Detection of Bombyx mori as a Protein Source in Feedingstuffs by Real-Time PCR with a Single-Copy Gene Target
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.1.1. Insect Samples
2.1.2. Pure B. mori Samples and Mixes Containing 0.1% of B. mori
2.1.3. Compound Feed Containing B. mori
2.1.4. Egg Samples
2.2. DNA Extraction
2.3. Primers and Probe for the Real-Time PCR
2.4. Real-Time PCR Method
2.5. Specificity of the PCR Method
2.6. Copy Number Determination of B. mori Genomic DNA and Dilutions
2.7. Limit of Detection (LOD)
2.8. Efficiency
2.9. Digital PCR
2.10. Robustness of the PCR Method
2.11. Applicability of the PCR Method
2.12. Practical Interest
2.13. Transferability of the PCR Method
2.14. Specimen Identification
2.15. High-Throughput Sequencing
2.16. Microscopic Observations
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sheikh, I.U.; Banday, M.T.; Baba, I.A.; Adil, S.; Nissa, S.S.; Zaffer, B.; Bulbul, K.H. Utilization of silkworm pupae meal as an alternative source of protein in the diet of livestock and poultry. Rev. J. Entomol. Zool. Stud. 2018, 6, 1010–1016. [Google Scholar]
- Kurbanov, A.R.; Milusheva, R.Y.; Rashidova, S.S.; Kamilov, B.G. Effect of replacement of fish meal with silkworm (Bombyx mori) pupa protein on the growth of Clarias gariepinus fingerling. Int. J. Fish. Aquat. Stud. 2015, 2, 25–27. [Google Scholar]
- Soumya, M.; Harinatha Reddy, A.; Nageswari, G.; Venkatappa, B. Silkworm (Bombyx mori) and its constituents: A fascinating insect in science and research. J. Entomol. Zool. Stud. 2017, 5, 1701–1705. [Google Scholar]
- Battampara, P.; Sathish, T.N.; Reddy, R.; Guna, V.; Nagananda, G.S.; Reddy, N.; Ramesha, B.S.; Maharaddi, V.H.; Rao, A.P.; Ravikumar, H.N.; et al. Properties of chitin and chitosan extracted from silkworm pupae and egg shells. Int. J. Biol. Macromol. 2020, 161, 1296–1304. [Google Scholar] [CrossRef] [PubMed]
- Shakoori, M.; Gholipour, H.; Naseri, S. Effect of replacing dietary fish meal with silkworm (Bombyx mori) pupae on hematological parameters of rainbow trout Oncorhynchus mykiss. Comp. Clin. Path. 2015, 24, 139–143. [Google Scholar] [CrossRef]
- Barman, K.; Banik, S.; Thomas, R.; Kumar, S.; Das, A.K.; Dutta, K.; Rajkhowa, S. Effect of partial replacement of protein supplement with silkworm (Bombyx mori L.) pupa meal on production performances in crossbred (HS × GH) grower pigs. Indian J. Anim. Sci. 2020, 90, 1519–1523. [Google Scholar] [CrossRef]
- Zsedely, E.; Cullere, M.; Takacs, G.; Herman, Z.; Szalai, K.; Singh, Y.; Dalle Zotte, A. Dietary inclusion of defatted silkworm (Bombyx mori L.) Pupa meal for broiler chickens at different ages: Growth performance, carcass and meat quality traits. Animals 2022, 13, 119. [Google Scholar] [CrossRef] [PubMed]
- van Huis, A.; Rumpold, B.; Maya, C.; Roos, N. Nutritional qualities and enhancement of edible insects. Annu Rev Nutr. 2021, 41, 551–576. [Google Scholar] [CrossRef]
- Brogan, E.N.; Park, Y.L.; Matak, E.K.; Jaczynski, J. Characterization of protein in cricket (Acheta domesticus), locust (Locusta migratoria), and silk worm pupae (Bombyx mori) insect powders. Food Sci. Technol. 2021, 125, 112314. [Google Scholar] [CrossRef]
- Giacomin, A.M.; Garcia, J.B., Jr.; Zonatti, W.F.; Silva-Santos, C.; Laktim, M.C.; Baruque-Ramos, J. Brazilian silkproduction: Economic and sustainability aspects. Procedia Eng. 2017, 200, 89–95. [Google Scholar] [CrossRef]
- European Commission. Commission regulation (EU) 2021/1372 of 17 August 2021 amending Annex IV to Regulation (EC) No 999/2001 of the European Parliament and of the Council as regards the prohibition to feed non-ruminant farmed animals, other than fur animals, with protein derived from animals. Off. J. Eur. Union 2021, L295, 1–17. [Google Scholar]
- European Commission. Commission regulation (EU) 2021/1925 of 5 November 2021 amending certain Annexes to Regulation (EU) No 142/2011 as regards the requirements for placing on the market of certain insect products and the adaptation of a containment method. Off. J. Eur. Union 2021, L393, 4–6. [Google Scholar]
- European Commission. Commission regulation (EU) 2017/893. Amending Annexes I and IV to Regulation (EC) No 999/2001 of the European Parliament and of the Council and Annexes X, XIV and XV to Commission Regulation (EU) No 42/2011 as regards the provisions on processed animal protein. Off. J. Eur. Union 2017, L138, 92–116. [Google Scholar]
- Cappellozza, S.; Saviane, A.; Tettamanti, G.; Squadrin, M.; Vendramin, E.; Paolucci, P.; Franzetti, E.; Squartini, A. Identification of Enterococcus mundtii as a pathogenic agent involved in the “flacherie” disease in Bombyx mori L. larvae reared on artificial diet. J. Invertebr. Pathol. 2011, 106, 386–393. [Google Scholar] [CrossRef] [PubMed]
- Zarske, M.; Zagon, J.; Schmolke, S.; Seidler, T.; Braeuning, A. Detection of silkworm (Bombyx mori) and Lepidoptera DNA in feeding stuff by real-time PCR. Food Control 2021, 126, 108059. [Google Scholar] [CrossRef]
- European Commission. Commission regulation (EU) 37/2010 of 22 December 2009 on pharmacologically active substances and their classification regarding maximum residue limits in foodstuffs of animal origin. Off. J. Eur. Union 2010, L15, 1–72. [Google Scholar]
