Identification of S100A9 as a Potential Inflammation-Related Biomarker for Radiation-Induced Lung Injury
Abstract
1. Introduction
2. Materials and Methods
2.1. Microarray Data Acquisition and DEGs Identification
2.2. GO and Pathway Enrichment Analyses
2.3. PPI Network Creation and Hub Gene Identification
2.4. Animals
2.5. Lung Irradiation Protocol
2.6. Sampling
2.7. Histopathology and Immunofluorescence
2.8. Real-Time Quantitative RT-PCR and ELISA
2.9. Statistical Analysis
3. Results
3.1. Determination of DEGs in RILI
3.2. Functional Enrichment Analysis of Shared DEGs
3.3. The Screening of Inflammation-Related Hub Genes and Involved Pathways via PPI Network Analysis
3.4. Construction of the RILI Mouse Model
3.5. Identification of S100A9 as a Potential Biomarker for RILI
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shen, T.L.; Liu, M.N.; Zhang, Q.; Feng, W.; Yu, W.; Fu, X.L.; Cai, X.W. The positive role of vitronectin in radiation induced lung toxicity: The in vitro and in vivo mechanism study. J. Transl. Med. 2018, 16, 100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carter, C.L.; Jones, J.W.; Farese, A.M.; MacVittie, T.J.; Kane, M.A. Lipidomic dysregulation within the lung parenchyma following whole-thorax lung irradiation: Markers of injury, inflammation and fibrosis detected by MALDI-MSI. Sci. Rep. 2017, 7, 10343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.; Zhu, Y.; Wang, J.; Hou, L.; Li, W.; An, H. CXCR4-Overexpressing Umbilical Cord Mesenchymal Stem Cells Enhance Protection against Radiation-Induced Lung Injury. Stem Cells Int. 2019, 2019, 2457082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, D.; Zhang, Y.; Cao, R.; Hao, Y.; Yang, X.; Tian, T.; Zhang, J. The protective effects of granulocyte-macrophage colony-stimulating factor against radiation-induced lung injury. Transl. Lung Cancer Res. 2020, 9, 2440–2459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, G.; Liang, N.; Xie, J.; Luo, H.; Qiao, L.; Zhang, J.; Wang, D.; Zhang, J. Pulmonary toxicity generated from radiotherapeutic treatment of thoracic malignancies. Oncol. Lett. 2017, 14, 501–511. [Google Scholar] [CrossRef] [Scilit]
- Medhora, M.; Haworth, S.; Liu, Y.; Narayanan, J.; Gao, F.; Zhao, M.; Audi, S.; Jacobs, E.R.; Fish, B.L.; Clough, A.V. Biomarkers for Radiation Pneumonitis Using Noninvasive Molecular Imaging. J. Nucl. Med. 2016, 57, 1296–1301. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.; Park, S.H.; Han, S.Y.; Lee, Y.S.; Cho, J.; Kim, J.M. LXA4-FPR2 signaling regulates radiation-induced pulmonary fibrosis via crosstalk with TGF-beta/Smad signaling. Cell Death Dis. 2020, 11, 653. [Google Scholar] [CrossRef] [Scilit]
- Wirsdorfer, F.; Cappuccini, F.; Niazman, M.; de Leve, S.; Westendorf, A.M.; Ludemann, L.; Stuschke, M.; Jendrossek, V. Thorax irradiation triggers a local and systemic accumulation of immunosuppressive CD4+ FoxP3+ regulatory T cells. Radiat. Oncol. 2014, 9, 98. [Google Scholar] [CrossRef] [Scilit]
- Giuranno, L.; Ient, J.; De Ruysscher, D.; Vooijs, M.A. Radiation-Induced Lung Injury (RILI). Front. Oncol. 2019, 9, 877. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Shao, C.; Fu, J. Promising Biomarkers of Radiation-Induced Lung Injury: A Review. Biomedicines 2021, 9, 1181. [Google Scholar] [CrossRef] [Scilit]
- Guo, T.; Zou, L.; Ni, J.; Zhou, Y.; Ye, L.; Yang, X.; Zhu, Z. Regulatory T Cells: An Emerging Player in Radiation-Induced Lung Injury. Front. Immunol. 2020, 11, 1769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathew, B.; Jacobson, J.R.; Berdyshev, E.; Huang, Y.; Sun, X.; Zhao, Y.; Gerhold, L.M.; Siegler, J.; Evenoski, C.; Wang, T.; et al. Role of sphingolipids in murine radiation-induced lung injury: Protection by sphingosine 1-phosphate analogs. FASEB J. 2011, 25, 3388–3400. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Citrin, D.E.; Shankavaram, U.; Horton, J.A.; Shield, W., 3rd; Zhao, S.; Asano, H.; White, A.; Sowers, A.; Thetford, A.; Chung, E.J. Role of type II pneumocyte senescence in radiation-induced lung fibrosis. J. Natl. Cancer Inst. 2013, 105, 1474–1484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Guo, S.; Tong, S.; Sun, X. Promoting Osteogenic Differentiation of Human Adipose-Derived Stem Cells by Altering the Expression of Exosomal miRNA. Stem Cells Int. 2019, 2019, 1351860. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Guo, H.; Liu, B.; Liu, N.; Xu, Z.; Wang, Y.; Zhou, H. Explore prognostic biomarker of bladder cancer based on competing endogenous network. Biosci. Rep. 2020, 40, BSR20202463. [Google Scholar] [CrossRef] [Scilit]
- Heinzelmann, F.; Jendrossek, V.; Lauber, K.; Nowak, K.; Eldh, T.; Boras, R.; Handrick, R.; Henkel, M.; Martin, C.; Uhlig, S.; et al. Irradiation-induced pneumonitis mediated by the CD95/CD95-ligand system. J. Natl. Cancer Inst. 2006, 98, 1248–1251. [Google Scholar] [CrossRef] [Scilit]
- Jiao, Y.; Liu, C.; Cui, F.M.; Xu, J.Y.; Tong, J.; Qi, X.F.; Wang, L.L.; Zhu, W. Long intergenic non-coding RNA induced by X-ray irradiation regulates DNA damage response signaling in the human bronchial epithelial BEAS-2B cell line. Oncol. Lett. 2015, 9, 169–176. [Google Scholar] [CrossRef] [Scilit]
- Oray, M.; Abu Samra, K.; Ebrahimiadib, N.; Meese, H.; Foster, C.S. Long-term side effects of glucocorticoids. Expert Opin. Drug Saf. 2016, 15, 457–465. [Google Scholar] [CrossRef] [Scilit]
- Roy, S.; Salerno, K.E.; Citrin, D.E. Biology of Radiation-Induced Lung Injury. Semin. Radiat. Oncol. 2021, 31, 155–161. [Google Scholar] [CrossRef] [Scilit]
- Masuda, Y.; Kamiya, K. Molecular nature of radiation injury and DNA repair disorders associated with radiosensitivity. Int. J. Hematol. 2012, 95, 239–245. [Google Scholar] [CrossRef] [Scilit]
- Burnette, B.; Weichselbaum, R.R. Radiation as an immune modulator. Semin. Radiat. Oncol. 2013, 23, 273–280. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruterbusch, M.; Pruner, K.B.; Shehata, L.; Pepper, M. In Vivo CD4(+) T Cell Differentiation and Function: Revisiting the Th1/Th2 Paradigm. Annu. Rev. Immunol. 2020, 38, 705–725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, T.; Zhang, Y.; Chang, P.; Gong, S.; Shao, L.; Dong, L. Mesenchymal stem cell-based therapy for radiation-induced lung injury. Stem Cell Res. Ther. 2018, 9, 18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, N.H.; Li, J.J.; Sun, L.Q. Molecular mechanisms and treatment of radiation-induced lung fibrosis. Curr. Drug Targets 2013, 14, 1347–1356. [Google Scholar] [CrossRef] [Scilit]
- Straub, J.M.; New, J.; Hamilton, C.D.; Lominska, C.; Shnayder, Y.; Thomas, S.M. Radiation-induced fibrosis: Mechanisms and implications for therapy. J. Cancer Res. Clin. Oncol. 2015, 141, 1985–1994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, Z.; Zhang, Z.; Wang, Y. T cell receptor signaling pathway and cytokine-cytokine receptor interaction affect the rehabilitation process after respiratory syncytial virus infection. PeerJ 2019, 7, e7089. [Google Scholar] [CrossRef] [Scilit]
- Dey, R.; Ji, K.; Liu, Z.; Chen, L. A cytokine-cytokine interaction in the assembly of higher-order structure and activation of the interleukine-3:receptor complex. PLoS ONE 2009, 4, e5188. [Google Scholar] [CrossRef] [Scilit]
- Bass, W.T.; Buescher, E.S.; Hair, P.S.; White, L.E.; Welch, J.C.; Burke, B.L. Proinflammatory cytokine-receptor interaction model improves the predictability of cerebral white matter injury in preterm infants. Am. J. Perinatol. 2008, 25, 211–218. [Google Scholar] [CrossRef] [Scilit]
- McGeachy, M.J.; Cua, D.J.; Gaffen, S.L. The IL-17 Family of Cytokines in Health and Disease. Immunity 2019, 50, 892–906. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Frantz, A.M.; Anderson, K.L.; Graef, A.J.; Scott, M.C.; Robinson, S.; Sharkey, L.C.; O’Brien, T.D.; Dickerson, E.B.; Modiano, J.F. Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment. Exp. Cell Res. 2014, 323, 155–164. [Google Scholar] [CrossRef] [Scilit]
