Improved Composite Hydrogel for Bioengineered Tracheal Graft Demonstrates Effective Early Angiogenesis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Hydrogel Construct Creation
2.3. Assessment of Fibroblast Migration and Angiogenesis
2.4. Statistical Analysis
3. Results
3.1. Fibroblast Migration
3.2. Angiogenesis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kirschbaum, A.; Teymoortash, A.; Suárez, C.; Shah, J.P.; Silver, C.E.; Nixon, I.; Rinaldo, A.; Kowalski, L.P.; Robbins, K.T.; Ferlito, A. Treatment of large tracheal defects after resection: Laryngotracheal release and tracheal replacement. Auris Nasus Larynx 2016, 43, 602–608. [Google Scholar] [CrossRef] [PubMed]
- Haykal, S.; Salna, M.; Waddell, T.K.; Hofer, S.O. Advances in Tracheal Reconstruction. Plast. Reconstr. Surg.–Glob. Open 2014, 2, e178. [Google Scholar] [CrossRef] [PubMed]
- Fabre, D.; Kolb, F.; Fadel, E.; Mercier, O.; Mussot, S.; Le Chevalier, T.; Dartevelle, P. Successful tracheal replacement in humans using autologous tissues: An 8-year experience. Ann. Thorac. Surg. 2013, 96, 1146–1155. [Google Scholar] [CrossRef]
- Jacobs, J.P.; Quintessenza, J.A.; Andrews, T.; Burke, R.P.; Spektor, Z.; Delius, R.E.; Smith, R.J.; Elliott, M.J.; Herberhold, C. Tracheal allograft reconstruction: The total North American and worldwide pediatric experiences. Ann. Thorac. Surg. 1999, 68, 1043–1051, discussion 1052. [Google Scholar] [CrossRef]
- Al Shetawi, A.H.; Weber, J.; Baig, M.Z.; Muslim, Z.; Bhora, F.Y. Advances in tracheal reconstruction and tissue engineering. Plast. Aesthetic Res. 2021, 8, 38. [Google Scholar] [CrossRef]
- Weber, J.F.; Rehmani, S.S.; Baig, M.Z.; Jadoon, Y.; Bhora, F.Y. Successes and Failures in Tracheal Bioengineering: Lessons Learned. Ann. Thorac. Surg. 2021, 112, 1089–1094. [Google Scholar] [CrossRef]
- Gao, M.; Zhang, H.; Dong, W.; Bai, J.; Gao, B.; Xia, D.; Feng, B.; Chen, M.; He, X.; Yin, M.; et al. Tissue-engineered trachea from a 3D-printed scaffold enhances whole-segment tracheal repair. Sci. Rep. 2017, 7, 5246. [Google Scholar] [CrossRef]
- Belsey, R. Resection and reconstruction of the intrathoracic trachea. Br. J. Surg. 1950, 38, 200–205. [Google Scholar] [CrossRef]
- Cosson, S.; Otte, E.A.; Hezaveh, H.; Cooper-White, J.J. Concise review: Tailoring bioengineered scaffolds for stem cell applications in tissue engineering and regenerative medicine. Stem Cells Transl. Med. 2015, 4, 156–164. [Google Scholar] [CrossRef]
- Schöneberg, J.; De Lorenzi, F.; Theek, B.; Blaeser, A.; Rommel, D.; Kuehne, A.J.C.; Kießling, F.; Fischer, H. Engineering biofunctional in vitro vessel models using a multilayer bioprinting technique. Sci. Rep. 2018, 8, 10430. [Google Scholar] [CrossRef]
- Hortensius, R.A.; Harley, B.A. Naturally derived biomaterials for addressing inflammation in tissue regeneration. Exp. Biol. Med. 2016, 241, 1015–1024. [Google Scholar] [CrossRef]
- Abedin, M.; Tintut, Y.; Demer, L.L. Mesenchymal Stem Cells and the Artery Wall. Circ. Res. 2004, 95, 671–676. [Google Scholar] [CrossRef] [PubMed]
- Krock, B.L.; Skuli, N.; Simon, M.C. Hypoxia-induced angiogenesis: Good and evil. Genes Cancer 2011, 2, 1117–1133. [Google Scholar] [CrossRef]
- Sottile, J. Regulation of angiogenesis by extracellular matrix. Biochim. Biophys. Acta 2004, 1654, 13–22. [Google Scholar] [CrossRef]
