Fine Mapping and Candidate-Gene Analysis of an open glume multi-pistil 3 (mp3) in Rice (Oryza sativa L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Survey of Agronomic Traits in Mutant mp3 and Wild-Type Rice
2.3. DNA Isolation
2.4. Marker Development
2.5. PCR Analysis
2.6. Molecular Mapping and Linkage-Map Construction
2.7. Development of Sequencing Primers and Candidate-Gene Analysis
3. Results
3.1. Morphological Analysis of Mutant mp3
3.2. Analysis on Agronomical Traits of Mutant mp3
3.3. Analysis on Grain Shapes of Mutant mp3
3.4. Genetic Analysis of Multi-Pistils in Mutant mp3
3.5. Gene Mapping of mp3
3.6. Fine Mapping of mp3
3.7. Gene Annotation and Sequence Analysis of the Predicated Genes of mp3
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
Ohms1 | Open-hull and male sterile 1 |
Ohss(t) | Open-hull semi-sterility mutant |
MSP1 | Multiple sporocyte 1 |
Aid1 | Anther indehiscence 1 |
Udt1 | Undeveloped tapetum 1 |
Tdr | Tapetum degeneration retardation |
EMF1 | Early morning flowering 1 |
Mp1 | Multiple pistil 1 |
Mp2 | Multiple pistil 2 |
Fon2-1 | Floral organ number 2-1 |
Fon2-2 | Floral organ number 2-1 |
Fon3 | Floral organ number 3 |
Fon(t) | Floral–organ–number mutant |
TOR | Twin–ovary mutant |
ISM(t) | Increased stigma mutant |
Afon1 | Abnormal floral organ number 1 |
Mf2 | Multi-floret 2 |
Fon1 | Floral organ number 1 |
FON4 | Floral organ number 4 |
LF1 | Lateral floret 1 |
Mp3 | multi-pistil 3 |
HD | Days to heading |
PH | Plant height |
PP | Panicles plant–1 |
PL | Panicle length |
FGP | Filling grains panicle–1 |
EGP | Empty grains panicle–1 |
SP | Spikelets panicle–1 |
1000-GW | 1000-grain weight |
GYMP | Grain yield of major panicle |
GYP | Grain yield plant–1 |
GL | Grain length |
GW | Grain width |
GT | Grain thickness |
GSR | Grain-setting rate |
GSD | Grain-setting density |
LWR | Length-to-width ratio |
References
- Sasaki, T.; Burr, B. International rice genome sequencing project: The effort to completely sequence the rice genome. Curr. Opin. Plant Biol. 2000, 3, 138–141. [Google Scholar] [CrossRef]
- He, F.; Chen, S.B.; Ning, Y.S.; Wang, G.L. Rice (Oryza sativa L.) protoplast isolation and its application for transient expression analysis: Rice protoplast isolation and transient expression analysis. Curr. Protoc. Plant Biol. 2016, 1, 373–383. [Google Scholar] [CrossRef] [PubMed]
- Ren, D.Y.; Li, Y.F.; Zhao, F.M.; Sang, X.C.; Shi, J.Q.; Wang, N.; Guo, S.; Ling, Y.H.; Zhang, C.W.; Yang, Z.L.; et al. MULTI-FLORET SPIKELET1, which encodes a AP2/ERF protein, determines spikelet meristem fate and sterile lemma identity in rice. Plant Physiol. 2013, 162, 872–884. [Google Scholar] [CrossRef] [PubMed]
