Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants
Abstract
1. Introduction
2. Materials and Methods
2.1. Material of Plant and Conditions of Growth
2.2. Physiological Measurements
2.3. Assessment of Fresh Mass and Plant Condition
2.4. Methylation-Sensitive Amplification Polymorphism (MSAP) Assay and Methylation Data Analysis
2.5. Statistical Analysis
3. Results and Discussion
3.1. Relative Content of Chlorophyll
3.2. Chlorophyll Fluorescence
3.3. Gas Exchange
3.4. Fresh Mass and Plant Condition
3.5. DNA Methylation Level
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. Crops and Livestock Products. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 5 November 2022).
- Butt, M.S.; Tahir-Nadeem, M.; Khan, M.K.I.; Shabir, R.; Butt, M.S. Oat: Unique among the cereals. Eur. J. Nutr. 2008, 47, 68–79. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, M.S.; Ahmad, A.; Sohail, A.; Asad, M.J. Nutritional and functional characterization of different oat (Avena sativa L.) cultivars. Int. J. Food Prop. 2020, 23, 1373–1385. [Google Scholar] [CrossRef]
- Barcchiya, J.; Meena, R.K.; Lal, N. Oat is a multifunctional cereal crop. Innov. Farming 2017, 2, 114–116. [Google Scholar]
- Sign, R.; De, S.; Belkheir, A. Avena sativa (oat), A potential neutraceutical and therapeutic agent: An overview. Crit. Rev. Food Sci. Nutr. 2012, 53, 126–144. [Google Scholar] [CrossRef]
- Daou, C.; Zhang, H. Oat beta-glucan: Its role in health promotion and prevention of diseases. Compr. Rev. Food Sci. Food Saf. 2012, 11, 355–365. [Google Scholar] [CrossRef]
- Peterson, D.M. Oat antioxidants. J. Cereal Sci. 2001, 33, 115–129. [Google Scholar] [CrossRef]
- Ripsin, C.M.; Keenan, J.M.; Jacobs, D.R.; Elmer, P.J.; Welch, R.R. Oat products and lipid lowering: A meta-analysis. JAMA 1992, 267, 3317–3325. [Google Scholar] [CrossRef]
- Braaten, J.T.; Wood, P.J.; Scott, F.W.; Wolynetz, M.S.; Lowe, M.K.; Bradley-White, P.; Collins, M.W. Oat beta-glucan reduces blood cholesterol concentration in hypercholesterolemic subjects. Eur. J. Clin. Nutr. 1994, 48, 465–474. [Google Scholar]
- Sterna, V.; Zute, S.; Brunava, L. Oat grain composition and its nutrition benefice. Agric. Agric. Sci. Procedia 2016, 8, 252–256. [Google Scholar] [CrossRef]
- Osbourn, A. Saponins and plant defence—A soap story. Trends Plant Sci. 1996, 1, 4–9. [Google Scholar] [CrossRef]
- Yusupovna, M.I. To study the structure of avenacine a-1 and quercetine using ir-spectroscopic and quantum-chemical computational techniques and their antimycobacterial activity. Eurasian J. Educ. Res. 2022, 4, 713–721. [Google Scholar] [CrossRef]
- Szempliński, W.; Budzyński, W.; Bielski, S. Owies. In Uprawa Roślin Tom II., 2nd ed.; Kotecki, A., Ed.; Wydawnictwo Uniwersytetu Przyrodniczego we Wrocławiu: Wrocław, Poland, 2021; pp. 191–202. (In Polish) [Google Scholar]
- Kaszkowiak, E.; Kaszkowiak, J. Energetyczne wykorzystanie ziarna owsa i jęczmienia jarego/Energy uses of grains of oats and spring barley. Inż. Ap. Chem. 2010, 10, 57–58. (In Polish) [Google Scholar]
- Tobiasz-Salach, R.; Pyrek-Bajcar, E.; Bobrecka-Jamro, D. Assessing the possible use of hulled and naked oat grains as energy source. Econtechmod. Int. Q. J. 2016, 5, 35–40. [Google Scholar]
- Głowacka, A.; Zych, M.; Żołnierczuk, J. Środowiskowe i ekonomiczne skutki wykorzystania ziarna owsa na cele energetyczne/Environmental and economic effects of the use of grain oat for energy purposes. Inż. Ekol. 2016, 49, 117–123. (In Polish) [Google Scholar] [CrossRef][Green Version]