- Tomotake, H.; Katagiri, M.; Yamato, M. Silkworm pupae (Bombyx mori) are new sources of high quality protein and lipid. J. Nutr. Sci. Vitaminol. 2010, 56, 446–448. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Wang, F.; Lu, Y.; Wang, J.; Chen, J.; Yu, Y.; Tao, X.; Xiao, Y.; Peng, Y. A review on edible insects in China: Nutritional supply, environmental benefits, and potential applications. Curr. Res. Food Sci. 2023, 7, 100596. [Google Scholar] [CrossRef]
- European Commission. Regulation (EU) 2015/2283 of the European Parliament and of the Council of 25 November 2015 on novel foods, amending Regulation (EU) No 1169/2011 of the European Parliament and of the Council and repealing Regulation (EC) No 258/97 of the European Parliament and of the Council and Commission Regulation (EC) No 1852/2001. Off. J. Eur. Union 2015, L327, 1–22. [Google Scholar]
- Roncolini, A.; Milanović, V.; Aquilanti, L.; Cardinali, F.; Garofalo, C.; Sabbatini, R.; Clementi, F.; Belleggia, L.; Pasquini, M.; Mozzon, M.; et al. Lesser mealworm (Alphitobius diaperinus) powder as a novel baking ingredient for manufacturing high-protein, mineral-dense snacks. Food Res. Int. 2020, 131, 109031. [Google Scholar] [CrossRef] [PubMed]
- EFSA Scientific Committee. Scientific Opinion on a risk profile related to production and consumption of insects as food and feed. EFSA J. 2015, 13, 4257. [Google Scholar] [CrossRef]
- European Commission. Commission implementing regulation (EU) 2021/882 of 1 June 2021 authorising the placing on the market of dried Tenebrio molitor larva as a novel food under Regulation (EU) 2015/2283 of the European Parliament and of the Council, and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2021, L194, 16–18. [Google Scholar]
- European Commission. Commission implementing regulation (EU) 2022/169 of 8 February 2022 authorising the placing on the market of frozen, dried and powder forms of yellow mealworm (Tenebrio molitor larva) as a novel food under Regulation (EU) 2015/2283 of the European Parliament and of the Council, and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2022, L28, 10–16. [Google Scholar]
- European Commission. Commission implementing regulation (EU) 2021/1975 of 12 November 2021 authorising the placing on the market of frozen, dried and powder forms of Locusta migratoria as a novel food under Regulation (EU) 2015/2283 of the European Parliament and of the Council, and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2021, L402, 10–16. [Google Scholar]
- European Commission. Commission implementing regulation (EU) 2022/188 of 10 February 2022 authorising the placing on the market of frozen, dried and powder forms of Acheta domesticus as a novel food under Regulation (EU) 2015/2283 of the European Parliament and of the Council, and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2022, L30, 108–114. [Google Scholar]
- European Commission. Commission implementing regulation (EU) 2023/58 of 5 January 2023 authorising the placing on the market of frozen, dried and powder forms of Alphitobius diaperinus larvae (lesser mealworm) as a novel food and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2023, L5, 10–15. [Google Scholar]
- European Commission. Commission implementing regulation (EU) 2023/5 of 3 January 2023 authorising the placing on the market of Acheta domesticus (house cricket) partially defatted powder as a novel food and amending Commission Implementing Regulation (EU) 2017/2470. Off. J. Eur. Union 2023, L2, 9–15. [Google Scholar]
- Akande, A.O.; Jolayemi, O.S.; Adelugba, V.A.; Akande, S.T. Silkworm pupae (Bombyx mori) and locusts as alternative protein sources for high-energy biscuits. J. Asia-Pac. Entomol. 2020, 23, 234–241. [Google Scholar] [CrossRef]
- de Gier, S.; Verhoeckx, K. Insect (food) allergy and allergens. Mol Immunol. 2018, 100, 82–106. [Google Scholar] [CrossRef]
- Marien, A.; Sedefoglu, H.; Dubois, B.; Maljean, J.; Francis, F.; Berben, G.; Guillet, S.; Morin, J.F.; Fumière, O.; Debode, F. Detection of Alphitobius diaperinus by real-time Polymerase Chain Reaction With a Single-Copy Gene Target. Front Vet Sci. 2022, 9, 718806. [Google Scholar] [CrossRef]
- Debode, F.; Janssen, E.; Berben, G. Physical degradation of genomic DNA of soybean flours does not impair relative quantification of its transgenic content. Eur. Food Res. Technol. 2007, 226, 273–280. [Google Scholar] [CrossRef]
- Debode, F.; Marien, A.; Janssen, E.; Bragard, C.; Berben, G. The influence of amplicon length on real-time PCR results. Biotechnol. Agron. Soc. Environ. 2017, 21, 3–11. [Google Scholar] [CrossRef]
- Marien, A.; Fumière, O.; Debode, F.; Hulin, J.; Berben, G. The Horse Meat Scandal—The European Analytical Response. In DNA Techniques to Verify Food Authenticity: Applications in Food Fraud; Burns, M., Foster, L., Walker, M., Eds.; Royal Society of Chemistry: London, UK, 2019; pp. 177–188. [Google Scholar]
