at the fruiting period, and the correlation coefficients were 0.532 and 0.610 (p < 0.05), respectively. The yield of each strain could reflect the degradation amount of cellulose well, to some extent, and vice versa. In general, the strain with higher yield had higher cellulose degradation.
The yields of the tested strains are shown in Table 5. There were significant differences in the yields of different strains on the reed substrate, and there were also significant differences between the reed substrate and the sawdust substrate. The reed-substrate yield was between 0.67 and 3.98 kg, and the sawdust-substrate yield was between 1.55 and 4.28 kg. There were no significant difference in the yield of strains A15, A134 and A184 in the two substrates. The yield of A15 in the reed substrate was the highest, and that of A224 in the sawdust substrate was the highest. The cellulose degradation capacity of different strains was further measured (Figure 2). There were differences in the ability of different strains to utilize the two substrates, and the cellulose degradation capacity of more than half of the strains in the reed substrate exceeded 40% at the fruiting-body maturity stage. The degradation of cellulose in A12 (58.35%), A15 (48.15%), and A496 (47.96%) was relatively high, and the degradation of cellulose in A12 and A496 was higher than that in the sawdust substrate. The adaptability of A12 and A496 to the reed substrate was relatively better, and the degradation of cellulose were basically consistent with the yield trend of each strain. The ability of different strains to degrade cellulose varied, but the overall trends were similar. The degradation of cellulose in the culture substrate gradually increased with the growth of mycelia, and reached the highest point after entering the reproductive stage, especially in the process of fruiting-body harvesting, which indicated that the degradation of cellulose provided abundant nutrients for the growth of A. heimuer.

3.3.2. Analysis of SEM Results

The reed-cultivation materials of strain A15 with the highest yield of reed substrate and strain A125 with the lowest yield were selected for the observation by scanning electron microscopy (SEM). The results showed, as shown in Figure 3, that the surface structure of the reed before mycelial degradation and utilization (Figure 3A1,A2) were compact and orderly, and the lignocellulose was intertwined to form a complete and dense structure. After degradation and utilization by extracellular enzymes secreted by mycelia, the surface structure of the reed became rough, the surface wax layer were destroyed, and numerous grooves have appeared; the wood fiber was cut, and the internal structure became loose and porous, destroying the original complex structure of the natural lignocellulose [33]. In addition, according to Figure 3B1,B2,C1,C2, compared with strain A15, which had the highest yield, although the reed substrate of A125 was also degraded and utilized by mycelium, it was more clearly seen that the surface of the reed substrate was not as thoroughly degraded as that of A15, and the reed was not fully degraded and utilized. It was proved that the two strains had different cellulose degradation ability, which could also explain the reason why the yield of A15 was significantly higher than that of A125.

3.4. Study on Cellulase Activity of Different Strains

3.4.1. Correlation Analysis of Cellulase Activity and Cellulose Degradation in Different Strains

The biodegradation of lignocellulose in the culture substrate requires the synergistic action of various extracellular enzymes, in which mycelia secretes cellulase to degrade cellulose in the substrate. In general, the activity of cellulase in strains directly determines the utilization of cellulose degradation. Therefore, the activity of 3 cellulases in 13 strains were measured, and the correlation with the degradation of cellulose in the reed substrate were analyzed. As shown in Table 6, the activities of three cellulases in the two growth stages were positively correlated with the amount of cellulose degradation. The correlation coefficients between CMCase enzyme activity and the amount of degradation were all significant or highly significant positive correlations, with the highest correlation coefficient of 0.820 (p < 0.01). All positive correlations were found between β-Gase enzyme activity and the amount of degradation, with the highest correlation coefficient of 0.538. The correlation coefficients between the FPase enzyme activity and the amount of degradation were all positive correlations, with some of them significant positive correlations, with the highest correlation coefficient of 0.734 (p < 0.01). In addition, the positive correlation between the three cellulase activities also confirmed that cellulose degradation was the result of their cooperation. Therefore, the high activity of CMCase, FPase and β-Gase enzymes was conducive to the degradation of cellulose in the reed substrate.

3.4.2. Analysis of Enzyme Activity of Carboxymethyl Cellulase (CMCase) in Different Strains

As shown in Figure 4, the enzyme activity of carboxymethyl cellulase at different periods and on different substrates was different among the strains. The enzyme activity was low in the full-bag period of mycelium and high in the fruiting period, which was consistent with the trend of degradation amount. In the full-bag period of mycelium, three strains (A14, A496, A596) showed no significant difference from the sawdust substrate, and five strains (A15, A125, A134, A224, A593) were highly significant higher than the sawdust substrate. At the fruiting period, five strains (A2, A125, A127, A134, A314) showed no significant difference from the sawdust substrate. Four strains (A12, A15, A184, A593) had relatively high enzyme activity in the reed substrate during the fruiting period, all of which exceeded 100 U/g. The CMCase enzyme activity of strains A12, A15, A184, A224 and A593 on the reed substrate was relatively high, and the enzyme activity of strains A15, A224 and A593 was significantly higher than that of the sawdust substrate in the mycelium period, while there was no significant difference between strains A2 and the sawdust substrate in the fruiting period. The enzyme activity of the A125, A127 and A134 strains was relatively low, and their degradation capacity and yield were also average.

3.4.3. Enzyme Activity Analysis of Filter-Paper Cellulase (FPase) from Different Strains

The filter-paper cellulase reflects the synergistic effect of exodextranase, endodextranase and β-glucosidase. As shown in Figure 5, at the full-bag period of mycelium, there were six strains (A12, A125, A127, A134, A224, and A593) that showed no significant difference from the sawdust substrate, one strain (A2) that was significantly higher than the sawdust substrate, and six strains (A14, A15, A184, A314, A496, and A596) that were highly significant higher than the sawdust substrate. At the fruiting period, there were five strains (A2, A134, A314, A593, and A596) with no significant difference from the sawdust substrate, and one strain (A12) with highly significant difference from the sawdust substrate. The activity of the reed substrate enzyme was relatively high in the five strains (A12, A15, A184, A224, and A593), all of which were over 150 U/g. Strains A12, A14, A15, A184, A224, and A593 had relatively high FPase enzyme activity in the two growth stages; from the perspective of FPase enzyme activity, they might be more suitable for growth in the reed substrate.

3.4.4. Analysis of β-Glucosidase (β-Gase) Activity in Different Strains

As shown in Figure 6, the β-glucosidase activity of different strains showed no significant difference between four strains (A2, A125, A127, and A596) and the sawdust substrate in the mycelium full-bag period, while two strains (A14 and A314) were significantly higher than that of the sawdust substrate; there were five strains (A15, A134, A184, A224, and A593) that were highly significant higher than the sawdust substrate. In the fruiting period, there were two strains (A12 and A184) with no significant difference from the sawdust substrate, and one strain (A2) with significant difference from the sawdust substrate. The activity of the reed substrate enzyme was relatively high in four strains (A12, A15, A184, and A224), all of which were over 400 U/g. In the two growth stages, strains A12, A15, A184, A224 and A593 had relatively high enzyme activity, while strains A125, A127, A134, A496 and A596 had relatively low enzyme activity. The regularity of β-Gase enzyme activity in the reed substrate was similar to that of CMCase and FPase. The higher the enzyme activity, the stronger the mycelia could degrade and utilize the reed substrate. Through the determination of the activity of three cellulases, it could be seen from the perspective of enzyme activity that the strains A2, A12, A15, A184, A224, A593, etc., were more suitable for growth on the reed substrate, and they could be referred as the next breeding objects for grass-rotting.