- Gilkes, D.M.; Bajpai, S.; Chaturvedi, P.; Wirtz, D.; Semenza, G.L. Hypoxia-inducible factor 1 (HIF-1) promotes extracellular matrix remodeling under hypoxic conditions by inducing P4HA1, P4HA2, and PLOD2 expression in fibroblasts. J. Biol. Chem. 2013, 288, 10819–10829. [Google Scholar] [CrossRef] [PubMed]
- Eckermann, C.W.; Lehle, K.; Schmid, S.A.; Wheatley, D.N.; Kunz-Schughart, L.A. Characterization and modulation of fibroblast/endothelial cell co-cultures for the in vitro preformation of three-dimensional tubular networks. Cell Biol. Int. 2011, 35, 1097–1110. [Google Scholar] [CrossRef] [PubMed]
- Langer, R.; Vacanti, J.P. Tissue engineering. Science 1993, 260, 920–926. [Google Scholar] [CrossRef]
- El-Sherbiny, I.M.; Yacoub, M.H. Hydrogel scaffolds for tissue engineering: Progress and challenges. Glob. Cardiol. Sci. Pract. 2013, 2013, 316–342. [Google Scholar] [CrossRef] [PubMed]
- Jang, T.S.; Jung, H.D.; Pan, H.M.; Han, W.T.; Chen, S.; Song, J. 3D printing of hydrogel composite systems: Recent advances in technology for tissue engineering. Int. J. Bioprinting 2018, 4, 126. [Google Scholar] [CrossRef]
- Jiang, L.; Wang, Y.; Liu, Z.; Ma, C.; Yan, H.; Xu, N.; Gang, F.; Wang, X.; Zhao, L.; Sun, X. Three-Dimensional Printing and Injectable Conductive Hydrogels for Tissue Engineering Application. Tissue Eng. Part B Rev. 2019, 25, 398–411. [Google Scholar] [CrossRef] [PubMed]
- Bhora, F.Y.; Lewis, E.E.; Rehmani, S.S.; Ayub, A.; Raad, W.; Al-Ayoubi, A.M.; Lebovics, R.S. Circumferential Three-Dimensional–Printed Tracheal Grafts: Research Model Feasibility and Early Results. Ann. Thorac. Surg. 2017, 104, 958–963. [Google Scholar] [CrossRef] [PubMed]
- Al-Ayoubi, A.M.; Rehmani, S.S.; Sinclair, C.F.; Lebovics, R.S.; Bhora, F.Y. Reconstruction of Anterior Tracheal Defects Using a Bioengineered Graft in a Porcine Model. Ann. Thorac. Surg. 2017, 103, 381–389. [Google Scholar] [CrossRef] [PubMed]
- Weber, J.F.; Rehmani, S.S.; Baig, M.Z.; Lebovics, R.; Raad, W.; Connery, C.; Bhora, F.Y. Novel composite trachea grafts using 3-dimensional printing. JTCVS Open 2021, 5, 152–160. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Lv, Y. Application of Collagen Scaffold in Tissue Engineering: Recent Advances and New Perspectives. Polymers 2016, 8, 42. [Google Scholar] [CrossRef]
- Zarrintaj, P.; Manouchehri, S.; Ahmadi, Z.; Saeb, M.R.; Urbanska, A.M.; Kaplan, D.L.; Mozafari, M. Agarose-based biomaterials for tissue engineering. Carbohydr. Polym. 2018, 187, 66–84. [Google Scholar] [CrossRef] [PubMed]
- Cambria, E.; Brunner, S.; Heusser, S.; Fisch, P.; Hitzl, W.; Ferguson, S.J.; Wuertz-Kozak, K. Cell-Laden Agarose-Collagen Composite Hydrogels for Mechanotransduction Studies. Front. Bioeng. Biotechnol. 2020, 8, 346. [Google Scholar] [CrossRef]
- Kreimendahl, F.; Köpf, M.; Thiebes, A.L.; Duarte Campos, D.F.; Blaeser, A.; Schmitz-Rode, T.; Apel, C.; Jockenhoevel, S.; Fischer, H. Three-Dimensional Printing and Angiogenesis: Tailored Agarose-Type I Collagen Blends Comprise Three-Dimensional Printability and Angiogenesis Potential for Tissue-Engineered Substitutes. Tissue Eng. Part C Methods 2017, 23, 604–615. [Google Scholar] [CrossRef]
- Kniebs, C.; Kreimendahl, F.; Köpf, M.; Fischer, H.; Jockenhoevel, S.; Thiebes, A.L. Influence of Different Cell Types and Sources on Pre-Vascularisation in Fibrin and Agarose-Collagen Gels. Organogenesis 2020, 16, 14–26. [Google Scholar] [CrossRef]
- Sattari, S.; Mariano, C.A.; Eskandari, M. Biaxial mechanical properties of the bronchial tree: Characterization of elasticity, extensibility, and energetics, including the effect of strain rate and preconditioning. Acta Biomater. 2023, 155, 410–422. [Google Scholar] [CrossRef] [PubMed]