- Urbaniak, R.; Ciupek, B.; Kłosowiak, R.; Nygard, A. Analysis of the possibility of burning and co-firing oats in automatic solid fuel boilers. Chem. Eng. Trans. 2018, 70, 685–690. [Google Scholar] [CrossRef]
- Pinto, C.W.; Barth, G.; Molin, R.; Silva, D.A.D.; Pauletti, V. Characterization of oat biomass for energy production. Rev. Caat. 2021, 34, 537–547. [Google Scholar] [CrossRef]
- Mółka, J.; Łapczyńska-Kordon, B. Właściwości energetyczne wybranych gatunków biomasy/Energy properties of selected types of biomass. Inż. Rol. 2011, 15, 141–147. (In Polish) [Google Scholar]
- Menon, R.; Gonzalez, T.; Ferruzzi, M.; Jackson, E.; Winderl, D.; Watson, J. Oats—from farm to fork. Adv. Food Nutr. Res. 2016, 77, 1–55. [Google Scholar] [CrossRef]
- Parihar, P.; Singh, S.; Singh, R.; Singh, V.P.; Prasad, S.M. Effect of salinity stress on plants and its tolerance strategies: A review. Environ. Sci. Pollut. Res. 2015, 22, 4056–4075. [Google Scholar] [CrossRef]
- Azeem, M.; Iqbal, N.; Kausar, S.; Javed, M.T.; Akram, M.S.; Sajid, M.A. Efficacy of silicon priming and fertigation to modulate seedling’s vigor and ion homeostasis of wheat (Triticum aestivum L.) under saline environment. Environ. Sci. Pollut. Res. 2015, 22, 14367–14371. [Google Scholar] [CrossRef]
- Mukarram, M.; Khan, M.M.A.; Zehra, A.; Petrik, P.; Kurjak, D. Suffer or survive: Decoding salt-sensitivity of lemongrass and its implication on essential oil productivity. Front. Plant Sci. 2022, 13, 903954. [Google Scholar] [CrossRef] [PubMed]
- Arif, Y.; Singh, P.; Siddiqui, H.; Bajguz, A.; Hayat, S. Salinity induced physiological and biochemical changes in plants: An omic approach towards salt stress tolerance. Plant Physiol. Biochem. 2020, 156, 64–77. [Google Scholar] [CrossRef] [PubMed]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.S.; Dietz, K.-J. Tuning of redox regulatory mechanisms, reactive oxygen species and redox homeostasis under salinity stress. Front. Plant Sci. 2016, 7, 548. [Google Scholar] [CrossRef] [PubMed]
- Chung, Y.S.; Kim, K.S.; Hamayun, M.; Kim, Y. Silicon confers soybean resistance to salinity stress through regulation of reactive oxygen and reactive nitrogen species. Front. Plant Sci. 2020, 10, 1725. [Google Scholar] [CrossRef] [PubMed]
- You, J.; Chan, Z. ROS regulation during abiotic stress responses in crop plants. Front. Plant Sci. 2015, 6, 1092. [Google Scholar] [CrossRef]
- Prajapati, P.; Gupta, P.; Kharwar, R.N.; Seth, C.S. Nitric oxide mediated regulation of ascorbate-glutathione pathway alleviates mitotic aberrations and DNA damage in Allium cepa L. under salinity stress. Int. J. Phytoremediation 2022, 1–12. [Google Scholar] [CrossRef]
- Sudhir, P.; Murthy, S. Effects of salt stress on basic processes of photosynthesis. Photosynthetica 2004, 42, 481–486. [Google Scholar] [CrossRef]
- Chaves, M.M.; Flexas, J.; Pinheiro, C. Photosynthesis under drought and salt stress: Regulation mechanisms from whole plant to cell. Ann. Bot. 2009, 103, 551–560. [Google Scholar] [CrossRef]
- Athar, H.U.R.; Zafar, Z.U.; Ashraf, M. Glycinebetaine improved photosynthesis in canola under salt stress: Evaluation of chlorophyll fluorescence parameters as potential indicators. J. Agron. Crop. Sci. 2015, 201, 428–442. [Google Scholar] [CrossRef]
- Ashraf, M.; Harris, P.J.C. Photosynthesis under stressful environments: An overview. Photosynthetica 2013, 51, 163–190. [Google Scholar] [CrossRef]
- Sharma, A.; Kumar, V.; Shahzad, B.; Ramakrishnan, M.; Sidhu, G.P.S.; Bali, A.S.; Handa, N.; Kapoor, D.; Yadav, P.; Khanna, K.; et al. Photosynthetic response of plants under different abiotic stresses: A review. J. Plant Growth Regul. 2020, 39, 509–531. [Google Scholar] [CrossRef]