3.5. Study on the Expression Level of Cellulase Gene in Different Strains

3.5.1. Correlation Analysis of Cellulase Activity and Relative Expression of Enzyme Genes in Different Strains

A. heimuer mycelium secretes cellulase to degrade cellulose in the substrate, and the higher the enzyme activity, the higher the cellulose degradation amount. However, the activity of cellulase is usually regulated by cellulase genes, and is closely related to gene expression levels. Therefore, the relative expression levels of cellulase genes (g5372, g7270, g9664 and g10234) of different strains in the reed substrate at different growth stages were measured by qRT-PCR, and correlation analyses were conducted between the three cellulase activities of the strains measured in the reed substrate. As shown in Figure 7, there was a positive correlation between enzyme gene expression and enzyme activity in the two growth stages on the whole, and some of them showed a significant positive correlation, with the highest correlation coefficient being 0.80 (p < 0.01). This indicated that the higher the transcriptional expression level of the cellulase gene of the strain, the higher its cellulase activity, and the stronger its ability to degrade and utilize cellulose in the substrate.

3.5.2. Analysis of Cellulase Gene Expression in Different Strains

The relative expression levels of four cellulase genes of thirteen A. heimuer strains on the reed substrate at two growth stages are shown in Figure 8 and Figure 9, and the relative expression levels of four cellulase genes at two growth stages were different among strains. In the mycelium period (Figure 8), the relative expression of g5372 was higher in strains A2, A224 and A12, which was significantly higher than for the other strains. The relative expression of g7270 was higher in A12, A184, A224 and A496, and the lowest in A127, A314 and A596. The relative expression of g9664 was the highest in A2 and A12, and medium in A15, A184, A224 and A496. The relative expression of g10234 was higher in A12 and A184 and significantly higher than in the other strains. In the fruiting period (Figure 9), the relative expression of g5372 was the highest in strains A184 and A224, and medium in strains A12, A15, A127, A496 and A593. The relative expression of g7270 was significantly higher in A12, A15, A224, A496 and A593 than in the other strains. The relative expression of g9664 was significantly higher in A15, A184, A224, A496 and A593 than in the other strains. The relative expression of g10234 was significantly higher in A2, A15, A224 and A593 than that of the other strains. Overall, seven strains of g5372 had higher relative gene expression in the mycelium period than in the fruiting period. The expression of 11 strains of g7270 in the mycelium period was higher than that in the fruiting period. The expression levels of all 13 strains of g9664 in the fruiting period were higher than those in the mycelium period. The expression of 11 strains of g10234 in the fruiting period was higher than that in the mycelium period. g5372 and g7270 were more actively expressed in the mycelium period, while g9664 and g10234 were more actively expressed in the fruiting period.

3.6. Study on Hybrid Cellulose Degradation and Utilization Ability

3.6.1. Analysis of Relative Expression of Cellulase Gene, Cellulose Degradation and Yield of Hybrid

In order to further verify the correlation between the relative expression of enzyme genes, the degradation amount of cellulose and the yield, hybrid breeding experiments were carried out on A. heimuer strains A12, A15, A184 and A224, which had been screened in the first half of this paper and had relatively strong cellulose utilization ability. Three mononuclear strains (spores) were obtained from each of the four parental strains for round mating, and a total of 41 hybrids were obtained; then the pouch (300 g) fruiting test (five bags repeated for each strain) was carried out, and finally 26 hybrids with normal fruiting were obtained.
The expression of two enzyme genes, yield and cellulose degradation of the hybrid and parent in hmycelium period were measured (Table 7, Figure 10). The expression level of g9664 in six hybrids was higher than in the four parents. In g10234, there were also six hybrids with higher expression levels than the four parents, and the hybrids with higher expression levels generally had higher yields in the reed substrate and the sawdust substrate. As can be seen from Table 7, the reed-substrate yield of most hybrids was lower than that of the sawdust substrate, and the cellulose degradation amount in the two growth stages was generally consistent with that shown in Figure 10. Specifically, the yield of eight hybrids in the reed substrate exceeded that of the parent A184, among which hybrid Z12 was the hybrid offspring of parent A184 and A15, and its yield was 1.78 kg, which was the same as that of the parent A15. The expression of two enzyme genes of Z12 was the highest among all the hybrids, while Z6 was the hybrid offspring of A184 and A224, and its yield was 2.21 kg, more than its yield on the sawdust substrate (1.55 kg) and exceeded the yields of the four parents, making it a superparental strain, and Z6 and Z12 were more adaptable to the reed substrate. The yield of 15 hybrids in the sawdust substrate exceeded that of the parent A184; Z18 was the hybrid offspring of parent A184 and parent A15, with a yield of 3.04 kg, which exceeded the yields of the four parents, and was a superparental strain There was no significant difference between reed-substrate yield and sawdust-substrate yield in 11 of the 26 hybrid strains.

3.6.2. Correlation Analysis of Relative Expression of Cellulase Gene, Cellulose Degradation and Yield in Hybrid

Correlation analysis was conducted between the relative expression of enzyme genes in the mycelium period of the hybridand parentalreed substrates, and cellulose degradation and yield in the two growth stages of the reed and sawdust substrate (Table 8). It can be seen from the data in the table that the amount of cellulose degradation at the full-bag period and the amount of cellulose degradation at the fruiting period of the reed substrate were highly significantly positively correlated with the yield of the reed substrate, and the correlation coefficients were 0.573 and 0.623 (p < 0.01). The degradation amount of cellulose at the full-bag period and at the fruiting period of the sawdust substrate were highly significantly positively correlated with the yield of the sawdust substrate, and the correlation coefficients were 0.468 and 0.660 (p < 0.01). In addition, the relative expression levels of g9664 and g10234 were highly significantly positively correlated (r = 0.532, p < 0.01), and the expression levels of g9664 and g10234 were positively correlated with the cellulose degradation levels of the reed substrate at the full-bag period and the fruiting period. There was a significant positive correlation between the expression level of g9664 and the degradation amount of cellulose at the fruiting period (r = 0.433, p < 0.05), while the correlation between the expression level of g10234 and the degradation amount of cellulose at the fruiting period was small (r = 0.350). The expression levels of the two enzyme genes were positively correlated with the yield of the reed substrate (r = 0.317, r = 0.274).