- Grohmann, L.; Seiler, C. Standardization of DNA-based methods for food authenticity testing. In DNA Techniques to Verify Food Authenticity: Applications in Food Fraud; Burns, M., Foster, L., Walker, M., Eds.; Royal Society of Chemistry: London, UK, 2019; pp. 227–234. [Google Scholar]
- Hirst, B.; Fernandez-Calvino, L.; Weiss, T. Commercial DNA testing. In DNA Techniques to Verify Food Authenticity: Applications in Food Fraud; Burns, M., Foster, L., Eds.; Walker Royal Society of Chemistry: London, UK, 2019; pp. 264–282. [Google Scholar]
- Cavelier, L.; Johannisson, A.; Gyllensten, U. Analysis of mtDNA copy number and composition of single mitochondrial particles using flow cytometry and PCR. Exp. Cell Res. 2000, 259, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Marien, A.; Debode, F.; Aerts, C.; Ancion, C.; Francis, F.; Berben, G. Detection of Hermetia illucens by real-time PCR. J. Insects Food Feed. 2018, 4, 115–122. [Google Scholar] [CrossRef]
- Zagon, J.; di Rienzo, V.; Potkura, J.; Lampen, A.; Braeuning, A. A real-time PCR method for the detection of black soldier fly (Hermetia illucens) in feedstuff. Food Control 2018, 91, 440–448. [Google Scholar] [CrossRef]
- Kim, S.Y.; Kim, M.J.; Jung, S.K.; Kim, H.Y. Development of a fast real-time PCR assay based on TaqMan probe for identification of edible rice grasshopper (Oxya chinensis) in processed food products. Food Res. Int. 2019, 116, 441–446. [Google Scholar] [CrossRef]
- Daniso, E.; Tulli, F.; Cardinaletti, G.; Cerri, R.; Tibaldi, E. Molecular approach for insect detection in feed and food: The case of Gryllodes sigillatus. Eur. Food Res. Technol. 2020, 246, 2373–2381. [Google Scholar] [CrossRef]
- Kim, M.J.; Jung, S.K.; Kim, S.Y.; Kim, H.Y. Development of detection method for edible silkworm (Bombyx mori) using real-time PCR. Food Control 2018, 94, 295–299. [Google Scholar] [CrossRef]
- Debode, F.; Marien, A.; Gérard, A.; Francis, F.; Fumière, O.; Berben, G. Development of real-time PCR targets for the detection of Tenebrio molitor in food and feed. Food Addit. Contam. Part A 2017, 34, 1421–1426. [Google Scholar] [CrossRef] [PubMed]
- Hua, G.; Park, Y.; Adang, M.J. Cadherin AdCad1 in Alphitobius diaperinus larvae is a receptor of Cry3Bb toxin from Bacillus thuringiensis. Insect Biochem. Mol. Biol. 2014, 45, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Broeders, S.; Huber, I.; Grohmann, L.; Berben, G.; Taverniers, I.; Mazzara, M.; Roosens, N.; Morisset, D. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci Technol. 2014, 37, 115–126. [Google Scholar] [CrossRef]
- European Network of GMO Laboratories (ENGL). Definition of minimum performance requirements for analytical methods of GMO testing. JRC Technical Report, 2015. [CrossRef]
- European Commission. Commission regulation (EC) No 152/2009 of 27 January 2009 laying down the methods of sampling and analysis for the official control of feed. Off. J. Eur. Union 2009, L54/1, 1–130. [Google Scholar]
- Fischer, B.; Larson, B.M.H. Collecting insects to conserve them: A call for ethical caution. Insect Conserv. Divers. 2019, 12, 173–182. [Google Scholar] [CrossRef]
- ISO 21571:2005; Foodstuffs—Methods of Analysis for the Detection of Genetically Modified Organisms and Derived Products—Nucleic acid Extraction. International Organisation for Standardization: Geneva, Switzerland, 2005.
- Debode, F.; Janssen, E.; Marien, A.; Berben, G. DNA detection by conventional and real-time PCR after extraction from vegetable oils. J. Am. Oil Chem. Soc. 2012, 89, 1249–1257. [Google Scholar] [CrossRef]
- Debode, F.; Marien, A.; Ledoux, Q.; Janssen, E.; Ancion, C.; Berben, G. Detection of ornamental transgenic fish by real-time PCR and fluorescence microscopy. Transgenic Res. 2020, 29, 283–294. [Google Scholar] [CrossRef] [PubMed]
- EURL-AP Standard Operating Procedure: Detection of Ruminant DNA in Feed Using Real-Time PCR. Available online: https://www.eurl.craw.eu/wp-content/uploads/2021/01/EURL-AP-SOP-Ruminant-PCR-FINAL-V1.2.pdf (accessed on 13 September 2023).
- EURL-AP Standard Operating Procedure: Detection of Pig DNA in Feed Using Real-Time PCR. Available online: https://www.eurl.craw.eu/wp-content/uploads/2021/09/EURL-AP-SOP-Pig-PCR-V1.0.pdf (accessed on 13 September 2023).
- Marien, A.; Fumière, O.; Roetschi, A.; Maljean, J.; Berben, G. A validated real-time PCR test for simultaneous detection of Gallus gallus and Meleagris gallopavo in feed instead of an impossible poultry test. Biotechnol. Agron. Soc. Environ. 2024, 28, 1–16. [Google Scholar] [CrossRef]
- Garikipati, D.K.; Gahr, S.A.; Rodgers, B.D. Identification, characterization, and quantitative expression analysis of rainbow trout myostatin-1a and myostatin-1b genes. J. Endocrinol. 2006, 190, 879–888. [Google Scholar] [CrossRef] [PubMed]
- Debode, F.; Janssen, E.; Marien, A.; Devlin, R.H.; Lieske, K.; Mankertz, J.; Berben, G. Detection of transgenic Atlantic and Coho salmon by real-time PCR. Food Anal. Methods 2017, 11, 2396–2406. [Google Scholar] [CrossRef]
- EURL-AP Standard Operating Procedure: DNA Extraction Using the “Wizard Magnetic DNA Purification System for Food” Kit. Available online: https://www.eurl.craw.eu/wp-content/uploads/2021/01/EURL-AP-SOP-DNA-extraction-V1.1.pdf (accessed on 13 September 2023).