- Cai, Q.; Yuan, Z.; Chen, M.J.; Yin, C.S.; Luo, Z.J.; Zhao, X.X.; Liang, W.Q.; Hu, J.P.; Zhang, D.B. Jasmonic acid regulates spikelet development in rice. Nat. Commun. 2014, 5, 3476. [Google Scholar] [CrossRef]
- Hoshikawa, K. The Growing Rice Plant–An Anatomical Monograph; Nobunkyo Press: Tokyo, Japan, 1989. [Google Scholar]
- Wang, W.M.; Xing, S.C.; Zheng, X.W.; Zhao, X.F.; Zhu, L.H. Morphological and anatomical analyses of a floral organ mutant in rice. Acta Bot. Sin. 2000, 42, 379–382. [Google Scholar]
- Sun, L.P.; Zhang, Y.X.; Zhang, P.P.; Yang, Z.F.; Zhan, X.D.; Shen, X.H.; Zhang, Z.H.; Hu, X.; Xuan, D.D.; Wu, W.X.; et al. Characterization and gene mapping of an open hull male sterile mutant ohms1 caused by alternative splicing in rice. Chin. J. Rice Sci. 2015, 29, 457–466. (In Chinese) [Google Scholar]
- Chen, L.K.; Huang, M.; Liu, Y.Z.; Wang, H.; Chen, Z.Q.; Guo, T. Observation, Genetic analysis and gene mapping of an open hull semi-sterility mutant in rice (Oryza sativa L.). Sci. Agric. Sin. 2016, 49, 1–13. (In Chinese) [Google Scholar]
- Yu, Y.; Piao, R.H.; Jiang, W.Z.; Kim, S.; Koh, H.J. Phenotypic characterization and genetic mapping of an open-hull sterile mutant in rice. Plant Breed. Biotech. 2013, 1, 24–32. [Google Scholar] [CrossRef][Green Version]
- Luo, H.; Lee, J.Y.; Hu, Q.; Kimberly, N.V.; Eitas, T.K.; Lickwar, C.; Albert, P.; Kausch, J.M.; Chandlee, T.K.; Hodges, R.T.S. A rice anther-specific gene is required for male fertility and its promoter sequence directs tissue-specific gene expression in different plant species. Plant Mol. Biol. 2003, 62, 397–408. (In Chinese) [Google Scholar] [CrossRef]
- Nonomura, K.I.; Miyoshi, K.; Eiguchi, M.; Suzuki, T.; Miyao, A.; Hirochika, H.; Kurata, N. The MSP1 gene is necessary to restrict the number of cells entering into male and female sporogenesis and to initiate anther wall formation in rice. Plant Cell 2003, 15, 1728–1739. [Google Scholar] [CrossRef]
- Zhu, Q.H.; Ramm, K.; Skivakkumar, R.; Dennis, E.S.; Upadhyaya, N.M. The ANTHER INDEHISCENCE1 gene encoding a single MYB domain protein is involved in anther development in rice. Plant Physiol. 2004, 135, 1514–1525. [Google Scholar] [CrossRef] [PubMed]
- Jang, S.; Hur, J.; Kim, S.J.; Han, M.J.; Kim, S.R.; An, G. Ectopic expression of OsYAB1 causes extra stamens and carpels in rice. Plant Mol. Biol. 2004, 56, 133–143. [Google Scholar] [CrossRef] [PubMed]
- Kalika, P.; Sriram, P.; Usha, V.H. OsMADS1, a rice MADS-box factor, controls differentiation of specific cell types in the lemma and palea and is an early-acting regulator of inner floral organs. Plant J. 2005, 43, 915–928. [Google Scholar]