4. Discussion

A. heimuer mycelium secretes lignocellulase to the outside world in the process of growth and development, decomposing and using lignocellulose in culture material to obtain the required nutrients. In this process, the level of cellulase activity will directly affect the absorption and utilization of nutrients in culture material by mycelium. However, the degradation amount of lignocellulose in different cultures at different periods could reflect the ability of the A. heimuer strain to utilize lignocellulose and the feeding situation of different substrates, to a certain extent [48,49]. Therefore, in this study, we took different A. heimuer strains from multiple regions as research objects, to study the relationship between cellulase genes of different strains and their cellulose utilization ability. These strains included cultivated strains and wild strains, and the sample size was abundant. Firstly, we made use of the characteristics of extracellular enzymes secreted by A. heimuer mycelia, and preliminarily screened 28 tested strains by Congo red staining on a plate containing only one carbon source (carboxymethyl cellulose Na). The colony diameter was set to be greater than 1.90 cm, and D/d was greater than 0.80. Finally, 13 strains were obtained. Then, the fruiting experiments were carried out on the reed substrate and the sawdust substrate with the 13 tested strains and the hybrid obtained from four parents. The yield of the strains on the two substrates was measured, and the material was extracted at the full-bag period of the mycelium and the fruiting period; the cellulase activity and cellulose degradation amounts were measured, and the correlation analysis of them was conducted. It was found that there were differences between strains in enzyme activity and cellulose degradation amount in the two growth stages, and the differences in the strains had certain effects on cellulase activity and degradation amount, but did not affect the change trend of the two: for most strains, the higher the cellulase activity, the higher the amount of cellulose degradation [50,51]. Compared with the general strains, the strains with strong cellulose utilization ability had stronger extracellular enzyme activity, stronger damage to the cellulose structure of the reed substrate and the sawdust substrate, and had a stronger feeding ability. Therefore, the higher the amount of cellulose degradation of the strain, the higher its yield in general; the correlation analysis among the cellulase activity, degradation amount and yield also proved this point. This was consistent with the fact that the peak of cellulase activity of wood-rotting edible mushrooms, such as Pleurotus cornucopiae and Pleurotus abalonus [52] and Pleurotus citrinopileatus [53], all appeared at the mature period of the fruiting-body, while the enzyme activity was lower at the mycelium period. The amount of degradation was also consistent with the trend found by previous studies [29,54]. In addition, in the two growth stages, most strains had a stronger ability to utilize the cellulose of the sawdust substrate than that of the reed substrate, and their yields were also higher than those of the reed substrate. This conclusion was further confirmed by the research on the relevant data of hybrids in the cross-breeding experiment in this paper, which was inseparable from the fact that A. heimuer is a wood-rotting edible mushroom, and breeding of strains better suited to herbaceous substrates also takes time.
The cellulase activity of the A. heimuer strain could not be separated from the regulation of related cellulase genes. In general, high levels of gene expression are usually accompanied by high enzyme activity and high substrate degradation. Guan et al. [51] compared and analyzed the expression levels of β-glucosidase coding genes in the mycelia full-length period (30 d) and the mid-color transformation period (60 d) by using real-time quantitative PCR technology, and found that with the increase in enzyme activity, compared with the mycelia full-length period (30 d), the relative expression of the β-glucosidase coding gene was significantly increased during the mid-color transformation period (60 d) (p < 0.05). Chen [55] showed that the expression level of UDP glucuronuronyltransferase gene (UGP gene) of Lentinula edodes was significantly positively correlated with the activity of the enzyme. In addition, under different carbon- and nitrogen-source fermentation conditions, the expression of the UGP gene and the activity of the UGPase enzyme showed the same trend, indicating that the higher the expression of the UGP gene, the higher the activity of this enzyme. Duan et al. [56] studied the expression level of the LeOAH1 gene in Lentinula edodes under different pH conditions, and its close relationship with oxalic acid secretion, and found that the expression level of the LeOAH1 gene was positively correlated with oxalic acid content. The results of our findings were basically consistent with the above studies. The relative expression levels of 4 cellulase genes in 13 tested strains and 2 enzyme genes in 26 hybrids were different among strains, and it was speculated that the strains with high cellulase-gene expression and degradation might have the characteristics of high cellulase-gene expression themselves or be induced by the reed substrate to have such high expression and degradation characteristics [47,57,58]. The expression levels of strains A2, A184, and A12 and hybrids Z6, Z12, Z19 and Z26 in the mycelium period were relatively high, and those of strains A2, A12, A15, A184, A224, A496 and A593 in the fruiting period were relatively high, while the expression levels of strains A125, A127, A134 and A314 were low in the two growth stages, which was basically consistent with the trend of cellulase activity, degradation and yield measured in the previous stage. The correlation analysis between cellulase gene expression and cellulase activity also proved this result; that is, the higher the cellulase-gene expression level of the strain, the higher its cellulase activity. In addition, like the expression levels of g9664 and g10234 in strains A15 and A593 were lower in the mycelium period, while their relative expression levels were significantly increased in the fruiting period. It was speculated that cellulase genes in strains A15 and A593 might be more easily induced by the reed substrate during the fruiting period, and thus exhibited higher transcriptional expression levels.
At the same time, we found that some strains might have high gene expression but low enzyme activity and degradation at different stages, or have low gene expression but high enzyme activity and degradation, possibly because the related enzymes could not be properly folded, were improperly modified, or might not function. On the contrary, due to post-transcriptional or post-translational regulatory mechanisms or other factors affecting the efficiency of gene expression, some strains might have high enzyme activity and high degradation amount but low gene expression amount, which was speculated to contain or restrict genes in the translation process [59]. This also explained the reason why the relative expression of enzyme genes and the enzyme activity of some strains in this study, such as A14, A15 and A593, were inconsistent at the two growth stages. In conclusion, the relationship between enzyme gene expression level, enzyme activity and degradation capacity is intricate; a high gene expression level leads to high enzyme activity and degradation capacity, but this is not always the case, and further studies are needed to understand the underlying mechanism of related enzyme function and production. At the same time, the interdependence of the three is of great reference and significance for breeding more suitable strains for reed-substrate cultivation.
In summary, real-time quantitative PCR technology was used to determine the cellulase gene expression of the tested strains on the reed substrate, while the cellulase activity and cellulose degradation ability of the tested strains were measured, and correlation analysis was performed. The results showed that the strains with high cellulase-gene expression also had high enzyme activity and degradation capacity, and there was a positive correlation between them. qRT-PCR technology could be used as an auxiliary breeding method to evaluate the cellulose degradation ability of the strain. At the same time, since the gene expression level did not always correspond to the enzyme activity level, the fruiting test of the target strain could be further conducted on the reed substrate and the relevant agronomic traits could be determined; finally, the suitability of the selected strains for production application could be comprehensively confirmed.

5. Conclusions

1. Real-time quantitative PCR technology could be used as a technology to rapidly evaluate the cellulose degradation ability of the A. heimuer strain. The use of qRT-PCR technology to evaluate the cellulose degradation ability of the strain in the early stage can reduce the workload of mushroom production in the later stage, improve the work efficiency, shorten the breeding time, and quickly provide a batch of A. heimuer strains that are more suitable for growth on the herbaceous substrate, promoting the development of the A. heimuer wood-rotting edible-mushroom grass-rotting cultivation. Finally, the feasibility of qRT-PCR as a rapid and auxiliary method to evaluate the cellulose degradation ability of strains was further verified through hybridization experiments.
2. Seven strains (A12, A15, A184, A224, Z6, Z12, and Z18) with high expression of cellulase gene, strong degradation ability and high utilization rate were comprehensively screened. Among them, one hybrid with a higher yield than the parent was Z6 on the reed substrate, and one hybrid with a higher yield than the parent was Z18 on the sawdust substrate.