- Khaleghi, E.; Arzani, K.; Moallemi, N.; Barzegar, M. Evaluation of chlorophyll content and chlorophyll fluorescence parameters and relationships between chlorophyll a, b and chlorophyll content index under water stress in Olea europaea cv. Dezful. World Acad. Eng. Technol. 2012, 6, 1154–1157. [Google Scholar]
- Kalaji, H.M.; Jajoo, A.; Oukarroum, A.; Brestic, M.; Zivcak, M.; Samborska, I.A.; Cetner, M.D.; Łukasik, I.; Goltsev, V. Chlorophyll a fluorescence as a tool to monitor physiological status of plants under abiotic stress conditions. Acta Physiol. Plant. 2016, 38, 102. [Google Scholar] [CrossRef]
- Banks, J.M. Chlorophyll fluorescence as a tool to identify drought stress in Acer genotypes. Environ. Exp. Bot. 2018, 155, 118–127. [Google Scholar] [CrossRef]
- Sajedi, N.; Madani, H.; Naderi, A. Effect of microelements and selenium on superoxide dismutase enzyme, malondialdehyde activity and grain yield maize (Zea mays L.) under water deficit stress. Not. Bot. Horti. Agrobot. Cluj Napoca 2011, 39, 153–159. [Google Scholar] [CrossRef][Green Version]
- Karim, M.R.; Zhang, Y.Q.; Zhao, R.R.; Chen, X.P.; Zhang, F.S.; Zou, C.Q. Alleviation of drought stress in winter wheat by late foliar application of zinc, boron, and manganese. J. Plant Nutr. Soil Sci. 2012, 175, 142–151. [Google Scholar] [CrossRef]
- Niu, J.; Liu, C.; Huang, M.; Liu, K.; Yan, D. Effects of foliar fertilization: A review of current status and future perspectives. J. Soil Sci. Plant Nutr. 2021, 21, 104–118. [Google Scholar] [CrossRef]
- Epstein, E. Silicon: Its manifold roles in plants. Ann. Appl. Biol. 2009, 155, 155–160. [Google Scholar] [CrossRef]
- Luyckx, M.; Hausman, J.F.; Lutts, S.; Guerriero, G. Silicon and plants: Current knowledge and technological perspectives. Front. Plant Sci. 2017, 8, 411. [Google Scholar] [CrossRef]
- Thorne, S.J.; Hartley, S.E.; Maathuis, F.J. Is silicon a panacea for alleviating drought and salt stress in crops? Front. Plant Sci. 2020, 11, 1221. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.J.; Randall, D.P.; Flowers, T.J. Silicon deposition in the root reduces sodium uptake in rice (Oryza sativa L.) seedlings by reducing bypass flow. Plant Cell Environ. 2006, 29, 1970–1979. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Wang, S.; Tanaka, K.; Fujihara, S.; Itai, A.; Den, X.; Zhang, S. Silicon-mediated changes in polyamines participate in silicon-induced salt tolerance in Sorghum bicolor L. Plant Cell Environ. 2016, 39, 245–258. [Google Scholar] [CrossRef] [PubMed]
- Tuna, A.L.; Kaya, C.; Higgs, D.; Murillo-Amador, B.; Aydemir, S.; Girgin, A.R. Silicon improves salinity tolerance in wheat plants. Environ. Exp. Bot. 2007, 62, 10–16. [Google Scholar] [CrossRef]
- Lee, S.K.; Sohn, E.Y.; Hamayun, M. Effect of silicon on growth and salinity stress of soybean plant grown under hydroponic system. Agroforest Syst. 2010, 80, 333–340. [Google Scholar] [CrossRef]
- Laane, H.-M. The effects of foliar sprays with different silicon compounds. Plants 2018, 7, 45. [Google Scholar] [CrossRef]
- Abdelaal, K.A.A.; Mazrou, Y.S.A.; Hafez, Y.M. Silicon foliar application mitigates salt stress in sweet pepper plants by enhancing water status, photosynthesis, antioxidant enzyme activity and fruit yield. Plants 2020, 9, 733. [Google Scholar] [CrossRef]
- Cao, D.; Gao, X.; Liu, J.; Kimatu, J.N.; Geng, S.; Wang, X.; Zhao, J.; Shi, D. Methylation sensitive amplified polymorphism (MSAP) reveals that alkali stress triggers more DNA hypomethylation levels in cotton (Gossypium hirsutum L.) roots than salt stress. Afr. J. Biotechnol. 2011, 10, 18971–18980. [Google Scholar]