- Teng, Z.; Trabelsi, O.; Ochoa, I.; He, J.; Gillard, J.H.; Doblare, M. Anisotropic material behaviours of soft tissues in human trachea: An experimental study. J. Biomech. 2012, 45, 1717–1723. [Google Scholar] [CrossRef]
- Quarta, A.; Gallo, N.; Vergara, D.; Salvatore, L.; Nobile, C.; Ragusa, A.; Gaballo, A. Investigation on the Composition of Agarose-Collagen I Blended Hydrogels as Matrices for the Growth of Spheroids from Breast Cancer Cell Lines. Pharmaceutics 2021, 13, 963. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Hong, Y. Enhancing cell infiltration of electrospun fibrous scaffolds in tissue regeneration. Bioact. Mater. 2016, 1, 56–64. [Google Scholar] [CrossRef] [PubMed]
- Sharma, V.P.; Tang, B.; Wang, Y.; Duran, C.L.; Karagiannis, G.S.; Xue, E.A.; Entenberg, D.; Borriello, L.; Coste, A.; Eddy, R.J.; et al. Live tumor imaging shows macrophage induction and TMEM-mediated enrichment of cancer stem cells during metastatic dissemination. Nat. Commun. 2021, 12, 7300. [Google Scholar] [CrossRef]
- Giraudo, M.V.; Di Francesco, D.; Catoira, M.C.; Cotella, D.; Fusaro, L.; Boccafoschi, F. Angiogenic Potential in Biological Hydrogels. Biomedicines 2020, 8, 436. [Google Scholar] [CrossRef] [PubMed]
- Monteiro, M.V.; Gaspar, V.M.; Ferreira, L.P.; Mano, J.F. Hydrogel 3D in vitro tumor models for screening cell aggregation mediated drug response. Biomater. Sci. 2020, 8, 1855–1864. [Google Scholar] [CrossRef]
- Hannan, R.T.; Peirce, S.M.; Barker, T.H. Fibroblasts: Diverse Cells Critical to Biomaterials Integration. ACS Biomater. Sci. Eng. 2018, 4, 1223–1232. [Google Scholar] [CrossRef]
- Wang, C.; Varshney, R.R.; Wang, D.A. Therapeutic cell delivery and fate control in hydrogels and hydrogel hybrids. Adv. Drug Deliv. Rev. 2010, 62, 699–710. [Google Scholar] [CrossRef]
- Gille, H.; Kowalski, J.; Li, B.; LeCouter, J.; Moffat, B.; Zioncheck, T.F.; Pelletier, N.; Ferrara, N. Analysis of biological effects and signaling properties of Flt-1 (VEGFR-1) and KDR (VEGFR-2). A reassessment using novel receptor-specific vascular endothelial growth factor mutants. J. Biol. Chem. 2001, 276, 3222–3230. [Google Scholar] [CrossRef]
- Matsumoto, T.; Mugishima, H. Signal transduction via vascular endothelial growth factor (VEGF) receptors and their roles in atherogenesis. J. Atheroscler. Thromb. 2006, 13, 130–135. [Google Scholar] [CrossRef]
- Lohela, M.; Bry, M.; Tammela, T.; Alitalo, K. VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr. Opin. Cell Biol. 2009, 21, 154–165. [Google Scholar] [CrossRef]
- Vestweber, D. VE-cadherin: The major endothelial adhesion molecule controlling cellular junctions and blood vessel formation. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 223–232. [Google Scholar] [CrossRef]
- Wallez, Y.; Vilgrain, I.; Huber, P. Angiogenesis: The VE-cadherin switch. Trends Cardiovasc. Med. 2006, 16, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Santibáñez-Salgado, J.A.; Sotres-Vega, A.; Gaxiola-Gaxiola, M.O.; Villalba-Caloca, J.; Lozoya, K.B.; Zúñiga-Ramos, J.A. Experimental Tracheal Replacement: Angiogenesis and Null Apoptosis Promote Stenosis. J. Chest Surg. 2021, 54, 191–199. [Google Scholar] [CrossRef]
- Shinde, A.V.; Humeres, C.; Frangogiannis, N.G. The role of α-smooth muscle actin in fibroblast-mediated matrix contraction and remodeling. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 298–309. [Google Scholar] [CrossRef] [PubMed]