- Jung, K.H.; Han, M.J.; Lee, Y.S.; Kim, Y.W.; Hwang, I.; Kim, M.J.; Kim, Y.K.; Nahm, B.H.; An, G. Rice UNDEVELOPED TAPETUML is a major regulator of early tapetum development. Plant Cell 2005, 17, 2705–2722. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Zhang, D.D.; Liu, H.S.; Yin, C.H.; Li, X.X.; Liang, W.Q.; Yuan, Z.; Xu, B.; Chu, H.W.; Wang, J.; et al. The rice TAPETUM DEGENERATION RETAR DATION gene is required for tapetum degradation and anther development. Plant Cell 2006, 18, 2999–3014. [Google Scholar] [CrossRef]
- Lee, S.Y.; Kim, J.; Han, J.J.; Han, M.J.; An, G. Functional analyses of the flowering time gene OsMADS50, the putative suppressor of overexpression of Col/Agamous-Like 20 (SOC1/AGL20) ortholog in rice. Plant J. 2004, 38, 754–764. [Google Scholar] [CrossRef]
- Xu, P.Z.; Wu, T.K.; Ali, A.; Zhang, H.Y.; Liao, Y.X.; Chen, X.Q.; Tian, Y.H.; Wang, W.M.; Fu, X.D.; Li, Y.; et al. Early morning flowering1 (EMF1) regulates the floret opening time by mediating lodicule cell wall formation in rice. Plant Biotechnol. J. 2022, 20, 1441–1443. [Google Scholar] [CrossRef]
- Librojo, A.L.; Khush, G.S. Chromosomal location of some mutant genes through the use of primary trisomics in rice. In Rice Genetics; IRRI: Manila, Philippines, 1986; pp. 249–255. [Google Scholar]
- Kushalappa, K.; Suresh-Kumar, M.B.; Patwardhan, L.; Vijayraghavan, U. Isolation and characterization of genes that control inflorescence. In Rice Genetics III; IRRI: Manila, Philippines, 1996; pp. 888–893. [Google Scholar]
- Nagasawa, N.; Miyoshi, M.; Kitano, H.; Satoh, H.; Nagato, Y. Mutations associated with floral organ number in rice. Planta 1996, 198, 627–633. [Google Scholar] [CrossRef]
- Jiang, L.; Qian, Q.; Mao, L.; Zhou, Q.Y.; Zhai, W.X. Characterization of the rice floral organ number mutant fon3. J. Integr. Plant Biol. 2005, 47, 100–106. [Google Scholar] [CrossRef]
- Li, Y.; Xu, P.Z.; Zhang, H.Y.; Peng, H.; Zhang, Q.F.; Wang, X.D.; Wu, X.J. Characterization and identification of a novel mutant fon(t) on floral organ number and floral organ identity in rice. J. Genet. Genom. 2007, 34, 730–737. [Google Scholar] [CrossRef]
- Wen, W.; Li, S.C.; Wang, S.Q.; He, T.H.; Li, P. Phenotypic and genetic characterization of a Twin-ovary mutant (TOR) in rice. Chin. J. Rice Sci. 2007, 21, 253–258. (In Chinese) [Google Scholar]
- Zhou, M.J.; Wen, Y.; Li, S.C.; Li, C.B.; Zhang, M.H.; Gao, F.Y.; Wang, L.X.; Li, P. Phenotypic characterization and genetic mapping of an increased stigma mutant in rice (Oryza sativa L.). Acta Agron. Sin. 2011, 37, 1779–1784. (In Chinese) [Google Scholar] [CrossRef]
- Yang, C.C.; Liang, R.; Qin, R.; Zeng, D.D.; Jin, X.L.; Shi, C.H. Phenotypical analysis and gene mapping of abnormal floral organ number mutant afon1 in rice (Oryza sativa L.). Sci. Agric. Sin. 2017, 50, 3837–3847. (In Chinese) [Google Scholar]