- Jilkova, D.; Marien, A.; Hulin, J.; Zdenkova, K.; Fumiere, O.; Cermakova, E.; Berben, G.; Debode, F. Detection of Acheta domesticus by real-time PCR in food and feed. J. Insects Food Feed. 2024, 1, 1–16. [Google Scholar] [CrossRef]
- AFNOR. Détection et Quantification des Organismes Végétaux Génétiquement Modifiés et Produits Dérivés; Partie 2: Méthodes Basées sur la Réaction de Polymérisation en Chaîne; Report No.: AFNOR Standard XP-V-03-020-2; AFNOR: Saint-Denis La Plaine, France, 2003. [Google Scholar]
- Corbisier, P.; Bhat, S.; Partis, L.; Rui Dan Xie, V.; Emslie, K.R. Absolute quantification of genetically modified MON810 maize (Zea mays L.) by digital polymerase chain reaction. Anal. Bioanal. Chem. 2010, 396, 2143–2150. [Google Scholar] [CrossRef]
- CCMAS (Codex Committee on Methods of Analysis and Sampling). Guidelines on Performance Criteria and Validation of Methods for Detection, Identification and Quantification for Specific DNA Sequences and Specific Proteins in Foods (Rep. No. CAC/GL 74-2010); CCMAS: Budapest, Hungary, 2010. [Google Scholar]
- Debode, F.; Janssen, E.; Bragard, C.; Berben, G. Detection by real-time PCR and pyrosequencing of the cry1Ab and cry1Ac genes introduced in GM constructions. Food Addit. Contam. Part A 2017, 34, 1398–1409. [Google Scholar] [CrossRef] [PubMed]
- Elbrecht, V.; Braukmann, T.W.; Ivanova, N.V.; Prosser, S.W.; Hajibabaei, M.; Wright, M.; Zakharov, E.V.; Hebert, P.D.; Steinke, D. Validation of COI metabarcoding primers for terrestrial arthropods. PeerJ 2019, 7, e7745. [Google Scholar] [CrossRef] [PubMed]
- Elbrecht, V.; Leese, F. Validation and development of COI metabarcoding primers for freshwater macroinvertebrate bioassessment. Front. Environ. Sci. 2017, 5, 11. [Google Scholar]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugan, M.; Asnicar, F.; et al. Reproducible, interactive, scalable, and extensible microbiome data science using QIIME2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods. 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K. BLAST+: Architecture and applications. BMC Bioinform. 2009, 10, 421. [Google Scholar] [CrossRef] [PubMed]
- Dubois, B.; Debode, F.; Hautier, L.; Hulin, J.; Martin, G.S.; Delvaux, A.; Janssen, E.; Mingeot, D. A detailed workflow to develop QIIME2-formatted reference databases for taxonomic analysis of DNA metabarcoding data. BMC Genom Data 2022, 23, 53. [Google Scholar] [CrossRef]
- Veys, P.; Baeten, V. Protocol for the isolation of processed animal proteins from insects in feed and their identification by microscopy. Food Control 2018, 92, 496–504. [Google Scholar] [CrossRef]
- Bel, Y.; Ferré, J.; Escriche, B. Quantitative real-time PCR with SYBR Green detection to assess gene duplication in insects: Study of gene dosage in Drosophila melanogaster (diptera) and in Ostrinia nubilalis (lepidoptera). BMC Res. Notes. 2011, 4, 84. [Google Scholar] [CrossRef] [PubMed]
- Sayed, A.; Nekl, E.R.; Siquiera, H.A.A.; Wang, H.C.; French-Constant, R.H.; Bagley MSiegfried, B.D. A novel cadherin-like gene from western worn rootworm, Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae), larval midgut tissue. Insect Mol. Biol. 2007, 16, 591–600. [Google Scholar] [CrossRef]
- Reddy, N.; Jiang, Q.; Yang, Y. Properties and potential medical applications of silk fibers produced by Rothischildia lebeau. J. Biomater. Sci. Polym. Ed. 2013, 24, 820–830. [Google Scholar] [CrossRef] [PubMed]
- Gani, M.; Chouhan, S.; Lal, B.; Gupta, R.K.; Khan, G.; Kumar, N.B.; Saini, P.; Ghosh, M.K. Bombyx mori nucleopolyhedrovirus (BmBPV): Its impact on silkworm rearing and management strategies. J. Biol. Control. 2017, 31, 189–193. [Google Scholar] [CrossRef]
- Edible Insects—Future Prospects for Food and Feed Security; FAO Forestry Paper 171; FAO: Rome, Italy, 2013.