Author Contributions

F.Y. designed the experiments; L.L. and J.L. revised the manuscript; M.F. and X.S. (Xu Sun) guided the experiment; X.S. (Xianqi Shan) prepared the materials for the experiments, analyzed the data and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by National Key Research and Development Program of China (No. 2023YFD1201604-4).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Acknowledgments

The authors thank the reviewers for their valuable suggestions.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wu, F.; Yuan, Y.; Malysheva, V.F.; Du, P.; Dai, Y.C. Species clarification of the most important and cultivated Auricularia mushroom “Heimuer”: Evidence from morphological and molecular data. Phytotaxa 2014, 186, 241–253. [Google Scholar] [CrossRef]
  2. Wu, F.; Dai, Y.C. Notes on the nomenclature of the Auricularia auricula-judae complex. Mycosystema 2015, 34, 604–611. [Google Scholar] [CrossRef]
  3. China Edible Fungi Association. Analysis of the results of the national edible fungi statistical survey in 2022. Edible Fungus China 2024, 43, 118–126. [Google Scholar] [CrossRef]
  4. Yao, F.J. Research and thinking on the cultivation of wood-rotting edible fungi grass-rotting. In Proceedings of the China Mycological Society 2018 Annual Conference, Tai’an, China, 11 August 2018. [Google Scholar]
  5. Li, Y. Reflections on the development of straw fungus industry in China—Report of 2023 Mushroom Festival in Zhangzhou, Fujian Province. J. Fungal Res. 2024, 22, 113–117. [Google Scholar] [CrossRef]
  6. Han, X.L.; Fang, Z.H.; Liang, J.Q.; Xiong, L.B.; Xiong, Z.; Lv, H.Y. Development status, model and suggestion of edible fungus industry of reed in Yuanjiang City. Hunan Agric. Sci. 2021, 11, 96–99. [Google Scholar] [CrossRef]
  7. Santos, F.A.; de Carvalho-Gonçalves, L.C.T.; de Carvalho Cardoso-Simões, A.L.; de Melo Santos, S.F. Evaluation of the production of cellulases by Penicillium sp. FSDE15 using corncob and wheat bran as substrates. Bioresour. Technol. Rep. 2021, 14, 100648. [Google Scholar] [CrossRef]
  8. Liu, Y.; Luo, Y.; Guo, W.; Zhang, X.; Zheng, W.; Chen, X. Study on the Effects of Different Light Supply Modes on the Development and Extracellular Enzyme Activity of Ganoderma lucidum. Agriculture 2024, 14, 835. [Google Scholar] [CrossRef]
  9. Xia, Y.; Wang, J.; Guo, C.; Xu, H.; Wang, W.; Yang, M.; Shen, Q.; Zhang, R.; Miao, Y. Exploring the multi-level regulation of lignocellulases in the filamentous fungus Trichoderma guizhouense NJAU4742 from an omics perspective. Microb. Cell Factories 2022, 21, 144. [Google Scholar] [CrossRef]
  10. Meng, W. Study on Mutagenesis Breeding and Fermentation Technology of Cellulase Producing Bacteria. Master’s Thesis, Jilin University, Changchun, China, 2008. [Google Scholar]
  11. Fatani, S.; Saito, Y.; Alarawi, M.; Gojobori, T.; Mineta, K. Genome sequencing and identification of cellulase genes in Bacillus paralicheniformis strains from the Red Sea. BMC Microbiol. 2021, 21, 254. [Google Scholar] [CrossRef]
  12. Bai, X.; Wang, X.; Wang, S.; Ji, X.; Guan, Z.; Zhang, W.; Lu, X. Functional Studies of β-Glucosidases of Cytophaga hutchinsonii and Their Effects on Cellulose Degradation. Front. Microbiol. 2017, 8, 140. [Google Scholar] [CrossRef]
  13. Madan, M.; Bisaria, R. Cellulolytic enzymes from an edible mushroom, Pleurotus sajor-caju. Biotechnol. Lett. 1983, 5, 601–604. [Google Scholar] [CrossRef]
  14. Fan, B.W.; Gong, J.L.; Lin, J.J.; Zhao, Y.; Shi, X.X.; Tang, C.S.; Wang, Z.H.; Li, Z.T.; Yang, K.J.; Zhao, C.J. Effects of carbon and nitrogen sources on mycelium and fruiting body growth and extracellular enzymes of Hericium erinaceus. Jiangsu Agric. Sci. 2018, 46, 122–126. [Google Scholar] [CrossRef]
  15. Lu, X.; Zhao, Y.; Li, F.; Liu, P. Active polysaccharides from Lentinula edodes and Pleurotus ostreatus by addition of corn straw and xylosma sawdust through solid-state fermentation. Int. J. Biol. Macromol. 2023, 228, 647–658. [Google Scholar] [CrossRef]
  16. Zhou, Y.; Liu, P.H.; Liu, B.; Su, R.R.; Zhou, J.J. Study on growth and development and extracellular enzyme activity of Agrocybe cylindracea with different cultivation formulas. North. Hortic. 2023, 19, 114–121. [Google Scholar]
  17. Lin, X.J.; Jiang, X.H.; Lin, R.B.; Chen, J.C. Correlations between extracellular enzyme levels and fruit body yields in strains of Agaricus blazei Murill. Acta Edulis Fungi 2007, 3, 24–28. [Google Scholar] [CrossRef]
  18. Al Makishah, N.H.; Elfarash, A.E. Molecular characterization of cellulase genes in Pseudomonas stutzeri. Electron. J. Biotechnol. 2022, 59, 55–61. [Google Scholar] [CrossRef]
  19. Huang, W.B.; Hou, D.; Zhou, C.L.; Li, Y.; Yang, R.H.; Bao, D.P. Analyses of genes related to different mycelial growth rate of Lentinula edodes monokaryons. Mycosystema 2023, 42, 2111–2118. [Google Scholar] [CrossRef]
  20. Li, Z.H.; Han, J.D.; Xie, H.Y.; Hu, Q.X.; Gong, Z.Y.; Zou, Y.J. Expression profiles of laccase gene family in Flammulina filiformis cultivated on different agricultural waste media. Acta Edulis Fungi 2021, 28, 47–54. [Google Scholar] [CrossRef]
  21. Liang, Z.Y.; Liu, F. Research progress on real-time quantitative PCR technology and its application. Mod. Agric. Sci. Technol. 2020, 6, 1–3+8. [Google Scholar]
  22. Niimi, Y.; Han, D.-S.; Mori, S.; Kobayashi, H. Detection of cucumber mosaic virus, lily symptomless virus and lily mottle virus in Lilium species by RT-PCR technique. Sci. Hortic. 2003, 97, 57–63. [Google Scholar] [CrossRef]
  23. Bai, J.; Chen, M.J.; Tang, L.H.; Du, J.H.; Feng, Z.Y.; Zhang, J.J.; Chen, H. Effects of temperature on antioxidant enzyme activities and gene expression in Morchella importuna. Mycosystema 2021, 40, 3276–3285. [Google Scholar] [CrossRef]
  24. Mao, W.J.; Li, Y.; Zhou, C.L.; Wang, Y.; Zhu, G.; Bao, D.P.; Wang, Y. Relative expression of laccase genes at different stages of Volvariella volvacea fruit body development. Acta Edulis Fungi 2016, 23, 1–6. [Google Scholar] [CrossRef]