- Lukens, L.N.; Zhan, S. The plant genome’s methylation status and response to stress: Implications for plant improvement. Curr. Opin. Plant Biol. 2007, 10, 317–322. [Google Scholar] [CrossRef]
- Shan, X.; Wang, X.; Yang, G.; Wu, Y.; Su, S.; Li, S.; Liu, H.; Yuan, Y. Analysis of the DNA methylation of maize (Zea mays L.) in response to cold stress based on methylation-sensitive amplified polymorphisms. J. Plant Biol. 2012, 56, 32–38. [Google Scholar] [CrossRef]
- Xu, M.; Li, X.; Korban, S.S. AFLP based detection of DNA methylation. Plant Mol. Biol. Report. 2000, 18, 361–368. [Google Scholar] [CrossRef]
- Niedziela, A. The influence of Al3+ on DNA methylation and sequence changes in the triticale (×Triticosecale Wittmack) genome. J. Appl. Genet. 2018, 59, 405–417. [Google Scholar] [CrossRef] [PubMed]
- Zhong, L.; Xu, Y.; Wang, J.B. DNA-methylation changes induced by salt stress in wheat. Afr. J. Biotechnol. 2009, 8, 6201–6207. [Google Scholar] [CrossRef]
- Liao, J.; Zhou, M.; Fan, J.; Hu, X.; Tang, M.; Gong, M.; Wu, Y. Analysis of DNA Methylation of Wheat in Response to Low Nitrogen Stress Based on Mathylation-sensitive Amplified Polymorphisms. Int. J. Agric. Biol. 2018, 20, 2897–2904. [Google Scholar]
- Konate, M.; Wilkinson, M.J.; Mayne, B.T.; Pederson, S.M.; Scott, E.S.; Berger, B.; Rodriguez Lopez, C.M. Salt stress induces non-CG methylation in coding regions of barley seedlings (Hordeum vulgare). Epigenomes 2018, 2, 12. [Google Scholar] [CrossRef]
- Zenda, T.; Liu, S.; Yao, D.; Duan, H. Analysis of sulphur and chlorine induced DNA cytosine methylation alterations in fresh corn (Zea mays L. saccharata and rugosa) leaf tissues by methylation sensitive amplification polymorphism (MSAP) approach. Genes Genom. 2018, 40, 913–925. [Google Scholar] [CrossRef]
- Pan, Y.; Wang, W.; Zhao, X.; Zhu, L.; Fu, B.; Li, Z. DNA methylation alterations of rice in response to cold stress. Plant Omics J. 2011, 4, 364–369. [Google Scholar]
- Tobiasz-Salach, R.; Stadnik, B.; Migut, D. Assessment of the physiological condition of spring barley plants in conditions of increased soil salinity. Agronomy 2021, 11, 1928. [Google Scholar] [CrossRef]
- Xiong, L.Z.; Xu, C.G.; Saghai Maroof, M.A.; Zhang, Q. Patterns of cytosine methylation in an elite rice hybrid and its parental lines, detected by a methylation-sensitive amplification polymorphism technique. Mol. Gen. Genet. 1999, 261, 439–446. [Google Scholar] [CrossRef]
- Bassam, B.J.; Gresshoff, P.M. Silver staining DNA in polyacrylamide gels. Nat. Protoc. 2007, 2, 2649–2654. [Google Scholar] [CrossRef]
- Li, X.; Xu, M.; Schuyler, S.K. DNA methylation profiles differ between field-andin vitro-grown leaves of apple. J. Plant Physiol. 2002, 159, 1229–1234. [Google Scholar] [CrossRef]
- Dawood, M.G.; Taie, H.A.A.; Nassar, R.M.A.; Abdelhamid, M.T.; Schmidhalter, U. The changes induced in the physiological, biochemical and anatomical characteristics of Vicia faba by the exogenous application of proline under seawater stress. S. Afr. J. Bot. 2014, 93, 54–63. [Google Scholar] [CrossRef]
- Saddiq, M.S.; Iqbal, S.; Hafeez, M.B.; Ibrahim, A.M.H.; Raza, A.; Fatima, E.M.; Baloch, H.; Jahanzaib; Woodrow, P.; Ciarmiello, L.F. Effect of salinity stress on physiological changes in winter and spring wheat. Agronomy 2021, 11, 1193. [Google Scholar] [CrossRef]
- Mostafa, H. Effects of salinity stress on growth, chlorophyll content and osmotic components of two basil (Ocimum basilicum L.) genotypes. Afr. J. Biotechnol. 2012, 11, 379–384. [Google Scholar] [CrossRef]