- Yan, X.C.; Chen, L.K.; Luo, Y.H.; Luo, W.L.; Wang, H.; Guo, T.; Chen, Z.Q. Identification and gene mapping of a floral organ number mutant mf2 in rice (Oryza sativa L.). Acta Agron. Sin. 2018, 44, 169–176. (In Chinese) [Google Scholar] [CrossRef]
- Suzaki, T.; Sato, M.; Asikari, M.; Miyoshi, M.; Nagato, Y.; Hirano, H.Y. The gene FLORAL ORGAN NUMBER1 regulates floral meristem size in rice and encodes a leucine-rich repeat receptor kinase orthologous to Arabidopsis CLAVATA1. Development 2004, 131, 5649–5657. [Google Scholar] [CrossRef]
- Moon, S.; Jung, K.H.; Lee, D.E.; Lee, D.Y.; Lee, J.; An, K.; Kang, H.G.; An, G. The rice FON1 gene controls vegetative and reproductive development by regulating shoot apical meristem size. Mol. Cells 2006, 21, 147–152. [Google Scholar]
- Chu, H.W.; Qian, Q.; Liang, W.Q.; Yin, C.S.; Tan, H.X.; Yao, X.; Yuan, Z.; Yang, J.; Huang, H.; Luo, D.; et al. The FLORAL ORGAN NUMBER 4 gene encoding a putative ortholog of Arabidopsis CLAVATA3 regulates apical meristem size in rice. Plant Physiol. 2006, 142, 1039–1052. [Google Scholar] [CrossRef]
- Xu, W.; Tao, J.H.; Chen, M.J.; Dreni, L.; Luo, Z.J.; Hu, Y.; Liang, W.Q.; Zhang, D.B. Interactions between FLORAL ORGAN NUMBER 4 and floral homeotic genes in regulating rice flower development. J. Exp. Bot. 2017, 68, 483–498. [Google Scholar] [CrossRef]
- Ren, D.Y.; Xu, Q.K.; Qiu, Z.N.; Cui, Y.J.; Zhou, T.T.; Zeng, D.L.; Guo, L.B.; Qian, Q. FON4 prevents the multi-floret spikelet in rice. Plant Biotechnol. J. 2019, 17, 1007–1009. [Google Scholar] [CrossRef]
- Zhang, T.; Li, Y.F.; Ma, L.; Sang, X.C.; Ling, Y.H.; Wang, Y.T.; Yu, W.; Zhuang, H.; Huang, J.Y.; Wang, N.; et al. LATERAL FLORET1 induced the three-floret spikelet in rice. Proc. Natl. Acad. Sci. USA 2017, 114, 9984–9989. [Google Scholar] [CrossRef]
- Shen, Z.T. Crop Breeding Experiment; China Agriculture Press: Beijing, China, 1995. (In Chinese) [Google Scholar]
- Chen, X.; Temnykh, S.; Xu, Y.; Cho, Y.; McCouch, S. Development of a microsatellite framework map providing genome-wide coverage in rice (Oryza sativa L.). Theor. Appl. Genet. 1997, 95, 553–567. [Google Scholar] [CrossRef]
- Li, Q.; Wan, J.M. SSRHunter: Development of a local searching software for SSR sites. Hereditas 2005, 27, 808–810. (In Chinese) [Google Scholar] [PubMed]
- Xu, S.; Tao, Y.; Yang, Z.; Chu, J. A simple and rapid methods used for silver staining and gel preservation. Hereditas 2002, 24, 335–336. (In Chinese) [Google Scholar] [PubMed]
- Li, H.H.; Ribaut, J.M.; Li, Z.H.; Wang, J.K. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet. 2008, 116, 243–260. [Google Scholar] [CrossRef] [PubMed]