- Augustin, H.G.; Koh, G.Y.; Thurston, G.; Alitalo, K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat. Rev. Mol. Cell Biol. 2009, 10, 165–177. [Google Scholar] [CrossRef] [PubMed]
- Coffman, L.G.; Parsonage, D.; D’Agostino, R., Jr.; Torti, F.M.; Torti, S.V. Regulatory effects of ferritin on angiogenesis. Proc. Natl. Acad. Sci. USA 2009, 106, 570–575. [Google Scholar] [CrossRef]
- Oliviero, O.; Ventre, M.; Netti, P.A. Functional porous hydrogels to study angiogenesis under the effect of controlled release of vascular endothelial growth factor. Acta Biomater. 2012, 8, 3294–3301. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
TIE1 | ATGGCTGCTCTTGTGGATCTGG | CGGTCACAAGTGCCACCATTCT |
CDH5 | GAAGCCTCTGATTGGCACAGTG | TTTTGTGACTCGGAAGAACTGGC |
FTL | TACGAGCGTCTCCTGAAGATGC | GGTTCAGCTTTTTCTCCAGGGC |
ACTA2 | CTATGCCTCTGGACGCACAACT | CAGATCCAGACGCATGATGGCA |
VEGF | TTGCCTTGCTGCTCTACCTCCA | GATGGCAGTAGCTGCGCTGATA |
Hydrogel Composition | 1 mg/mL T1 Collagen & 0.125% Agarose | 2 mg/mL T1 Collagen & 0.125% Agarose | p-Value |
---|---|---|---|
Day 1 (Mean ± SD/Median [Q1–Q3]) | 29.7 ± 34.0 µm 16.2 [9.2–42.0] µm | 52.5 ± 46.4 µm 40.4 [16.2–80.6] µm | 0.001 |
Day 4 (Mean ± SD/Median [Q1–Q3]) | 35.8 ± 44.6 µm 19.5 [6.9–43.9] µm | 29.4 ± 26.9 µm 21.5 [9.3–41.2] µm | 0.836 |
Day 7 (Mean ± SD/Median [Q1–Q3]) | 25.3 ± 32.6 µm 11.4 [5.4–38.9] µm | 38.5 ± 38.9 µm 28.1 [5.0–58.2] µm | 0.073 |
Genes | 1 mg/mL T1 Collagen & 0.25% Agarose | 1 mg/mL T1 Collagen & 0.125% Agarose | 2 mg/mL T1 Collagen & 0.25% Agarose | 2 mg/mL T1 Collagen & 0.125% Agarose | p-Value | |
---|---|---|---|---|---|---|
TIE1 | Fold Change | −3.03 | −3.70 | +1.21 | −3.45 | <0.001 |
Log2 (Fold Change) | −1.61 | −1.91 | +0.27 | −1.80 | ||
CDH5 | Fold Change | +2.75 | +12.13 | −1.52 | +10.27 | <0.001 |
Log2 (Fold Change) | +1.46 | +3.60 | −0.61 | +3.36 | ||
FTL | Fold Change | −43.47 | −2.17 | 0% * | −43.47 | <0.001 |
Log2 (Fold Change) | −5.30 | −1.12 | - | −5.30 | ||
ACTA2 | Fold Change | +2.17 | +47.50 | −1.32 | +18.64 | <0.001 |
Log2 (Fold Change) | +1.12 | +5.57 | −0.39 | +4.22 | ||
VEGF | Fold Change | +1.52 | +12.13 | 0% * | +2.48 | <0.001 |
Log2 (Fold Change) | +0.60 | +3.60 | - | +1.31 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martins, R.S.; Weber, J.; Drake, L.; Latif, M.J.; Poulikidis, K.; Razi, S.S.; Luo, J.; Bhora, F.Y. Improved Composite Hydrogel for Bioengineered Tracheal Graft Demonstrates Effective Early Angiogenesis. J. Clin. Med. 2024, 13, 5148. https://doi.org/10.3390/jcm13175148
Martins RS, Weber J, Drake L, Latif MJ, Poulikidis K, Razi SS, Luo J, Bhora FY. Improved Composite Hydrogel for Bioengineered Tracheal Graft Demonstrates Effective Early Angiogenesis. Journal of Clinical Medicine. 2024; 13(17):5148. https://doi.org/10.3390/jcm13175148
Chicago/Turabian StyleMartins, Russell Seth, Joanna Weber, Lauren Drake, M. Jawad Latif, Kostantinos Poulikidis, Syed Shahzad Razi, Jeffrey Luo, and Faiz Y. Bhora. 2024. "Improved Composite Hydrogel for Bioengineered Tracheal Graft Demonstrates Effective Early Angiogenesis" Journal of Clinical Medicine 13, no. 17: 5148. https://doi.org/10.3390/jcm13175148
APA StyleMartins, R. S., Weber, J., Drake, L., Latif, M. J., Poulikidis, K., Razi, S. S., Luo, J., & Bhora, F. Y. (2024). Improved Composite Hydrogel for Bioengineered Tracheal Graft Demonstrates Effective Early Angiogenesis. Journal of Clinical Medicine, 13(17), 5148. https://doi.org/10.3390/jcm13175148