- Ibrahim, W.; Ahmed, I.M.; Chen, X.; Wu, F. Genotype-dependent alleviation effects of exogenous GSH on salinity stress in cotton is related to improvement in chlorophyll content, photosynthetic performance, and leaf/root ultrastructure. Environ. Sci. Pollut. Res. 2017, 24, 9417–9427. [Google Scholar] [CrossRef]
- Chandramohanan, K.T.; Radhakrishnan, V.V.; Abhilash Joseph, E.; Mohanan, K.V. A study on the effect of salinity stress on the chlorophyll content of certain rice cultivars of Kerala state of India. Agric. For. Fish. 2014, 3, 67–70. [Google Scholar] [CrossRef]
- Zhao, G.Q.; Ma, B.L.; Ren, C.Z. Growth, gas exchange, chlorophyll fluorescence, and ion content of naked oat in response to salinity. Crop. Sci. 2007, 47, 123–131. [Google Scholar] [CrossRef]
- Qin, Y.; Bai, J.; Wang, Y.; Liu, J.; Hu, Y.; Dong, Z.; Ji, L. Comparative effects of salt and alkali stress on photosynthesis and root physiology of oat at anthesis. Arch. Biol. Sci. 2018, 70, 329–338. [Google Scholar] [CrossRef]
- Chauhan, A.; Rajput, N.; Kumar, A.; Verma, J.S.; Chaudhry, A.K. Interactive effects of gibberellic acid and salt stress on growth parameters and chlorophyll content in oat cultivars. J. Environ. Biol. 2018, 39, 639–646. [Google Scholar] [CrossRef]
- Devi, S.; Phogat, D.; Satpal, S.; Goyal, V. Responses of oat (Avena sativa L.) genotypes under salt stress. Int. J. Chem. Stud. 2019, 7, 734–737. [Google Scholar]
- Chutipaijit, S.; Cha-um, S.; Sompornpailin, K. High contents of proline and anthocyaninincrease protective response to salinity in Oryza sativa L. spp. Indica. Aust. J. Crop Sci. 2011, 5, 1191–1198. [Google Scholar]
- Mane, A.V.; Karadge, B.A.; Samant, J.S. Salinity induced changes in photosynthetic pigments and polyphenols of Cymbopogon nardus (L.) Rendle. J. Chem. Pharm. Res. 2010, 2, 338–347. [Google Scholar]
- Singh, P.; Kumar, V.; Sharma, J.; Saini, S.; Sharma, P.; Kumar, S.; Sinhmar, Y.; Kumar, D.; Sharma, A. Silicon supplementation alleviates the salinity stress in wheat plants by enhancing the plant water status, photosynthetic pigments, proline content and antioxidant enzyme activities. Plants 2022, 11, 2525. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, M.A.; Merwad, A.M.; Elnaka, E.A.; Burras, C.L.; Follett, L. Application of silicon ameliorated salinity stress and improved wheat yield. J. Soil Sci. Environ. 2016, 7, 81–91. [Google Scholar] [CrossRef]
- Kutasy, E.; Buday-Bódi, E.; Virág, I.C.; Forgács, F.; Melash, A.A.; Zsombik, L.; Nagy, A.; Csajbók, J. Mitigating the negative effect of drought stress in oat (Avena sativa L.) with silicon and sulphur foliar fertilization. Plants 2022, 11, 30. [Google Scholar] [CrossRef] [PubMed]
- Trejo-Téllez, L.I.; García-Jiménez, A.; Escobar-Sepúlveda, H.F.; Ramírez-Olvera, S.M.; Bello-Bello, J.J.; Gómez-Merino, F.C. Silicon induces hormetic dose-response effects on growth and concentrations of chlorophylls, amino acids and sugars in pepper plants during the early developmental stage. PeerJ 2020, 8, e9224. [Google Scholar] [CrossRef]
- El-Serafy, R.S.; El-Sheshtawy, A.N.A.; Atteya, A.K.; Al-Hashimi, A.; Abbasi, A.M.; Al-Ashkar, I. Seed priming with silicon as a potential to increase salt stress tolerance in Lathyrus odoratus. Plants 2021, 10, 2140. [Google Scholar] [CrossRef]
- Maxwell, K.; Johnson, G.N. Chlorophyll fluorescence—A practical guide. J. Exp. Bot. 2000, 51, 659–668. [Google Scholar] [CrossRef]
- Force, L.; Critchley, C.; van Rensen, J.J. New fluorescence parameters for monitoring photosynthesis in plants. Photosynth. Res. 2003, 78, 17. [Google Scholar] [CrossRef]