  25. Zhang, Y.; Yao, F.J.; Sun, W.J.; Fang, M.; Wu, C.S. Screening of reference genes for qRT-PCR amplification in Auricularia heimuer. Mycosystema 2020, 39, 1510–1519. [Google Scholar] [CrossRef]
  26. Xiang, Q.; Li, J.; Qin, P.; He, M.; Yu, X.; Zhao, K.; Zhang, X.; Ma, M.; Chen, Q.; Chen, X.; et al. Identification and evaluation of reference genes for qRT-PCR studies in Lentinula edodes. PLoS ONE 2018, 13, e0190226. [Google Scholar] [CrossRef] [PubMed]
  27. Liao, F.; Yan, H.; Zhao, S.F.; Li, X.H. Real-time fluorescent quantitative RT-PCR method to determine the antiviral activity of edible mushroom proteins against Tobacco mosaic virus (TMV). Acta Phytopathol. Sin. 2010, 40, 622–627. [Google Scholar] [CrossRef]
  28. Wang, M.L.; Zhao, Y.; Chen, M.J.; Wang, H. Expression analysis of xyn and activity determination of xylanase in different Volvariella volvacea strains. Mycosystema 2014, 33, 1074–1083. [Google Scholar] [CrossRef]
  29. Zhai, Y. Genetic Analysis of Wild Germplasm Resources and Development of New Substrates for Excellent Strains of Auricularia heimuer. Master’s Thesis, Jilin Agricultural University, Changchun, China, 2017. [Google Scholar]
  30. Wang, R. Evaluation of Cellulose Utilization Capacity of Auricularia heimuer Germplasm Resources and Screening of Excellent Strains. Master’s Thesis, Jilin Agricultural University, Changchun, China, 2023. [Google Scholar]
  31. Fang, M.; Wang, X.; Chen, Y.; Wang, P.; Lu, L.; Lu, J.; Yao, F.; Zhang, Y. Genome Sequence Analysis of Auricularia heimuer Combined with Genetic Linkage Map. J. Fungi 2020, 6, 37. [Google Scholar] [CrossRef]
  32. Fang, M.; Sun, X.; Yao, F.; Lu, L.; Ma, X.; Shao, K.; Kaimoyo, E. A Combination of Transcriptome and Enzyme Activity Analysis Unveils Key Genes and Patterns of Corncob Lignocellulose Degradation by Auricularia heimuer under Cultivation Conditions. J. Fungi 2024, 10, 545. [Google Scholar] [CrossRef]
  33. Si, J.; Yang, C.; Ma, W.; Chen, Y.; Xie, J.; Qin, X.; Hu, X.; Yu, Q. Screen of high efficiency cellulose degrading strains and effects on tea residues dietary fiber modification: Structural properties and adsorption capacities. Int. J. Biol. Macromol. 2022, 220, 337–347. [Google Scholar] [CrossRef]
  34. Zhou, L.; Zhuang, W.Y. Screening high cellulase production Trichoderma strains and optimization of fermentation conditions. Mycosystema 2023, 42, 1966–1980. [Google Scholar] [CrossRef]
  35. Sun, J. Mining and Functional Study of Genes Related to Cellulose Degradation in Auricularia heimuer. Ph.D. Thesis, Northeast Forestry University, Harbin, China, 2023. [Google Scholar]
  36. Wang, Z.Y.; Wang, R.X.; Zhou, J.S.; Cheng, J.F.; Li, Y.H. An assessment of the genomics, comparative genomics and cellulose degradation potential of Mucilaginibacter polytrichastri strain RG4-7. Bioresour. Technol. 2020, 297, 122389. [Google Scholar] [CrossRef] [PubMed]
  37. Nie, T.; Jiang, Z.; Sun, L.; Chen, Y.; Li, J.; Yang, A.; Wei, Q.; Yin, Z. Reference genes selection for qRT-PCR analysis in various flowering transition events of Magnolia × soulangeana ‘Changchun’. Sci. Hortic. 2023, 316, 112006. [Google Scholar] [CrossRef]
  38. Zhang, Y. Screening of Reference Genes and Study Expression Levels of Functional Genes in Auricularia heimuer for qRT-PCR. Master’s Thesis, Jilin Agricultural University, Changchun, China, 2021. [Google Scholar]
  39. Wang, J.N.; Yao, F.J.; Zhang, W.; Liu, L.J. Study on effects of smallhole-fruiting method on physical and chemical nature for compost and growth and development of Auricularia heimuer. In Proceedings of the Second National Academic Exchange Meeting of Young and Middle-aged Experts in Edible Fungi, Hangzhou, China, 23 October 2008. [Google Scholar]
  40. Bian, Y.B. Edible Mushroom Cultivation, 3rd ed.; Higher Education Press: Beijing, China, 2017; pp. 60–66. [Google Scholar]
  41. Sun, Y.; Tian, Y.Q.; Zhao, L.K. Study on the conditions for determination of CMC enzyme activity of cellulase. Sci. Technol. Food Ind. 2013, 34, 68–71+74. [Google Scholar] [CrossRef]
  42. Mboowa, D.; Chandra, R.P.; Hu, J.; Saddler, J.N. Substrate Characteristics That Influence the Filter Paper Assay’s Ability to Predict the Hydrolytic Potential of Cellulase Mixtures. ACS Sustain. Chem. Eng. 2020, 8, 10521–10528. [Google Scholar] [CrossRef]
  43. Liu, Q.; Niu, S.; Hu, S.; Cui, X.; Shi, Z.; Wu, J.; Zhang, Y.; Kong, W. Lignocellulose degradation pattern and structural change of the sawdust substrate and enzyme secretion by Lentinula edodes during its production. Wood Sci. Technol. 2023, 57, 389–405. [Google Scholar] [CrossRef]
  44. Jin, M.-Y.; Zhang, T.; Yang, Y.-S.; Ding, Y.; Li, J.-S.; Zhong, G.-R. A simplified and miniaturized glucometer-based assay for the detection of β-glucosidase activity. J. Zhejiang Univ.-Sci. B 2019, 20, 264–272. [Google Scholar] [CrossRef]
  45. Liu, S.; Zhang, M.; Hong, D.; Fang, Z.; Xiao, Y.; Fang, W.; Zhang, X. Improving the cellobiose hydrolysis activity of glucose-stimulating β-glucosidase Bgl2A. Enzym. Microb. Technol. 2023, 169, 110289. [Google Scholar] [CrossRef]
  46. Li, F.; Xie, Y.; Gao, X.; Shan, M.; Sun, C.; Niu, Y.D.; Shan, A. Screening of cellulose degradation bacteria from Min pigs and optimization of its cellulase production. Electron. J. Biotechnol. 2020, 48, 29–35. [Google Scholar] [CrossRef]
  47. Zhang, F.; Zhang, T.; Dai, D.; Zhang, Z.; Zhang, B.; Li, Y. Screening of efficient lignin-degrading fungal strains and their degradation on cornstalk. Mycosystema 2021, 40, 1869–1880. [Google Scholar]
  48. Atila, F. Compositional changes in lignocellulosic content of some agro-wastes during the production cycle of shiitake mushroom. Sci. Hortic. 2019, 245, 263–268. [Google Scholar] [CrossRef]
  49. Öztürk, C.; Atila, F. Changes in lignocellulosic fractions of growing substrates during the cultivation of Hypsizygus ulmarius mushroom and its effects on mushroom productivity. Sci. Hortic. 2021, 288, 110403. [Google Scholar] [CrossRef]