- Jeon, J.S.; Jang, S.; Lee, S.; Lee, S.; Nam, J.; Kim, C.; Lee, S.H.; Chung, Y.Y.; Kim, S.R.; Lee, Y.H.; et al. Ieafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development. Plant Cell 2000, 12, 871–884. [Google Scholar]
- Prasad, K.; Sriram, P.; Kumar, S.C.; Kushalappa, K.; Vijayraghavan, U. Ectopic expression of rice OsMADS1 reveals a role in specifying the lemma and palea, grass floral organs analogous to sepals. Dev. Genes Evol. 2001, 211, 281–290. [Google Scholar] [CrossRef]
Genotypes | HD | PH | PL | PP | FGP | EGP | SP | GSR | GSD | 1000-GW | GYMP | GYP |
---|---|---|---|---|---|---|---|---|---|---|---|---|
d | ————cm———— | —————n————— | % | ————g———— | ||||||||
RJ35 | 124.40 ± 1.02 A | 91.43 ± 1.00 A | 19.95 ± 0.64 A | 8.34 ± 0.33 A | 208.12 ± 4.84 A | 15.99 ± 1.89 B | 247.16 ± 26.66 A | 85.12 ± 9.15 A | 12.40 ± 1.42 A | 22.90 ± 0.37 C | 3.93 ± 0.11 A | 26.86 ± 0.27 A |
XQZB | 82.00 ± 1.41 B | 74.92 ± 0.65 B | 20.45 ± 1.01 A | 8.04 ± 0.64 A | 97.28 ± 7.24 B | 10.72 ± 0.74 C | 104.00 ± 1.41 B | 93.47 ± 5.76 A | 5.10 ± 0.24 B | 26.70 ± 0.57 BC | 1.98 ± 0.12 B | 24.16 ± 0.20 A |
mp3 | 84.40 ± 1.02 B | 74.70 ± 0.75 B | 19.42 ± 0.47 A | 7.60 ± 1.02 A | 62.90 ± 1.69 C | 41.10 ± 1.28 A | 104.00 ± 1.41 B | 60.48 ± 1.48 B | 5.36 ± 0.13 B | 36.87 ± 0.31 A | 1.88 ± 0.05 B | 13.42 ± 0.18 B |
Genotypes | GL | GW | GT | LWR | 1000-GW |
---|---|---|---|---|---|
—————mm————— | g | ||||
RJ35 | 7.23 ± 0.24 C | 3.23± 0.13 C | 2.28 ± 0.13 B | 2.21 ± 0.08 B | 22.90 ± 0.37 C |
XQZB | 9.85 ± 0.14 A | 2.55 ± 0.06 D | 2.06 ± 0.05 C | 3.86 ± 0.13 A | 26.70 ± 0.57 BC |
mp3 | 8.02 ± 0.30 B | 5.91 ± 0.46 A | 2.30 ± 0.07 B | 1.36 ± 0.06 D | 36.87 ± 0.31 A |
02428 | 7.34 ± 0.21 C | 3.87 ± 0.08 B | 2.52 ± 0.07 A | 1.90 ± 0.07 C | 26.07 ± 0.61 BC |
02428/mp3 F1 | 7.63 ± 0.12 BC | 3.67 ± 0.16 BC | 2.28 ± 0.10 B | 2.08 ± 0.12 BC | 27.47 ± 0.52 B |
Cross Combinations | F1 Plant | F2 Population | x23:1 | x20.05 | ||
---|---|---|---|---|---|---|
Total | Normal Plant | Mutant Plant | ||||
02428×mp3 | Normal | 5785 | 4368 | 1417 | 0.79 | 3.84 |
Nippobare×mp3 | Normal | 472 | 355 | 117 | 0.03 |
Primers | GP (bp) | Forward 5′-3′ | Reverse3′-5′ | Purpose |
---|---|---|---|---|
RM3467 | 6003496 | ATAATGGCAGGGTTGTCTCG | CTCGGTGAGCCTCCTACAAC | Fine mapping |
L3-118 | 6012517 | GAATTGGGAACTCCCGCCTA | TCATGACACTATCCTGCACCA | Fine mapping |
L3-132 | 6043090 | TTGCCTGTTTTCCGAGTTGAC | AGCTTCCAGCTCTAGCACATT | Fine mapping |
L3-135 | 6048599 | CGGAGCTTCTGTTCATGTGTC | GACTGCTTCTTGTACGACGAC | Fine mapping |
RM7576 | 6078216 | CTGCCCTGCCTTTTGTACAC | GCGAGCATTCTTTCTTCCAC | Fine mapping |