- Akhter, M.S.; Noreen, S.; Mahmood, S.; Athar, H.U.; Ashraf, M.; Alsahli, A.A.; Ahmad, P. Influence of salinity stress on PSII in barley (Hordeum vulgare L.) genotypes, probed by chlorophyll-a fluorescence. J. King Saud. Univ. Sci. 2021, 33, 101239. [Google Scholar] [CrossRef]
- Allakhverdiev, S.I.; Sakamoto, A.; Nishiyama, Y.; Inaba, M.; Murata, N. Ionic and osmotic effects of NaCl-induced inactivation of photosystems I and II in Synechococcus sp. Plant Physiol. 2000, 123, 1047–1056. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Qin, Y.; Liu, J.; Wang, Y.; Sa, R.; Zhang, N.; Jia, R. Proteomic response of oat leaves to long-term salinity stress. Environ. Sci. Pollut. Res. 2017, 24, 3387–3399. [Google Scholar] [CrossRef] [PubMed]
- Jafarinia, M.; Mojga, K. Investigation the effects of salinity and nitric oxide on the changes of chlorophyll a fluorescence in oat (Avena sativa L.) plant probed by JIP-Test. Iran. J. Plant Biol. 2017, 9, 87–98. [Google Scholar] [CrossRef]
- Gupta, S.; Pandey, S. Enhanced salinity tolerance in the common bean (Phaseolus vulgaris) plants using twin ACC deaminase producing rhizobacterial inoculation. Rhizosphere 2020, 16, 100241. [Google Scholar] [CrossRef]
- Gupta, P.; Srivastava, S.; Seth, C.S. 24-Epibrassinolide and sodium nitroprusside alleviate the salinity stress in Brassica juncea L. cv. Varuna through cross-talk among proline, nitrogen metabolism and abscisic acid. Plant Soil 2017, 411, 483–498. [Google Scholar] [CrossRef]
- Maghsoudi, K.; Emam, Y.; Ashraf, M. Influence of foliar application of silicon on chlorophyll fluorescence, photosynthetic pigments, and growth in water-stressed wheat cultivars differing in drought tolerance. Turk. J. Bot. 2015, 39, 625–634. [Google Scholar] [CrossRef]
- Ghassemi–Golezani, K.; Lotfi, R. The impact of salicylic acid and silicon on chlorophyll a fluorescence in mung bean under salt stress. Russ. J. Plant Physiol. 2015, 62, 611–616. [Google Scholar] [CrossRef]
- Shah, S.S.; Li, Z.; Yan, H.; Shi, L.; Zhou, B. Comparative study of the effects of salinity on growth, gas exchange, an accumulation and stable isotope signatures of forage oat (Avena sativa L.) genotypes. Plants 2020, 9, 1025. [Google Scholar] [CrossRef]
- Pan, T.; Liu, M.; Kreslavski, V.D.; Zharmukhamedov, S.K.; Nie, C.; Yu, M.; Kuznetsov, V.V.; Allakhverdiev, S.I.; Shabala, S. Non-stomatal limitation of photosynthesis by soil salinity. Crit. Rev. Environ. Sci. Technol. 2021, 51, 791–825. [Google Scholar] [CrossRef]
- Mateos-Naranjo, E.; Andrades-Moreno, L.; Davy, A.J. Silicon alleviates deleterious effects of high salinity on the halophytic grass Spartina densiflora. Plant Physiol. Biochem. 2013, 63, 115–121. [Google Scholar] [CrossRef]
- Ueda, A.; Yahagi, H.; Fujikawa, Y.; Nagaoka, T.; Esaka, M.; Calcaño, M.; González, M.M.; Martich, J.D.H.; Saneoka, H. Comparative physiological analysis of salinity tolerance in rice. Soil Sci. Plant Nutr. 2013, 59, 896–903. [Google Scholar] [CrossRef]
- Gururani, M.A.; Venkatesh, J.; Tran, L.S.P. Regulation of photosynthesis during abiotic stress-induced photoinhibition. Mol. Plant 2015, 8, 1304–1320. [Google Scholar] [CrossRef] [PubMed]
- Kiani-Pouya, A.; Rasouli, F.; Rabbi, B.; Falakboland, Z.; Yong, M.; Chen, Z.H.; Zhou, M.; Shabala, S. Stomatal traits as a determinant of superior salinity tolerance in wild barley. J. Plant Physiol. 2020, 245, 153108. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Gong, H. Beneficial effects of silicon on salt and drought tolerance in plants. Agron. Sustain. Dev. 2014, 34, 455–472. [Google Scholar] [CrossRef]
- Parvaiz, M. Response of maize to salt stress a critical review. Int. J. Healthc. Sci. 2014, 1, 13–25. [Google Scholar]
- Negrão, S.; Schmöckel, S.M.; Tester, M. Evaluating physiological responses of plants to salinity stress. Ann. Bot. 2017, 119, 1–11. [Google Scholar] [CrossRef]
- Alian, A.; Altman, A.; Heuer, B. Genotypic difference in salinity and water stress tolerance of fresh market tomato cultivars. Plant Sci. 2000, 152, 59–65. [Google Scholar] [CrossRef]
- Ghoulam, C.; Foursy, A.; Fares, K. Effects of salt stress on growth, inorganic ions and proline accumulation in relation to osmotic adjustment in five sugar beet cultivars. Environ. Exp. Bot. 2002, 47, 39–50. [Google Scholar] [CrossRef]
- Jamil, M.; Lee, K.J.; Kim, J.M.; Kim, H.S.; Rha, E.S. Salinity reduced growth PS2 photochemistry and chlorophyll content in radish. Sci. Agric. 2007, 64, 111–118. [Google Scholar] [CrossRef]
- Kasim, W.A.; Gaafar, R.M.; Abou-Ali, R.M.; Omar, M.N.; Hewait, H.M. Effect of biofilm forming plant growth promoting rhizobacteria on salinity tolerance in barley. Ann. Agric. Sci. 2016, 61, 217–227. [Google Scholar] [CrossRef]
- Zan, W.; Geng, Z.; Xue-min, W.; Hong-wen, G. Growth, ion content and photosynthetic responses of two Elytrigia Desv. species seedlings to salinity stress. Afr. J. Biotechnol. 2011, 10, 7390–7396. [Google Scholar] [CrossRef]
- Hewedy, O.A.; Mahmoud, G.A.E.; Elshafey, N.F.; Khamis, G.; Karkour, A.M.; Lateif, K.S.A.; Amin, B.H.; Chiab, N.; El-Taher, A.M.; Elsheery, N.I. Plants take action to mitigate salt stress: Ask microbe for help, phytohormones, and genetic approaches. J. Water Land Dev. 2022, 55, 1–16. [Google Scholar] [CrossRef]
- Virlouvet, L.; Fromm, M. Physiological and transcriptional memory in guard cells during repetitive dehydration stress. New Phytol. 2015, 205, 596–607. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.; Yang, Z.; Liu, L.; Duan, L. DNA methylation in plant responses and adaption to abiotic stresses. Int. J. Mol. Sci. 2022, 23, 6910. [Google Scholar] [CrossRef]
- Vriet, C.; Hennig, L.; Laloi, C. Stress-induced chromatin changes in plants: Of memories, metabolites and crop improvement. Cell Mol. Life Sci. 2015, 72, 1261–1273. [Google Scholar] [CrossRef]
- Zhao, Y.; Chen, X. Non-coding RNAs and DNA methylation in plants. Nat. Sci. Rev. 2014, 1, 219–229. [Google Scholar] [CrossRef]
- Kong, L.; Liu, Y.; Wang, X.; Chang, C. Insight into the role of epigenetic processes in abiotic and biotic stress response in wheat and barley. Int. J. Mol. Sci. 2020, 21, 1480. [Google Scholar] [CrossRef]
- Turgut-Kara, N.; Arikan, B.; Celik, H. Epigenetic memory and priming in plants. Genetica 2020, 148, 47–54. [Google Scholar] [CrossRef]
- Gallo-Franco, J.J.; Sosa, C.C.; Ghneim-Herrera, T.; Quimbaya, M.A. Epigenetic control of plant response to heavy metal stress: A new view on aluminum tolerance. Front. Plant Sci. 2020, 11, 602625. [Google Scholar] [CrossRef]
- Ali, S.; Khan, N.; Tan, Y. Epigenetic marks for mitigating abiotic stresses in plants. J. Plant Physiol. 2022, 275, 153740. [Google Scholar] [CrossRef]
- Sadhukhan, A.; Prasad, S.S.; Mitra, J.; Siddiqui, N.; Sahoo, L.; Kobayashi, Y. How do plants remember drought? Planta 2022, 256, 7. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Quan, W.; Bartels, D. Stress memory responses and seed priming correlate with drought tolerance in plants: An overview. Planta 2022, 255, 45. [Google Scholar] [CrossRef] [PubMed]
- Sharma, M.; Kumar, P.; Verma, V.; Sharma, R.; Bhargava, B.; Irfan, M. Understanding plant stress memory response for abiotic stress resilience: Molecular insights and prospects. Plant Physiol. Biochem. 2022, 179, 10–24. [Google Scholar] [CrossRef] [PubMed]
- Eichten, S.R.; Swanson-Wagner, R.A.; Schnable, J.C.; Waters, A.J.; Hermanson, P.J.; Liu, S.; Yeh, C.-T.; Jia, Y.; Gendler, K.; Freeling, M.; et al. Heritable epigenetic variation among maize inbreds. PLoS Genet. 2011, 7, e1002372. [Google Scholar] [CrossRef]
- Shen, H.; He, H.; Li, J.; Chen, W.; Wang, X.; Guo, L.; Peng, Z.; He, G.; Zhong, S.; Qi, Y.; et al. Genome-wide analysis of DNA methylation and gene expression changes in two Arabidopsis ecotypes and their reciprocal hybrids. Plant Cell 2012, 24, 875–892. [Google Scholar] [CrossRef]
- Li, P.; Ponnala, L.; Gandotra, N.; Wang, L.; Si, Y.; Tausta, L.; Kebrom, T.; Provart, N.; Patel, R.; Myers, C.; et al. The developmental dynamics of the maize leaf transcriptome. Nat. Genet. 2010, 42, 1060–1067. [Google Scholar] [CrossRef]
- Ferreira, L.J.; Azevedo, V.; Maroco, J.; Oliveira, M.M.; Santos, A.P. Salt tolerant and sensitive rice varieties display differential methylome flexibility under salt stress. PLoS ONE 2015, 10, e0124060. [Google Scholar] [CrossRef]
- Skorupa, M.; Szczepanek, J.; Mazur, J.; Domagalski, K.; Tretyn, A.; Tyburski, J. Salt stress and salt shock differently affect DNA methylation in salt-responsive genes in sugar beet and its wild, halophytic ancestor. PLoS ONE 2021, 16, e0251675. [Google Scholar] [CrossRef]
MSAP Stage | Primer/Adapter | Sequence |
---|---|---|
Ligation | EcoRI-Adapter | 5′ CTCGTAGACTGCGTACC 3′ 3′ CATCTGACGCATGGTTAA 5′ |
MspI-HpaII-Adapter | 5‘ CGACTCAGGACTCAT 3′ 3′ TGAGTCCTGAGTAGCAG 5′ | |
Preamplification | Pre-EcoRI | 5′ GACTGCGTACCAATTC 3′ |
Pre-MspI-HpaII | 5′ GATGAGTCCTGAGTCGG 3′ | |
Selective amplification | EcoRI-ACT | 5′ GACTGCGTACCAATTCACT 3′ |
EcoRI-AG | 5′ GACTGCGTACCAATTCAG 3′ | |
EcoRI-AC | 5′ GACTGCGTACCAATTCAC 3′ | |
EcoRI-AT | 5′ GACTGCGTACCAATTCAT 3′ | |
MspI/HpaII-ATG | 5′ GATGAGTCCTGAGTCGGATG 3′ | |
MspI/HpaII-CTC | 5′ GATGAGTCCTGAGTCGGCTC 3′ | |
MspI/HpaII-CAT | 5′ GATGAGTCCTGAGTCGGCAT 3′ | |
MspI/HpaII-CT | 5′ GATGAGTCCTGAGTCGGCT 3′ | |
MspI/HpaII-GT | 5′ GATGAGTCCTGAGTCGGGT 3′ | |
MspI/HpaII-CA | 5′ GATGAGTCCTGAGTCGGCA 3′ |
Analyzed Values | Control | NaCl | NaCl + 0.05% Si | NaCl + 0.1% Si | NaCl + 0.2% Si |
---|---|---|---|---|---|
Number of symmetric methylation bands | 44 | 45 | 48 | 54 | 57 |
Symmetric methylation (%) | 13.7 | 13.2 | 14.2 | 16.5 | 17.0 |
Number of hemimethylation bands | 97 | 99 | 90 | 87 | 74 |
Hemimethylation (%) | 30.2 | 29.1 | 26.6 | 26,6 | 22.1 |
Total bands number | 321 | 340 | 338 | 327 | 335 |
% total methylation | 43.9 | 42.4 | 40.8 | 43.1 | 39.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stadnik, B.; Tobiasz-Salach, R.; Mazurek, M. Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants. Agriculture 2023, 13, 81. https://doi.org/10.3390/agriculture13010081
Stadnik B, Tobiasz-Salach R, Mazurek M. Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants. Agriculture. 2023; 13(1):81. https://doi.org/10.3390/agriculture13010081
Chicago/Turabian StyleStadnik, Barbara, Renata Tobiasz-Salach, and Marzena Mazurek. 2023. "Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants" Agriculture 13, no. 1: 81. https://doi.org/10.3390/agriculture13010081
APA StyleStadnik, B., Tobiasz-Salach, R., & Mazurek, M. (2023). Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants. Agriculture, 13(1), 81. https://doi.org/10.3390/agriculture13010081