  50. Zhai, F.-H.; Han, J.-R. Decomposition of asparagus old stalks by Pleurotus spp. under mushroom-growing conditions. Sci. Hortic. 2018, 231, 11–14. [Google Scholar] [CrossRef]
  51. Guan, W.; Chu, T.; Bao, D.P.; Wang, J.N.; Li, F.H.; Tang, L.H. Detection and analysis of physiological indices during mycelium color conversion of Lentinula edodes. Acta Edulis Fungi 2021, 28, 47–52. [Google Scholar] [CrossRef]
  52. Chu, Y.; Ni, X.J.; Yang, G.W.; Yuan, Y. Comparison of activity of eight extracellular enzymes of Pleurotus cornucopiae and Pleurotus abalonus in different growth periods. J. Yantai Univ. (Nat. Sci. Eng. Ed.) 2008, 2, 138–142. [Google Scholar] [CrossRef]
  53. Lei, P.; Wu, Y.Z.; Zhang, W.J.; Ma, J.J.; Jia, J.; Ma, Y. Studies on Changes of Extracellular Enzyme Activities in Different Growth Stages of Pleurotus citrinopileatus. Edible Fungus China 2020, 39, 57–61. [Google Scholar] [CrossRef]
  54. Cong, S. Study on Suitable Variety Screening and Nutritional Physiology of Auricularia heimuer Composite Substrate. Master’s Thesis, Jilin Agricultural University, Changchun, China, 2014. [Google Scholar]
  55. Chen, X.M.; Wu, H.B.; Xiang, Q.J.; Gu, Y.F.; Zhang, X.P. Transcriptional expression profiles and enzyme activity of UGP from Letinous edodes under different carbon and nitrogen sources. J. Sichuan Univ. (Nat. Sci. Ed.) 2018, 55, 214–220. [Google Scholar]
  56. Duan, Y.C.; Hu, Z.Y.; Yang, F.; Li, J.T.; Wu, X.L.; Zhang, R.Y. Cloning and expression analysis of oxaloacetate hydrolase (LeOAH1) gene from Lentinula edodes. Biotechnol. Bull. 2020, 36, 227–234. [Google Scholar] [CrossRef]
  57. Zhang, Z.Y.; Raza, M.F.; Zheng, Z.; Zhang, X.; Dong, X.; Zhang, H. Complete genome sequence of Bacillus velezensis ZY-1-1 reveals the genetic basis for its hemicellulosic/cellulosic substrate-inducible xylanase and cellulase activities. 3 Biotech 2018, 8, 465. [Google Scholar] [CrossRef]
  58. Doria, E.; Altobelli, E.; Girometta, C.; Nielsen, E.; Zhang, T.; Savino, E. Evaluation of lignocellulolytic activities of ten fungal species able to degrade poplar wood. Int. Biodeterior. Biodegrad. 2014, 94, 160–166. [Google Scholar] [CrossRef]
  59. Wang, M.L. Study on Hemicellulose Related Enzyme Activity and Gene Expression of Volvariella volvacea. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2016. [Google Scholar]
Figure 1. The amplicon length and specificity of candidate reference genes. (A): Amplified fragments of candidate reference genes shown by agarose gel electrophoresis with ethidium bromide staining; (B): melting curves generated by qRT-PCR.
Figure 1. The amplicon length and specificity of candidate reference genes. (A): Amplified fragments of candidate reference genes shown by agarose gel electrophoresis with ethidium bromide staining; (B): melting curves generated by qRT-PCR.
Agriculture 14 02027 g001aAgriculture 14 02027 g001b
Figure 2. Degradation amount of cellulose in two growth stages of different strains. RS: Reed substrate. SS: Sawdust substrate.
Figure 2. Degradation amount of cellulose in two growth stages of different strains. RS: Reed substrate. SS: Sawdust substrate.
Agriculture 14 02027 g002
Figure 3. Surface structure and morphology of reed used for A. heimuer mycelium degradation. (A1,A2) indicate the surface structural morphology of the reed substrate before mycelium utilization under 100 and 500 times microscope, respectively. (B1,B2) indicate the surface structural morphology of reed substrate during the fruiting period of strains A15 under 100 and 500 times microscope, respectively. (C1,C2) indicate the surface structural morphology of reed substrate during the fruiting period of strains A125 under 100 and 500 times microscope, respectively.
Figure 3. Surface structure and morphology of reed used for A. heimuer mycelium degradation. (A1,A2) indicate the surface structural morphology of the reed substrate before mycelium utilization under 100 and 500 times microscope, respectively. (B1,B2) indicate the surface structural morphology of reed substrate during the fruiting period of strains A15 under 100 and 500 times microscope, respectively. (C1,C2) indicate the surface structural morphology of reed substrate during the fruiting period of strains A125 under 100 and 500 times microscope, respectively.
Agriculture 14 02027 g003
Figure 4. Activity of carboxymethyl cellulase at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level. The significant difference was expressed by Duncan’s multiple range test.
Figure 4. Activity of carboxymethyl cellulase at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level. The significant difference was expressed by Duncan’s multiple range test.
Agriculture 14 02027 g004
Figure 5. Filter-paper cellulase activity at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level.
Figure 5. Filter-paper cellulase activity at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level.
Agriculture 14 02027 g005
Figure 6. β-glucosidase activity at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level.
Figure 6. β-glucosidase activity at the period of full-bag of mycelium (left) and fruiting-body maturation (right). * indicates the significance of difference at p < 0.05 level, ** indicates the significance of difference at p < 0.01 level.
Agriculture 14 02027 g006
Figure 7. Correlation analysis between cellulase activity and relative expression of enzyme genes in different strains. g5372-1 indicates the relative gene expression level at the mycelium period of g5372, and g5372-2 indicates the relative gene expression level at the fruiting period of g5372. The same applies to g7270, g9664, and g10234.
Figure 7. Correlation analysis between cellulase activity and relative expression of enzyme genes in different strains. g5372-1 indicates the relative gene expression level at the mycelium period of g5372, and g5372-2 indicates the relative gene expression level at the fruiting period of g5372. The same applies to g7270, g9664, and g10234.