L3-95 | 6127475 | TCGAGGAATGATTTCACTTTCCCA | TGCAGCTAGAGAATGGTCGAT | Fine mapping |
L3-97 | 6239662 | TAACGGCCAGTCACTCTCCA | CGATTCCGACGACAAGGAGT | Fine mapping |
L3-101 | 6240244 | GCACGATTGATCACAGCTCG | TGCATGAAACCGACACCGAT | Fine mapping |
L3-52 | 6812449 | GGCAGCCCACTACAAGTCTA | ACGAACGGGAAGTGCAAGAA | Fine mapping |
RM7197 | 9888524 | AACGTGGGAATTTCTAGCCC | GTTTTGGGCCTAAACGAGTG | Fine mapping |
GS2 | 6066335-6069291 | ACAGCCGAGGGCAAGATAAG | CACTTGGGTCGTTGCTACAAA | LOC_Os03g11630 |
GS5 | 6071382-6073151 | CAAATTTGTGCAGGCAGCCA | GCGTGGAACTTTGTTGCTCC | LOC_Os03g11640 |
GS6 | 6041245-6048687 | GCTAGGGCTAGCTTGCTTGT | TGGCCTGGAATCTGTTCCAAA | LOC_Os03g11600 |
GS7 | 6041245-6048687 | TGAAGGGTCTCTCTGTTTCCAG | AATTTGGTACTCTCCCCAGTG | LOC_Os03g11600 |
GS18 | 6041245-6048687 | ATGCATGGCAAGCGTTTGAG | ACAGTGTCTTGGCTAGGATTCG | LOC_Os03g11600 |
GS9 | 6052750-6061369 | CTGAGTGTCAATCCCCACCTTT | GGACACTGTTTGCATTGGCTT | LOC_Os03g11614 |
GS47 | 6052750-6061369 | TTAAGTGTGTGGACGAGCGA | ACATTGTCCTAAACGACTTCCT | LOC_Os03g11614 |
GS52 | 6052750-6061369 | CTCCAATTCTACCGCTGGCT | CCGATGCATGCAGGACTAGC | LOC_Os03g11614 |
GS64 | 6050750-6052750 | AGATGTGCAAAATAATGCTGGA | ACGTACCATGATGAGCTGGA | LOC_Os03g11614 (Promoter) |
TIGR Rice Locus | Putative Function |
---|---|
LOC_Os03g11600 | YABBY domain-containing protein, putative, expressed |
LOC_Os03g11614 | OsMADS1-MADS-box family gene with MIKCc type-box, expressed |
LOC_Os03g11630 | Transposon protein, putative, Mutator sub-class, expressed |
LOC_Os03g11640 | Hypothetical protein |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, Y.; Gong, J.; Yan, Y.; Peng, T.; Xiao, J.; Wang, S.; Nan, W.; Qin, X.; Zhang, H. Fine Mapping and Candidate-Gene Analysis of an open glume multi-pistil 3 (mp3) in Rice (Oryza sativa L.). Agriculture 2022, 12, 1731. https://doi.org/10.3390/agriculture12101731
Liang Y, Gong J, Yan Y, Peng T, Xiao J, Wang S, Nan W, Qin X, Zhang H. Fine Mapping and Candidate-Gene Analysis of an open glume multi-pistil 3 (mp3) in Rice (Oryza sativa L.). Agriculture. 2022; 12(10):1731. https://doi.org/10.3390/agriculture12101731
Chicago/Turabian StyleLiang, Yongshu, Junyi Gong, Yuxin Yan, Tingshen Peng, Jinyu Xiao, Shuang Wang, Wenbin Nan, Xiaojian Qin, and Hanma Zhang. 2022. "Fine Mapping and Candidate-Gene Analysis of an open glume multi-pistil 3 (mp3) in Rice (Oryza sativa L.)" Agriculture 12, no. 10: 1731. https://doi.org/10.3390/agriculture12101731
APA StyleLiang, Y., Gong, J., Yan, Y., Peng, T., Xiao, J., Wang, S., Nan, W., Qin, X., & Zhang, H. (2022). Fine Mapping and Candidate-Gene Analysis of an open glume multi-pistil 3 (mp3) in Rice (Oryza sativa L.). Agriculture, 12(10), 1731. https://doi.org/10.3390/agriculture12101731