- Gouda, M.M.; Bhandary, Y.P. Acute Lung Injury: IL-17A-Mediated Inflammatory Pathway and Its Regulation by Curcumin. Inflammation 2019, 42, 1160–1169. [Google Scholar] [CrossRef] [Scilit]
- Bai, S.; Wang, W.; Ye, L.; Fang, L.; Dong, T.; Zhang, R.; Wang, X.; Gao, H.; Shen, B.; Ding, S. IL-17 stimulates neutrophils to release S100A8/A9 to promote lung epithelial cell apoptosis in Mycoplasma pneumoniae-induced pneumonia in children. Biomed. Pharmacother. 2021, 143, 112184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Craig, V.J.; Zhang, L.; Hagood, J.S.; Owen, C.A. Matrix metalloproteinases as therapeutic targets for idiopathic pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 2015, 53, 585–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wooff, Y.; Man, S.M.; Aggio-Bruce, R.; Natoli, R.; Fernando, N. IL-1 Family Members Mediate Cell Death, Inflammation and Angiogenesis in Retinal Degenerative Diseases. Front. Immunol. 2019, 10, 1618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baghaki, S.; Yalcin, C.E.; Baghaki, H.S.; Aydin, S.Y.; Daghan, B.; Yavuz, E. COX2 inhibition in the treatment of COVID-19: Review of literature to propose repositioning of celecoxib for randomized controlled studies. Int. J. Infect. Dis. 2020, 101, 29–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ninichuk, V.; Anders, H.J. Chemokine receptor CCR1: A new target for progressive kidney disease. Am. J. Nephrol. 2005, 25, 365–372. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.; Song, R.; Wang, Z.; Jing, Z.; Wang, S.; Ma, J. S100A8/A9 in Inflammation. Front. Immunol. 2018, 9, 1298. [Google Scholar] [CrossRef] [Scilit]
- Marinkovic, G.; Koenis, D.S.; de Camp, L.; Jablonowski, R.; Graber, N.; de Waard, V.; de Vries, C.J.; Goncalves, I.; Nilsson, J.; Jovinge, S.; et al. S100A9 Links Inflammation and Repair in Myocardial Infarction. Circ. Res. 2020, 127, 664–676. [Google Scholar] [CrossRef] [Scilit]






| Gene Name | Forward | Reverse | Product Length, bp |
|---|---|---|---|
| Gapdh | TGTGTCCGTCGTGGATCTGA | CCTGCTTCACCACCTTCTTGA | 77 |
| MMP9 | GGACCCGAAGCGGACATTG | CGTCGTCGAAATGGGCATCT | 139 |
| S100A9 | ATACTCTAGGAAGGAAGGACACC | TCCATGATGTCATTTATGAGGGC | 129 |
| IL-1B | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG | 116 |
| CCR1 | ATACTCTGGAAACACAGACTCACT | TCCTTTGCTGAGGAACTGGTC | 84 |
| KEGG Pathway | Description | Count | p Value |
|---|---|---|---|
| hsa04657 | IL-17 signaling pathway | 3 | 1.5 × 10−4 |
| hsa04668 | TNF signaling pathway | 2 | 3.36 × 10−2 |
| hsa05418 | Fluid shear stress and atherosclerosis | 2 | 3.36 × 10−2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Wu, M.; Guo, J.; Tang, Y.; Jiang, H.; Yang, B.; Wu, M.; Huang, J. Identification of S100A9 as a Potential Inflammation-Related Biomarker for Radiation-Induced Lung Injury. J. Clin. Med. 2023, 12, 733. https://doi.org/10.3390/jcm12030733
Liu Y, Wu M, Guo J, Tang Y, Jiang H, Yang B, Wu M, Huang J. Identification of S100A9 as a Potential Inflammation-Related Biomarker for Radiation-Induced Lung Injury. Journal of Clinical Medicine. 2023; 12(3):733. https://doi.org/10.3390/jcm12030733
Chicago/Turabian StyleLiu, Youyi, Mengdi Wu, Jingrou Guo, Yifei Tang, Hongliang Jiang, Bo Yang, Minchen Wu, and Jianfeng Huang. 2023. "Identification of S100A9 as a Potential Inflammation-Related Biomarker for Radiation-Induced Lung Injury" Journal of Clinical Medicine 12, no. 3: 733. https://doi.org/10.3390/jcm12030733
APA StyleLiu, Y., Wu, M., Guo, J., Tang, Y., Jiang, H., Yang, B., Wu, M., & Huang, J. (2023). Identification of S100A9 as a Potential Inflammation-Related Biomarker for Radiation-Induced Lung Injury. Journal of Clinical Medicine, 12(3), 733. https://doi.org/10.3390/jcm12030733