- Harris, R. A glossary of surface sculpturing. California Department of Food and Agriculture, Bureau of Entomology. Occas. Pap. Entomol. 1979, 28, 1–31. [Google Scholar]
- Barros, L.M.; Gutjahr, A.L.N.; Ferreira-Keppler, R.L.; Martins, R.T. Morphological description of the immature stages of Hermetia illucens (Linnaeus, 1758) (Diptera: Stratiomyidae). Microsc Res Tech. 2019, 82, 178–189. [Google Scholar] [CrossRef]
No Sample | Composition | Brands |
---|---|---|
P1 | Chrysalis of B. mori | Confidential |
P2 | Caterpillars after cocoon formation | Confidential |
P3 | Silkworm meal | Vivani baits (Venlo, the Netherlands) |
P4 | Silkworm protein meal | Feed stimulants (Zoetermeer, the Netherlands) |
No Sample | Types of Commercial Feed | Composition |
---|---|---|
BF1 | Fish feed | Fishmeal, fish oil, wheat gluten, protein concentrate extracted from pea, maize starch, yeast, lecithin, vitamins, minerals |
BF2 | Piglet feed | Wheat, maize, soybean oilcake (genetically modified), barley, wheat gluten, wheat bran, palm kernel flakes, sunflower seed oilcake, pork fat, rapeseed oilcake, peas, calcium carbonate |
BF3 | Poultry feed | Maize, wheat, soybean oilcake (genetically modified), wheat by-product, calcium carbonate, soybean oil, premix, sodium chloride, lysine, methionine, essential oils |
No Sample | Kind of Samples | Brands and Product Names | Composition | Claims |
---|---|---|---|---|
CF1 | Supplementary feed for fish | Feed stimulants Insect cream, boilies 12 mm (Zoetermeer, the Netherlands) | Animal meals, vegetable meals, enhancers, amino acids, preserver, flavor, sweetener, vitamins, minerals. | “crafted with defatted black soldier fly meal and silkworm meal” in the information mentioned on the site |
CF2 | Supplementary feed for fish | Feed stimulants Insect cream, boilie mix (Zoetermeer, the Netherlands) | Animal meals, vegetable meals, enhancers, amino acids, preserver, flavor, sweetener, vitamins, minerals. | “crafted with several insect meals such as black soldier fly meal, silkworm and insect powder” in the information mentioned on the site |
CF3 | Complementary feed for Koi | Hikari® Silkworm selects™ (Hyogo, Japan) | Insects, cereals, by-products of plant origin, algae, mineral substances. | “silkworm” in the name of product |
CF4 | Supplementary feed for carp | Vivani Baits Bombyx mori boilies (Venlo, the Netherlands) | Maize, wheat, silkworm meal, soy flour, chicken protein powder, egg powder, mulberry Florentine aroma, salt. | “Bombyx mori” in the name of product |
CF5 | Feed for ornamental fish | JBL Propond® silkworms (Neuhofen, Germany) | Salmon meal (23%), silkworms (14%), wheat germs, maize meal, krill meal (9%), gammares, soja meal, rice meal, wheat gluten, spirulina (4%), yeast extract, seaweed meal (1%), minerals, herb flour. | “silkworm” in the name of product |
CF6 | Feed for ornamental fish | Tropical® Insect menu flakes (Chorzów, Poland) | Insects (Hermetia illucens larvae meal 15%, silkworm pupae meal 15%, mealworms meal 15%), cereals, vegetable protein extracts, algae, oils, fats, minerals. | Presence of silkworm is explicitly mentioned in the composition |
CF7 | Pet food for dogs and cats | Truffe délice Mulberry Bombyx & carrots treats (Poisat, France) | Carrot, mulberry bombyx, potato flour, flaxseed oil. | “mulberry bombyx” in the name of product |
CF8 | Pet food for dogs | Antos® Insecta nibbles silkworm with carrot (Zaltbommel, the Netherlands) | Carrot, silkworm, potato flour, flaxseed oil. | “silkworm” in the name of product |
Assay | Target | Name | Sequences 5′-3′ | Amplicon Size (bp) |
---|---|---|---|---|
qPCR | B. mori cadherin gene | Bombyx-Cad-F | TTTCAGACACCGACCATGACA | 98 |
Bombyx-Cad-R | CCAAAATGATGCCGAAGTACTG | |||
Bombyx-Cad-P | FAM–AGCTCTGGAGCATTGTCGTTCACATCAA–TAMRA | |||
Sanger sequencing (Specimen identification) | B. mori COI gene | COI_F6 | CAATTTATCGCTTATTATTCAGCC | 826 |
COI_R6 | CCTCTTTCTTGTGAAATAATATGAG | |||
High-throughput sequencing (Metabarcoding) | Arthropod COI gene | BF3 | CCHGAYATRGCHTTYCCHCG | 458 |
BR2 | TCDGGRTGNCCRAARAAYCA |
Target | Name | Sequences 5′-3′ | Publication |
---|---|---|---|
Tenebrio molitor | Cadherin-2F | AATAGACGAAGACAACCAGCTTGA | [42] |
Cadherin-2R | TCTCTATCGGCATCACTATATGTTAGATT | ||
Cadherin-2P | FAM–CCGGACGACACCCTCAACGGA–TAMRA | ||
Tenebrio molitor | TM-WING-F | CAGGGTTGAACGGGTTCAGT | |
TM-WING-R | ATACTATTTCGGGCAACAGCATC | ||
TM-WING-P | FAM–AAGCCGTACTTGTGTTACGGCGGTTCAC–TAMRA | ||
Hermetia illucens | HI-mito-2F | ACCATTCTTCAAGCCTATGA | [37] |
HI-mito-2R | TTGAGCCGTAGACTGCG | ||
HI-mito-P | FAM–TGAAGCCCCTTTTACTATTGCTG–TAMRA | ||
Alphitobius diaperinus | Alphi-Dia-Cad-F | CCAAGTGACTCTCATCATTCAGGAT | [30] |
Alphi-Dia-Cad-R | CTGAAACCGTAATGTCTAGTTCACCTA | ||
Alphi-Dia-Cad-P | FAM–CCATTGCAGATCCAAGTCCCCGAAA–TAMRA | ||
Acheta domesticus | AchetaD_cytB_F1 | ATAGTAGGTATTCTAATCTTATTCCTA | [57] |
AchetaD_cytB_R1 | CATTGTACTAGATCAGTTCCTAGATA | ||
AchetaD_cytB_P1 | FAM–AATAGCTGCCGCTTTCATAGGTTAC–TAMRA | ||
Gryllodes sigillatus | GS1Fw | GATCAAACAATCCCCTAGGTGTC | [40] with a modification as described in [57] |
GS1re | CTGGGTCTCCAAGTATATAAGGATTAG |
Taxonomic Classification | Scientific Name (Species or Species Group) | Common Name | Origin | Results | |
---|---|---|---|---|---|
Insects | Lepidoptera | Bombyx mori L. | Silkworm | b | + (m = 27.72, σ = 0.03) |
Samia ricini (Jones) | Eri silkmoth | b | - | ||
Rothschildia lebeau (Guérin-Meneville) | Rothschild silkmoth | b | - | ||
Galleria mellonella L. | Greater wax moth | a | - | ||
Omphisa Fuscidentalis (Hampson) | Bamboo worm | b | - | ||
Cadra cautella (Walker) | Almond moth | a | - | ||
Ephestia kuehniella (Zeller) | Mill moth | a | - | ||
Coleoptera | Alphitobius diaperinus (Panzer) | Lesser mealworm | a | - | |
Tenebrio molitor L. | Mealworm | b | - | ||
Zophobas morio F. | Superworm | b | - | ||
Staphylinidae (Latreille) | Rove beetles | a | - | ||
Trypodendron domesticum L. | European hardwood ambrosia beetle | a | - | ||
Coccinella septempunctata L. | The seven spot ladybird | a | - | ||
Melolontha melolontha L. | Cockchafer | c | - | ||
Cassida viridis L. | Green tortoise beetle | c | - | ||
Protaetia cuprea F. | Copper chafer | a | - | ||
Lucanus cervus L. | Stag beetle | a * | - | ||
Rhynchophorus ferrugineus (Olivier) | Red palm weevil | b | - | ||
Cybister limbatus F. | Diving beetle | b | - | ||
Cetonia aurata L. | Rose chafer | b | - | ||
Diptera | Hermetia illucens L. | Black soldier fly | b | - | |
Tabanus sudeticus (Zeller) | Dark giant horsefly | a | - | ||
Episyrphus balteatus (De Geer) | Marmalade hoverfly | a | - | ||
Musca domestica L. | House fly | a | - | ||
Drosophila melanogaster (Meigen) | Common fruit fly | b | - | ||
Lucilia sericata (Meigen) | Common green fly | b | - | ||
Pollenia angustigena (Wainwright) | Blow fly | a | - | ||
Orthoptera | Locusta migratoria L. | Migratory locust | c | - | |
Acheta domesticus L. | House cricket | b | - | ||
Gryllus bimaculatus (De Geer). | Mediterranean field cricket | b | - | ||
Gryllus assimilis F. | Jamaican field cricket | b | - | ||
Gryllodes sigillatus (Walker) | Tropical house cricket | b | - | ||
Gryllus campestris L. | European field cricket | a | - | ||
Patanga succincta (Johannson) | Bombay locust | b | - | ||
Brachytrupes portentosus (Lichtenstein) | Giant cricket | b | - | ||
Hemiptera | Palomena prasina L. | Green shield bug | a | - | |
Pyrrhocoris apterus L. | Firebug | a | - | ||
Belostomatidae sp. (Leach) | Giant water bug | b | - | ||
Cicadidae sp. (Latreille) | Cicada | b | - | ||
Hymenoptera | Bombus terrestris L. | Buff-tailed bumblebee | a | - | |
Oecophylla smaragdina F. | Weaver ant | b | - | ||
Blattodea | Blatta orientalis L. | Oriental cockroach | c | - | |
Blaptica dubia (Serville) | Dubia cockroach | b | - | ||
Arachnida | Heterometrus longimanus (Herbst) | Black scorpion | d | - | |
Haplopelma albostriatum (Simon) | Tarantulas | d | - | ||
Polychaeta | Lumbricus terrestris L. | Earthworm | d | - | |
Crustacean | Euphausia superba (Dana) | Antartic krill | d | - | |
Penaeus vannamei (Boone) | Whiteleg shrimp | d | - | ||
Crangon crangon L. | Common shrimp | d | - | ||
Nephrops norvegicus L. | Langoustine | d | - | ||
Homarus gammarus L. | European lobster | d | - | ||
Paralithodes camtschatieus (Tilesius) | Red king crab | d | - | ||
Mollusca | Teuthida sp. (Naef) | Squid | d | - | |
Terrestrial mammals | Bos taurus L. | Beef | d | - | |
Sus scrofa domesticus (Erxleben). | Pork | d | - | ||
Sus scrofa scrofa L. | Wild boar | d | - | ||
Ovis aries L. | Sheep | d | - | ||
Capra hircus L. | Goat | d | - | ||
Equus caballus L. | Horse | d | - | ||
Equus asinus L. | Donkey | d | - | ||
Lepus europaeus (Pallas) | Hare | d | - | ||
Capreolus capreolus L. | Roe deer | d | - | ||
Cervus elaphus L. | Stag | d | - | ||
Rattus rattus L. | Rat | d | - | ||
Homo sapiens L. | Human | d | - | ||
Sea mammals | Stenella coeruleoalba (Meyen) | Striped dolphin | d | - | |
Tursiops truncatus (Montagu) | Bottlenose dolphin | d | - | ||
Grampus griseus (G. Cuvier) | Risso’s dolphin | d | - | ||
Ziphius cavirostris (G. Cuvier) | Cuvier’s beaked whale | d | - | ||
Phocoena phocoena L. | Harbor porpoise | d | - | ||
Phocidae (Gray) | Seals | d | - | ||
Fish | Salmo salar L. | Salmon | d | - | |
Gadus morhua L. | Atlantic cod | d | - | ||
Scomber scombrus L. | Atlantic mackerel | d | - | ||
Clupea harengus L. | Atlantic herring | d | - | ||
Mallotus villosus (Müller) | Capelin | d | - | ||
Sprattus sprattus L. | Sprat | d | - | ||
Engraulis encrasicolus L. | European anchovy | d | - | ||
Birds | Gallus gallus L. | Chicken | d | - | |
Meleagris gallopavo L. | Turkey | d | - | ||
Numida meleagris L. | Guinea fowl | d | - | ||
Cairina moschata L. | Muscovy duck | d | - | ||
Anser sp. L. | Goose | d | - | ||
Coturnix japonica (Temminck and Schlegel) | Quail | d | - | ||
Struthio camelus L. | Ostrich | d | - | ||
Turdus merula L. | Blackbird | d | - | ||
Plants | Glycine max (Merr) | Soybean | d | - | |
Zea mays L. | Maize | d | - | ||
Brassica napus L. | Rapeseed | d | - | ||
Triticum aestivum L. | Wheat | d | - | ||
Oryza sativa L. | Rice | d | - | ||
Solanum lycopersicum L. | Tomato | d | - | ||
Beta vulgaris L. | Sugar beet | d | - |
No Sample | Identification of Samples | Mean Cq Obtained with B. mori PCR Test |
---|---|---|
E1 | Kind 1 of B. mori eggs | 26.78 |
E2 | Kind 2 of B. mori eggs | 26.63 |
E3 | Kind 3 of B. mori eggs | 26.45 |
E4 | Kind 4 of B. mori eggs | 27.10 |
E5 | Kind 5 of B. mori eggs | 28.23 |
PCR machine | Bio-Rad CFX96™ Real-Time System (Bio-Rad) or QuantStudio 5 (Applied Biosystems) | ||||
PCR reagent kit | Universal Mastermix (Diagenode s.a.) or Master Mix ABI No AmpErase™ (Applied Biosystems) | ||||
Annealing temperature | 59 or 61 °C | ||||
Concentration of each primer (final concentration in the PCR) | Minus 30% (0.119 µM) | Standard (0.170 µM) | Standard (0.170 µM) | Standard (0.170 µM) | Standard (0.170 µM) |
Probe concentration (final concentration in the PCR) | Standard (0.300 µM) | Minus 30% (0.210 µM) | Standard (0.300 µM) | Standard (0.300 µM) | Standard (0.300 µM) |
PCR volume | Standard (20 µl mix + 5 µl DNA) | Standard (20 µl mix + 5 µl DNA) | Standard (20 µL mix + 5 µL DNA) | Standard + 1 µL Mastermix (21 µL mix + 5 µL DNA) | Standard − 1 µL Mastermix (19 µL mix + 5 µL DNA) |
Plate | Copy Number of Target/5 µL | Copy Number Mean of Target/5 µL ± SD (σ) | Coefficient of Variation |
---|---|---|---|
1 | 7487 | 6351 ± 422.51 | 6.65% |
6672 | |||
6748 | |||
6188 | |||
6825 | |||
6315 | |||
6239 | |||
6417 | |||
6213 | |||
6239 | |||
5857 | |||
6315 | |||
5857 | |||
6519 | |||
6188 | |||
2 | 6595 | ||
7334 | |||
5806 | |||
5908 | |||
6570 | |||
6137 | |||
6494 | |||
6417 | |||
5806 | |||
6595 | |||
5857 | |||
5704 | |||
5933 | |||
6494 | |||
5959 | |||
6952 | |||
6901 | |||
6112 | |||
6035 | |||
6188 | |||
6774 |
Array | Copy Number of Target/5 µL | Copy Number Mean of Target/5 µL ± SD (σ) | Coefficient of Variation |
---|---|---|---|
1 | 578 | 574 ± 47.12 | 8.22% |
650 | |||
642 | |||
443 | |||
553 | |||
528 | |||
617 | |||
573 | |||
551 | |||
501 | |||
523 | |||
2 | 540 | ||
606 | |||
620 | |||
600 | |||
598 | |||
606 | |||
598 | |||
589 | |||
562 | |||
551 | |||
589 |
Copy Number of Target | Cq (Mean Value) ± SD (σ) and (n) |
---|---|
5000 | 27.62 ± 0.21 (24) |
2500 | 28.58 ± 0.08 (24) |
1000 | 29.99 ± 0.13 (24) |
500 | 31.01 ± 0.17 (24) |
100 | 33.33 ± 0.19 (24) |
5 | 38.47 ± 0.79 (60) |
No Sample | Identification of Samples | Mean Cq obtained with Bombyx mori PCR Test | |
---|---|---|---|
P1 | Chrysalis of B. mori | Extract 1 | 19.98 |
Extract 2 | 19.95 | ||
P2 | Caterpillars of B. mori after cocoon formation | Extract 1 | 21.85 |
Extract 2 | 22.52 | ||
P3 | Silkworm meal | Extract 1 | 23.76 |
Extract 2 | 23.35 | ||
P4 | Silkworm protein meal | Extract 1 | 24.34 |
Extract 2 | 24.03 | ||
M1 | Fish feed (BF1) containing 0.1% of B. mori from P1 | Extract 1 | 33.00 |
Extract 2 | 32.54 | ||
M2 | Piglet feed (BF2) containing 0.1% of B. mori from P1 | Extract 1 | 30.67 |
Extract 2 | 29.35 | ||
M3 | Poultry feed (BF3) containing 0.1% of B. mori from P1 | Extract 1 | 32.21 |
Extract 2 | 30.62 | ||
M4 | Fish feed (BF1) containing 0.1% of B. mori from P2 | Extract 1 | 34.41 |
Extract 2 | 33.17 | ||
M5 | Piglet feed (BF2) containing 0.1% of B. mori from P2 | Extract 1 | 33.90 |
Extract 2 | 33.96 | ||
M6 | Poultry feed (BF3) containing 0.1% of B. mori from P2 | Extract 1 | 35.28 |
Extract 2 | 34.18 | ||
M7 | Fish feed (BF1) containing 0.1% of B. mori from P3 | Extract 1 | 34.45 |
Extract 2 | 37.19 | ||
M8 | Piglet feed (BF2) containing 0.1% of B. mori from P3 | Extract 1 | 33.63 |
Extract 2 | 32.18 | ||
M9 | Poultry feed (BF3) containing 0.1% of B. mori from P3 | Extract 1 | 34.34 |
Extract 2 | 34.97 | ||
M10 | Fish feed (BF1) containing 0.1% of B. mori from P4 | Extract 1 | 35.24 |
Extract 2 | 35.34 | ||
M11 | Piglet feed (BF2) containing 0.1% of B. mori from P4 | Extract 1 | 33.71 |
Extract 2 | 33.70 | ||
M12 | Poultry feed (BF3) containing 0.1% of B. mori from P4 | Extract 1 | 36.71 |
Extract 2 | 35.27 |
Samples Identification | Results with PCR Tests for the Detection of | LM Results | HTS Results | |||||||
---|---|---|---|---|---|---|---|---|---|---|
B. mori | T. molitor (Cadherin) | T. molitor (TM-Wing) | H. illucens | A. diaperinus | A. domesticus | G. sigillatus | ||||
CF1 | Extract 1 | + (29.99) | - | - | + (18.70) | - | - | - | B. mori + H. illucens + | NA |
Extract 2 | + (29.65) | - | - | + (18.14) | - | - | - | |||
CF2 | Extract 1 | + (30.64) | - | - | + (21.74) | - | - | - | B. mori + H. illucens + | NA |
Extract 2 | + (31.74) | - | - | + (22.40) | - | - | - | |||
CF3 | Extract 1 | + (29.65 a) | + (38.39) | + (41.33) | - | - | - | - | B. mori + T. molitor − | NA |
Extract 2 | + (27.52 a) | + (38.05) | + (42.14) | - | - | - | - | |||
CF4 | Extract 1 | + (29.76) | - | - | + (29.10) | - | - | - | B. mori + H. illucens + | NA |
Extract 2 | + (29.09) | - | - | + (30.18) | - | - | - | |||
CF5 | Extract 1 | + (33.25 d) | - | - | + (38.35 b) | - | - | - | B. mori ~ H. illucens ~ | NA |
Extract 2 | + (33.22 d) | - | - | + (37.55 b) | - | - | - | |||
CF 6 | Extract 1 | + (33.23 d) | - | - | + (25.45 c) | - | - | - | B. mori + H. illucens + | B. mori H. illucens |
Extract 2 | + (33.93 d) | - | - | + (25.12 c) | - | - | - | |||
CF7 | Extract 1 | - | + (32.73) | + (33.76) | + (23.32) | - | - | - | T. molitor + H. illucens + | T. molitor H. illucens |
Extract 2 | - | + (32.77) | + (33.36) | + (23.40) | - | - | - | |||
CF8 | Extract 1 | - | + (29.88) | + (31.35) | + (35.92) | - | - | - | T. molitor + H. illucens − | T. molitor |
Extract 2 | - | + (29.83) | + (31.41) | + (35.58) | - | - | - |
Copy Number of Target | Cq (Mean Value) ± SD (σ) and (n) |
---|---|
5000 | 27.52 ± 0.12 (24) |
2500 | 28.76 ± 0.18 (24) |
1000 | 30.12 ± 0.18 (24) |
500 | 31.27 ± 0.26 (24) |
100 | 33.49 ± 0.22 (24) |
10 | 37.48 ± 0.90 (60) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marien, A.; Dubois, B.; Anselmo, A.; Veys, P.; Berben, G.; Kohl, C.; Maljean, J.; Guillet, S.; Morin, J.-F.; Debode, F. Detection of Bombyx mori as a Protein Source in Feedingstuffs by Real-Time PCR with a Single-Copy Gene Target. Agriculture 2024, 14, 1996. https://doi.org/10.3390/agriculture14111996
Marien A, Dubois B, Anselmo A, Veys P, Berben G, Kohl C, Maljean J, Guillet S, Morin J-F, Debode F. Detection of Bombyx mori as a Protein Source in Feedingstuffs by Real-Time PCR with a Single-Copy Gene Target. Agriculture. 2024; 14(11):1996. https://doi.org/10.3390/agriculture14111996
Chicago/Turabian StyleMarien, Aline, Benjamin Dubois, Abigaël Anselmo, Pascal Veys, Gilbert Berben, Cloé Kohl, Julien Maljean, Stéphanie Guillet, Jean-François Morin, and Frédéric Debode. 2024. "Detection of Bombyx mori as a Protein Source in Feedingstuffs by Real-Time PCR with a Single-Copy Gene Target" Agriculture 14, no. 11: 1996. https://doi.org/10.3390/agriculture14111996
APA StyleMarien, A., Dubois, B., Anselmo, A., Veys, P., Berben, G., Kohl, C., Maljean, J., Guillet, S., Morin, J.-F., & Debode, F. (2024). Detection of Bombyx mori as a Protein Source in Feedingstuffs by Real-Time PCR with a Single-Copy Gene Target. Agriculture, 14(11), 1996. https://doi.org/10.3390/agriculture14111996