Agriculture 14 02027 g007
Figure 8. Expression of cellulase gene in mycelium period of different strains. The (AD) in the graphs indicate the relative expression of genes g5372, g7270, g9664, and g10234 in the test strains, in that order. Different lowercase letters in the figure indicate the significant difference between different strains (p < 0.05). The significant difference was expressed by Duncan’s multiple range test.
Figure 8. Expression of cellulase gene in mycelium period of different strains. The (AD) in the graphs indicate the relative expression of genes g5372, g7270, g9664, and g10234 in the test strains, in that order. Different lowercase letters in the figure indicate the significant difference between different strains (p < 0.05). The significant difference was expressed by Duncan’s multiple range test.
Agriculture 14 02027 g008
Figure 9. Expression of cellulase gene in fruiting period of different strains. The (AD) in the graphs indicate the relative expression of genes g5372, g7270, g9664, and g10234 in the test strains, in that order. Different lowercase letters in the figure indicate the significant difference between different strains (p < 0.05). The significant difference was expressed by Duncan’s multiple range test.
Figure 9. Expression of cellulase gene in fruiting period of different strains. The (AD) in the graphs indicate the relative expression of genes g5372, g7270, g9664, and g10234 in the test strains, in that order. Different lowercase letters in the figure indicate the significant difference between different strains (p < 0.05). The significant difference was expressed by Duncan’s multiple range test.
Agriculture 14 02027 g009
Figure 10. Degradation of cellulose in different growth stages of hybrids (Z1–Z26).
Figure 10. Degradation of cellulose in different growth stages of hybrids (Z1–Z26).
Agriculture 14 02027 g010
Table 1. Strain names and origins of germplasm of the preserved fungi A. heimuer.
Table 1. Strain names and origins of germplasm of the preserved fungi A. heimuer.
Serial NumberStorage IDTypeOrigin of Resource
1JAUAH002CultivatedHubei Province
2JAUAH004CultivatedBeijing
3JAUAH012CultivatedHubei Province
4JAUAH013CultivatedHeilongjiang Province
5JAUAH014CultivatedHeilongjiang Province
6JAUAH015CultivatedHeilongjiang Province
7JAUAH016CultivatedHeilongjiang Province
8AUAH017CultivatedHeilongjiang Province
9AUAH019CultivatedJilin Province
10AUAH020CultivatedShanghai
11AUAH124WildHeilongjiang Province
12JAUAH125WildHeilongjiang Province
13JAUAH127WildJilin Province
14JAUAH132WildHeilongjiang Province
15JAUAH134WildHeilongjiang Province
16JAUAH139WildHeilongjiang Province
17JAUAH184WildJilin Province
18JAUAH224WildHeilongjiang Province
19JAUAH282WildJilin Province
20JAUAH308WildYunnan Province
21JAUAH314WildYunnan Province
22JAUAH336WildYunnan Province
23JAUAH345WildYunnan Province
24JAUAH356WildYunnan Province
25JAUAH496WildJilin Province
26JAUAH593CultivatedJilin Province
27JAUAH596CultivatedJilin Province
28JAUAH599CultivatedJilin Province
Table 2. Screening results of cellulase production capacity of A. heimuer strain.
Table 2. Screening results of cellulase production capacity of A. heimuer strain.
Sample
ID
Colony
Diameter (cm)
D/dSample
ID
Colony
Diameter (cm)
D/d
A143.10 ± 0.05 a1.00 ± 0.00 c–fA1271.90 ± 0.08 d–g1.27 ± 0.01 a–e
A3142.99 ± 0.10 a,b0.82 ± 0.01 fA41.86 ± 0.07 e–g1.32 ± 0.24 a–d
A1252.85 ± 0.19 a–c1.04 ± 0.04 c–fA171.85 ± 0.08 e–g1.06 ± 0.30 b–f
A22.83 ± 0.16 a–c0.94 ± 0.05 c–fA161.77 ± 0.07 e–g1.08 ± 0.11 b–f
A122.83 ± 0.22 a–c0.93 ± 0.12 c–fA5991.73 ± 0.08 f,g0.78 ± 0.09 f
A5962.77 ± 0.19 a–c0.99 ± 0.00 c–fA2821.69 ± 0.30 f–h1.27 ± 0.25 a–e
A152.77 ± 0.15 a–c0.91 ± 0.13 d–fA201.68 ± 0.23 f–h1.03 ± 0.21 c–f
A5932.74 ± 0.08 a–c0.93 ± 0.01 c–fA3451.60 ± 0.13 g–i1.04 ± 0.08 c–f
A3362.72 ± 0.38 a–c0.77 ± 0.12 fA1241.42 ± 0.12 g–k0.80 ± 0.02 f
A132.55 ± 0.29 a–c0.79 ± 0.02 fA3561.08 ± 0.13 h–l0.88 ± 1.69 e,f
A1842.53 ± 0.19 a–d1.12 ± 0.03 b–fA1321.01 ± 0.14 i–l1.50 ± 0.28 a,b
A4962.37 ± 0.15 b–e0.82 ± 0.08 fA1390.97 ± 0.08 j–l1.27 ± 0.07 a–e
A1342.24 ± 0.56 c–f0.88 ± 0.14 e,fA3080.91 ± 0.00 k,l1.37 ± 0.05 a–c
A2241.90 ± 0.15 g–j1.62 ± 0.22 aA190.78 ± 0.07 l1.32 ± 0.12 a–d
Note: The data in the table are mean ± standard deviation, and different lowercase letters in the same name column indicate significant differences between strains (p < 0.05). The type of average comparison test was Duncan’s multiple range test.
Table 3. Sequence of cellulase gene primers.
Table 3. Sequence of cellulase gene primers.
Gene IDPrimer Sequences (5′–3′)Amplicon Size (bp)
g5372CCTCGCCGTTAATGAACTTGATGTC
AGTACGAGATGTTCAACCTCCTGA
213 bp
g7270GAAAGTGCTGGGGTTGTTCTTG
ATACTAACTGTGTGACGGACAACG
173 bp
g9664CTCCTGGAGAGCGAATCAAAATACG
GTTGGTCGAGAACTTGGACATACC
156 bp
g10234GTCCTTGAATTGCTGCATGAGAAG
CACTACATCAACAACGAGCAAGAG
179 bp
Table 4. Correlation analysis of degradation amount and yield in two growth stages of different strains.
Table 4. Correlation analysis of degradation amount and yield in two growth stages of different strains.
RS-CDR1RS-CDR2RS-YieldSS-CDR1SS-CDR2SS-Yield
RS-CDR11.000
RS-CDR20.5321.000
RS-Yield0.3870.5061.000
SS-CDR10.2190.726 **0.3611.000
SS-CDR20.2850.5340.645 *0.610 *1.000
SS-Yield0.588 *0.4550.774 **0.3100.4441.000
Note: RS: reed substrate, SS: sawdust substrate. RS-CDR is the degradation amount of cellulose in reed substrate, and SS-CDR is the degradation amount of cellulose in sawdust substrate. The number 1 represents the full-bag period of mycelium and 2 represents the fruiting period. * Correlation is significant at the 0.05 level (2-tailed). ** Correlation is significant at the 0.01 level (2-tailed).
Table 5. Yield characteristics of different strains.
Table 5. Yield characteristics of different strains.
Sample IDYield (kg)
Reed SubstrateSawdust Substrate
A22.10 ± 0.01 k,l2.55 ± 0.05 g,h
A122.83 ± 0.11 e,f3.02 ± 0.02 d
A140.75 ± 0.28 r2.27 ± 0.03 i,j
A153.98 ± 0.18 b3.90 ± 0.14 b
A1250.73 ± 0.04 r1.55 ± 0.21 p
A1271.15 ± 0.02 q2.11 ± 0.01 k,l
A1341.84 ± 0.10 n1.90 ± 0.11 m,n
A1842.18 ± 0.19 j,k2.25 ± 0.16 i,j
A2242.30 ± 0.03 i4.28 ± 0.02 a
A3141.12 ± 0.03 q1.68 ± 0.02 o
A4962.01 ± 0.12 l,m2.75 ± 0.04 f
A5932.61 ± 0.01 g3.33 ± 0.22 c
A5962.48 ± 0.02 h2.90 ± 0.13 e
Note: Different lowercase letters indicate the significant difference between different strains and different substrates (p < 0.05). The type of average comparison test was Duncan’s multiple range test.
Table 6. Correlation analysis between cellulose degradation and cellulase activity.
Table 6. Correlation analysis between cellulose degradation and cellulase activity.
CMCase1CMCase2β-Gase1β-Gase2FPase1FPase2RS-CDR1RS-CDR2
CMCase11.000
CMCase20.614 *1.000
β-Gase10.5060.751 **1.000
β-Gase20.4880.808 **0.872 **1.000
FPase10.790 **0.5170.4290.3981.000
FPase20.4350.663 *0.816 **0.898 **0.3111.000
RS-CDR10.820 **0.592 *0.3500.3200.734 **0.1911.000
RS-CDR20.622 *0.694 **0.3500.5380.3550.4700.5321.000
Note: CMCase 1 indicates the enzyme activity of CMCase mycelium full-bag period, and CMCase 2 indicates the enzyme activity of the fruiting period. The same goes for β-Gase and FPase. * Correlation is significant at the 0.05 level (2-tailed). ** Correlation is significant at the 0.01 level (2-tailed).
Table 7. Relative expression of cellulase gene and yield of hybrids.
Table 7. Relative expression of cellulase gene and yield of hybrids.
Hybrid NumberGene Relative ExpressionParental Hybrid NumberYield (kg)
g9664g10234Reed SubstrateSawdust
Substrate
Z10.86 ± 0.15 i,j5.20 ± 0.66 f,gA15-1*A224-30.82 ± 0.02 k,l1.39 ± 0.06 h–j
Z20.83 ± 0.23 i,j5.33 ± 0.52 f,gA15-1*A224-11.28 ± 0.14 h–j1.17 ± 0.17 j–l
Z30.79 ± 0.04 i,j0.25 ± 0.04 gA224-3*A12-10.18 ± 0.04 p–r0.15 ± 0.05 p
Z40.32 ± 0.04 i,j1.74 ± 0.12 gA224-1*A12-10.28 ± 0.04 o–r0.64 ± 0.28 o
Z51.38 ± 0.24 i,j1.20 ± 0.09 gA184-1*A224-21.02 ± 0.03 j,k1.18 ± 0.04 j–l
Z638.20 ± 3.69 d6.37 ± 2.29 f,gA184-2*A224-22.21 ± 0.28 b–d1.55 ± 0.05 f,g
Z71.58 ± 0.10 i,j0.63 ± 0.06 gA184-3*A12-10.17 ± 0.03 p–r1.07 ± 0.08 k–n
Z84.78 ± 1.11 i,j19.52 ± 1.12 dA184-2*A15-10.45 ± 0.07 m–o2.11 ± 0.10 c,d
Z92.00 ± 0.18 i,j0.79 ± 0.10 gA184-2*A224-30.72 ± 0.03 l1.14 ± 0.14 j–l
Z101.15 ± 0.10 i,j0.21 ± 0.06 gA184-2*A15-31.50 ± 0.05 e–h0.87 ± 0.14 m–o
Z110.91 ± 0.14 i,j2.27 ± 0.33 gA184-3*A12-30.07 ± 0.01 r0.11 ± 0.00 p
Z12272.35 ± 14.73 b246.59 ± 2.91 aA184-2*A15-21.78 ± 0.10 d,e2.37 ± 0.01 b
Z131.00 ± 0.00 i,j1.00 ± 0.00 gA224-3*A12-20.10 ± 0.00 q,r0.87 ± 0.28 m–o
Z140.24 ± 0.05 j0.23 ± 0.06 gA15-2*A224-30.69 ± 0.04 l,m0.93 ± 0.04 l–n
Z153.17 ± 0.65 i,j1.24 ± 0.17 gA15-2*A224-11.29 ± 0.06 h,i0.81 ± 0.10 n,o
Z165.95 ± 0.74 h–j11.42 ± 0.53 e,fA15-2*A224-21.44 ± 0.06 e–i1.79 ± 0.01 e
Z1713.31 ± 1.12 f,g0.77 ± 0.12 gA184-2*A12-20.34 ± 0.06 o–q1.47 ± 0.04 g,h
Z187.79 ± 2.18 g–i1.30 ± 0.16 gA184-1*A15-11.61 ± 0.01 e–g3.04 ± 0.01 a
Z1916.70 ± 1.45 e,f5.30 ± 0.82 f,gA184-3*A15-10.59 ± 0.01 l–n2.33 ± 0.02 b,c
Z200.99 ± 0.19 i,j0.84 ± 0.10 gA184-1*A12-30.17 ± 0.07 p–r1.59 ± 0.06 e,f
Z214.17 ± 0.25 i,j0.56 ± 0.05 gA184-3*A15-20.69 ± 0.06 l,m1.13 ± 0.02 j–m
Z221.33 ± 0.158 i,j2.64 ± 0.26 gA184-1*A12-30.42 ± 0.03 n–p0.98 ± 0.11 l–n
Z2321.74 ± 0.93 e6.51 ± 0.78 f,gA184-3*A224-31.00 ± 0.16 j,k1.84 ± 0.01 e
Z240.22 ± 0.08 j1.17 ± 0.14 gA184-1*A224-30.68 ± 0.10 l,m1.63 ± 0.03 e,f
Z252.96 ± 0.32 i,j4.61 ± 1.28 f,gA184-2*A12-11.20 ± 0.14 i,j1.28 ± 0.03 i–k
Z262.05 ± 0.31 i,j46.21 ± 0.27 cA184-2*A12-30.27 ± 0.01 o–r0.17 ± 0.01 p
A12545.40 ± 8.60 a95.20 ± 4.22 bA121.38 ± 0.14 f–i1.63 ± 0.30 e,f
A1511.59 ± 2.09 f–h6.29 ± 0.63 f,gA151.78 ± 0.28 d,e2.07 ± 0.10 d
A18446.39 ± 9.93 c249.91 ± 23.61 aA1841.03 ± 0.03 j,k1.13 ± 0.03 j–m
A2246.24 ± 0.12 h–j16.31 ± 2.03 d,eA2241.21 ± 0.01 i,j2.88 ± 0.20 a
Note: All lowercase letters in the same column of data in the table show significant differences at the 0.05 level. * Indicates hybridization of mononuclear mycelium from two parents. The type of average comparison test was Duncan’s multiple range test.
Table 8. Correlation analysis of hybrid-cellulase gene relative expression, cellulose degradation and yield.
Table 8. Correlation analysis of hybrid-cellulase gene relative expression, cellulose degradation and yield.
g9664g10234RS-CDR1RS-CDR2SS-CDR1SS-CDR2RS-YieldSS-Yield
g96641.000
g102340.532 **1.000
RS-CDR10.0530.0611.000
RS-CDR20.433 *0.3500.536 **1.000
SS-CDR10.3170.3120.386 *0.400 *1.000
SS-CDR20.1710.1260.416 *0.488 **0.629 **1.000
RS-Yield0.3170.2740.573 **0.623 **0.3340.431 *1.000
SS-Yield0.2000.1510.526 **0.577 **0.468 **0.660 **0.517 **1.000
Note: * Correlation is significant at the 0.05 level (2-tailed). ** Correlation is significant at the 0.01 level (2-tailed).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shan, X.; Yao, F.; Lu, L.; Fang, M.; Lu, J.; Sun, X. Study of the Degradation and Utilization of Cellulose from Auricularia heimuer and the Gene Expression Level of Its Decomposition Enzyme. Agriculture 2024, 14, 2027. https://doi.org/10.3390/agriculture14112027

AMA Style

Shan X, Yao F, Lu L, Fang M, Lu J, Sun X. Study of the Degradation and Utilization of Cellulose from Auricularia heimuer and the Gene Expression Level of Its Decomposition Enzyme. Agriculture. 2024; 14(11):2027. https://doi.org/10.3390/agriculture14112027

Chicago/Turabian Style

Shan, Xianqi, Fangjie Yao, Lixin Lu, Ming Fang, Jia Lu, and Xu Sun. 2024. "Study of the Degradation and Utilization of Cellulose from Auricularia heimuer and the Gene Expression Level of Its Decomposition Enzyme" Agriculture 14, no. 11: 2027. https://doi.org/10.3390/agriculture14112027

APA Style

Shan, X., Yao, F., Lu, L., Fang, M., Lu, J., & Sun, X. (2024). Study of the Degradation and Utilization of Cellulose from Auricularia heimuer and the Gene Expression Level of Its Decomposition Enzyme. Agriculture, 14(11), 2027. https://doi.org/10.3390/agriculture14112027

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop