Prevalence of Human Papillomavirus in the Oropharynx of Healthy Individuals in an Italian Population
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients’ Collection
2.2. DNA Purification
2.3. Primer Design
2.4. Real Time PCR
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Bosch, F.X.; Lorincz, A.; Munoz, N.; Meijer, C.J.L.M.; Shah, K.V. The causal relation between human papillomavirus and cervical cancer. J. Clin. Pathol. 2002, 55, 244–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cooper, K.; McGee, J.O.; Bolodeoku, J.; Yoshida, K.; Yeomans, P.; Wells, C.A.; Tarin, D. Human papillomavirus, integration and cervical carcinogenesis: A clinicopathological perspective. Mol. Pathol. 1997, 50, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Vuyst, H.; Clifford, G.M.; Nascimento, M.C.; Madeleine, M.M.; Franceschi, S. Prevalence and type distribution of human papillomavirus in carcinoma and intraepithelial neoplasia of the vulva, vagina and anus: A meta-analysis. Int. J. Cancer 2009, 124, 1626–1636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castellsagué, X.; Alemany, L.; Quer, M.; Halec, G.; Quirós, B.; Tous, S.; Clavero, O.; Alòs, L.; Biegner, T.; Szafarowski, T.; et al. HPV Involvement in Head and Neck Cancers: Comprehensive Assessment of Biomarkers in 3680 Patients. JNCI J. Natl. Cancer Inst. 2016, 108, djv403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morand, G.B.; Diaconescu, A.; Ibrahim, I.; Lamarche, G.; Ruas, J.S.; Dalfen, J.; Hier, M.P.; Alaoui-Jamali, M.A.; Maschietto, M.; da Silva, S.D. Molecular prognostic indicators in HPV-positive oropharyngeal cancer: An updated review. Clin. Exp. Metastasis 2022, 9, 110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaturvedi, A.K.; Engels, E.A.; Pfeiffer, R.M.; Hernandez, B.Y.; Xiao, W.; Kim, E.; Jiang, B.; Goodman, M.T.; Sibug-Saber, M.; Cozen, W.; et al. Human papillomavirus and rising oropharyngeal cancer incidence in the United States. J. Clin. Oncol. 2011, 29, 4294–4301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tumban, E. A Current Update on Human Papillomavirus-Associated Head and Neck Cancers. Viruses 2019, 11, 922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krüger, M.; Pabst, A.; Walter, C.; Sagheb, K.; Günther, C.; Blatt, S.; Weise, K.; Al-Nawas, B.; Ziebart, T. The prevalence of human papilloma virus (HPV) infections in oral squamous cell carcinomas: A retrospective analysis of 88 patients and literature overview. J. Cranio-Maxillofac. Surg. 2014, 42, 1506–1514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Doornum, G.J.; Hooykaas, C.; Juffermans, L.H.; van der Lans, S.M.; van der Linden, M.M.; Coutinho, R.A.; Quint, W.G. Prevalence of human papillomavirus infections among heterosexual men and women with multiple sexual partners. J. Med. Virol. 1992, 37, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Badaracco, G.; Venuti, A.; Di Lonardo, A.; Scambia, G.; Mozzetti, S.; Panici, P.B.; Mancuso, S.; Marcante, M.L. Concurrent HPV infection in oral and genital mucosa. J. Oral Pathol. Med. 1998, 27, 130–134. [Google Scholar] [CrossRef] [Scilit]
- Syrjänen, S. Human papillomavirus infections and oral tumors. Med. Microbiol. Immunol. 2003, 192, 123–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cañadas, M.P.; Bosch, F.X.; Junquera, M.L.; Ejarque, M.; Font, R.; Ordoñez, E.; de Sanjosé, S. Concordance of prevalence of human papillomavirus DNA in anogenital and oral infections in a high-risk population. J. Clin. Microbiol. 2004, 42, 1330–1332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giraldo, P.; Gonçalves, A.K.; Pereira, S.A.; Barros-Mazon, S.; Gondo, M.L.; Witkin, S.S. Human papillomavirus in the oral mucosa of women with genital human papillomavirus lesions. Eur. J. Obstet. Gynecol. Reprod. Biol. 2006, 126, 104–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shiboski, C.H.; Schmidt, B.L.; Jordan, R.C. Tongue and tonsil carcinoma: Increasing trends in the U.S. population ages 20–44 years. Cancer 2005, 103, 1843–1849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Attner, P.; Du, J.; Näsman, A.; Hammarstedt-Nordenvall, L.; Ramqvist, T.; Lindholm, J.; Marklund, L.; Dalianis, T.; Munck-Wikland, E. The role of human papillomavirus in the increased incidence of base of tongue cancer. Int. J. Cancer 2010, 126, 2879–2884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ernster, J.A.; Sciotto, C.G.; O’Brien, M.M.; Finch, J.L.; Robinson, L.J.; Willson, T.; Mathews, M. Rising incidence of oropharyngeal cancer and the role of oncogenic human papilloma virus. Laryngoscope 2007, 117, 2115–2128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taberna, M.; Mena, M.; Pavon, M.A.; Alemany, L.; Gillison, M.L.; Mesía, R. Human papillomavirus-related oropharyngeal cancer. Ann. Oncol. 2017, 28, 2386–2398. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pickard, R.K.L.; Xiao, W.; Broutian, T.R.; He, X.; Gillison, M.L. The prevalence and incidence of oral human papillomavirus infection among young men and women, aged 18–30 years. Sex. Transm. Dis. 2012, 39, 559–566. [Google Scholar] [CrossRef] [Scilit]
- Kreimer, A.R.; Alberg, A.J.; Daniel, R.; Gravitt, P.E.; Viscidi, R.; Garrett, E.S.; Shah, K.V.; Gillison, M.L. Oral human papillomavirus infection in adults is associated with sexual behavior and HIV serostatus. J. Infect. Dis. 2004, 189, 686–698. [Google Scholar] [CrossRef] [Scilit]
- D’Souza, G.; Agrawal, Y.; Halpern, J.; Bodison, S.; Gillison, M.L. Oral sexual behaviors associated with prevalent oral human papillomavirus infection. J. Infect. Dis. 2009, 199, 1263–1269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Edwards, S.; Carne, C. Oral sex and the transmission of viral STIs. Sex. Transm. Infect. 1998, 74, 6–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mehanna, H.; Bryant, T.S.; Babrah, J.; Louie, K.; Bryant, J.L.; Spruce, R.J.; Batis, N.; Olaleye, O.; Jones, J.; Struijk, L.; et al. Human Papillomavirus (HPV) Vaccine Effectiveness and Potential Herd Immunity for Reducing Oncogenic Oropharyngeal HPV-16 Prevalence in the United Kingdom: A Cross-sectional Study. Clin. Infect. Dis. 2018, 69, 1296–1302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehtinen, M.; Apter, D.; Eriksson, T.; Harjula, K.; Hokkanen, M.; Lehtinen, T.; Natunen, K.; Damaso, S.; Soila, M.; Bi, D.; et al. Effectiveness of the AS04-adjuvanted HPV-16/18 vaccine in reducing oropharyngeal HPV infections in young females-Results from a community-randomized trial. Int. J. Cancer 2020, 147, 170–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herrero, R.; Quint, W.; Hildesheim, A.; Gonzalez, P.; Struijk, L.; Katki, H.A.; Porras, C.; Schiffman, M.; Rodriguez, A.C.; Solomon, D.; et al. Reduced prevalence of oral human papillomavirus (HPV) 4 years after bivalent HPV vaccination in a randomized clinical trial in costa rica. PLoS ONE 2013, 8, e68329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaturvedi, A.K.; Graubard, B.I.; Broutian, T.; Pickard, R.K.L.; Tong, Z.-Y.; Xiao, W.; Kahle, L.; Gillison, M.L. Effect of Prophylactic Human Papillomavirus (HPV) Vaccination on Oral HPV Infections among Young Adults in the United States. J. Clin. Oncol. 2018, 36, 262–267. [Google Scholar] [CrossRef] [Scilit]
- Van Doorslaer, K.; Li, Z.; Xirasagar, S.; Maes, P.; Kaminsky, D.; Liou, D.; Sun, Q.; Kaur, R.; Huyen, Y.; McBride, A.A. The Papillomavirus Episteme: A major update to the papillomavirus sequence database. Nucleic Acids Res. 2017, 45, D499–D506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, K.; Li, H.; Xu, Y.; Shao, Q.; Yi, J.; Wang, R.; Cai, W.; Hang, X.; Zhang, C.; Cai, H.; et al. MFEprimer-3.0: Quality control for PCR primers. Nucleic Acids Res. 2019, 47, W610–W613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moberg, M.; Gustavsson, I.; Gyllensten, U. Real-time pcr-based system for simultaneous quantification of human papillomavirus types associated with high risk of cervical cancer. J. Clin. Microbiol. 2003, 41, 3221–3228. [Google Scholar] [CrossRef] [Scilit]
- Chaturvedi, A.K.; Engels, E.A.; Anderson, W.F.; Gillison, M.L. incidence trends for human papillomavirus–related and –unrelated oral squamous cell carcinomas in the United States. J. Clin. Oncol. 2008, 26, 612–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryerson, A.B.; Peters, E.S.; Coughlin, S.S.; Chen, V.W.; Gillison, M.L.; Reichman, M.E.; Wu, X.; Chaturvedi, A.K.; Kawaoka, K. Burden of potentially human papillomavirus-associated cancers of the oropharynx and oral cavity in the US, 1998–2003. Cancer 2008, 113, 2901–2909. [Google Scholar] [CrossRef] [Scilit]
- Marur, S.; D’Souza, G.; Westra, W.H.; Forastiere, A.A. HPV-associated head and neck cancer: A virus-related cancer epidemic. Lancet Oncol. 2010, 11, 781–789. [Google Scholar] [CrossRef] [Scilit]
- Lechner, M.; Jones, O.S.; Breeze, C.E.; Gilson, R. Gender-neutral HPV vaccination in the UK, rising male oropharyngeal cancer rates, and lack of HPV awareness. Lancet Infect. Dis. 2019, 19, 131–132. [Google Scholar] [CrossRef] [Scilit]
- Ang, K.K.; Harris, J.; Wheeler, R.; Weber, R.; Rosenthal, D.I.; Nguyen-Tân, P.F.; Westra, W.H.; Chung, C.H.; Jordan, R.C.; Lu, C.; et al. Human papillomavirus and survival of patients with oropharyngeal cancer. N. Engl. J. Med. 2010, 363, 24–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Licitra, L.; Perrone, F.; Bossi, P.; Suardi, S.; Mariani, L.; Artusi, R.; Oggionni, M.; Rossini, C.; Cantù, G.; Squadrelli, M.; et al. High-risk human papillomavirus affects prognosis in patients with surgically treated oropharyngeal squamous cell carcinoma. J. Clin. Oncol. 2006, 24, 5630–5636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hariri, S.; Unger, E.; Sternberg, M.; Dunne, E.F.; Swan, D.; Patel, S.; Markowitz, L.E. Prevalence of genital human papillomavirus among females in the United States, the National Health and Nutrition Examination Survey, 2003–2006. J. Infect. Dis. 2011, 204, 566–573. [Google Scholar] [CrossRef] [Scilit]
- Giuliano, A.R.; Lazcano-Ponce, E.; Villa, L.L.; Flores, R.; Salmerón, J.; Lee, J.-H.; Papenfuss, M.R.; Abrahamsen, M.; Jolles, E.; Nielson, C.M.; et al. The human papillomavirus infection in men study: Human papillomavirus prevalence and type distribution among men residing in Brazil, Mexico, and the United States. Cancer Epidemiol. Biomark. Prev. 2008, 17, 2036–2043. [Google Scholar] [CrossRef] [Scilit]
- Brianti, P.; De Flammineis, E.; Mercuri, S.R. Review of HPV-related diseases and cancers. New Microbiol. 2017, 40, 80–85. [Google Scholar] [PubMed]
- Mirabello, L.; Clarke, M.A.; Nelson, C.W.; Dean, M.; Wentzensen, N.; Yeager, M.; Cullen, M.; Boland, J.F.; Schiffman, M.; Burk, R.D.; et al. The Intersection of HPV Epidemiology, Genomics and Mechanistic Studies of HPV-Mediated Carcinogenesis. Viruses 2018, 10, 80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cramer, J.D.; Ferris, R.L.; Kim, S.; Duvvuri, U. Primary surgery for human papillomavirus-associated oropharyngeal cancer: Survival outcomes with or without adjuvant treatment. Oral Oncol. 2018, 87, 170–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howard, J.; Masterson, L.; Dwivedi, R.C.; Riffat, F.; Benson, R.; Jefferies, S.; Jani, P.; Tysome, J.R.; Nutting, C. Minimally invasive surgery versus radiotherapy/chemoradiotherapy for small-volume primary oropharyngeal carcinoma. Cochrane Database Syst. Rev. 2016, 12, CD010963. [Google Scholar] [CrossRef] [Scilit]
- Kellokoski, J.; Syrjänen, S.; Yliskoski, M.; Syrjänen, K. Dot blot hybridization in detection of human papillomavirus (HPV) infections in the oral cavity of women with genital HPV infections. Oral Microbiol. Immunol. 1992, 7, 19–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sasagawa, T.; Takagi, H.; Makinoda, S. Immune responses against human papillomavirus (HPV) infection and evasion of host defense in cervical cancer. J. Infect. Chemother. 2012, 18, 807–815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morán-Torres, A.; Pazos-Salazar, N.G.; Téllez-Lorenzo, S.; Jiménez-Lima, R.; Lizano, M.; Reyes-Hernández, D.O.; Marin-Aquino, J.D.J.; Manzo-Merino, J. HPV oral and oropharynx infection dynamics in young population. Braz. J. Microbiol. 2021, 52, 1991–2000. [Google Scholar] [CrossRef] [Scilit]
- Kreimer, A.R.; Bhatia, R.K.; Messeguer, A.L.; González, P.; Herrero, R.; Giuliano, A.R. Oral human papillomavirus in healthy individuals: A systematic review of the literature. Sex. Transm. Dis. 2010, 37, 386–391. [Google Scholar] [CrossRef] [Scilit]
- Kreimer, A.R.; Villa, A.; Nyitray, A.G.; Abrahamsen, M.; Papenfuss, M.; Smith, D.; Hildesheim, A.; Villa, L.L.; Lazcano-Ponce, E.; Giuliano, A.R. The epidemiology of oral HPV infection among a multinational sample of healthy men. Cancer Epidemiol. Biomark. Prev. 2011, 20, 172–182. [Google Scholar] [CrossRef] [Scilit]
- Castro, T.M.P.P.G.; Filho, I.B.; Nascimento, V.X.; Xavier, S.D. HPV detection in the oral and genital mucosa of women with positive histopathological exam for genital HPV, by means of the PCR. Braz. J. Otorhinolaryngol. 2009, 75, 167–171. [Google Scholar] [CrossRef] [Scilit]
- Gillison, M.L.; Broutian, T.; Pickard, R.K.L.; Tong, Z.-Y.; Xiao, W.; Kahle, L.; Graubard, B.I.; Chaturvedi, A.K. Prevalence of oral HPV infection in the United States, 2009–2010. JAMA 2012, 307, 693–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kreimer, A.R.; Campbell, C.M.P.; Lin, H.-Y.; Fulp, W.; Papenfuss, M.R.; Abrahamsen, M.; Hildesheim, A.; Villa, L.L.; Salmerón, J.J.; Lazcano-Ponce, E.; et al. Incidence and clearance of oral human papillomavirus infection in men: The HIM cohort study. Lancet 2013, 382, 877–887. [Google Scholar] [CrossRef] [Scilit]

| First reaction: quantification of human genome | ||
| Gene symbol | Primer sequences 5′-3′ | Probe sequences 5′-3′ |
| HMBSA | f-AAGACACGTTCCACTTTTGATTCA | AAGCCTCCGAACTGCACACAAACGTC-JOE |
| r-ACACAAAAAGAAGGCGCACTTC | ||
| Second reaction: detection of HPV 16, 18, 31, and 45 | ||
| HPV type | Primer sequences 5′-3′ | Probe sequences 5′-3′ |
| HPV16 | f-AGCTCAGAGGAGGAGGATGAA | CCAGCTGGACAAGCAGAACCGG-FAM |
| r-GGTTACAATATTGTAATGGGCTC | ||
| HPV18 | f-CATTTTGTGAACAGGCAGAGC | AGAGACAGCACAGGCATTGTTCCATG -JOE |
| r-ACTTGTGCATCATTGTGGACC | ||
| HPV31 | f-ACGATTCCACAACATAGGAGGA | CTCCAACATGCTATGCAACGTCC-CY5 |
| r-TACACTTGGGTTTCAGTACGAGGT | ||
| HPV45 | f-CATTTTGTGAACAGGCAGAGC | AGAGACAGCACAGGCATTGTTCCATG -JOE |
| r-CAACACCTGTGCATCATTCTGA | ||
| Third reaction: detection of HPV 33, 35, 39, and 58 | ||
| HPV type | Primer sequences 5′-3′ | Probe sequences 5′-3′ |
| HPV33 | f- CGTCGCAGGCGTAAACG | AGATGTCCGTGTGGCGGCCTAG-FAM |
| r-ACAGGAGGCAGGTACAC | ||
| HPV35 | f-ACCCATACCAAAGCCTGCTC | ACGACTTCGAGGGGGTACCGAGCTCCCC-JOE |
| r-GCACTGAGTCGCACTCGC | ||
| HPV39 | f-CGAGCAATTAGGAGAGTCAGAGG | AACCCGACCATGCAGTTAATCACCAAC-CY5 |
| r-TGTGTGACGCTGTGGTTCAT | ||
| HPV58 | f-GCGTCGCAGACGTAAACG | AGATGTCCGTGTGGCGGCCTAG-FAM |
| r-ACAGGAGGCAGGTACAC | ||
| Fourth reaction: detection of HPV 51, 56, and 66 | ||
| HPV type | Primer sequences 5′-3′ | Probe sequences 5′-3′ |
| HPV51 | f-CACCGCCTCCACCTTTGT | GGCGCCCAAGACGCCGCGGTATCCC-CY5 |
| r-GTGTGCGTAGGACTCTCTGG | ||
| HPV56 | f-GCTAACCTACTGGAGGACTGG | CCCCGCCAGTGGCCACCAGCCTAGA-JOE |
| r-TTCTGTTGGTGGCTGTTCCC | ||
| HPV66 | f-CACCGCCTCCACCTTTGT | GGCGCCCAAGACGCCGCGGTATCCC-FAM |
| r-GTGTGCGTAGGACTCTCTGG | ||
| Fifth reaction: detection of HPV 44, 62, 72, and 84 | ||
| HPV type | Primer sequences 5′-3′ | Probe sequences 5′-3′ |
| HPV44 | f-TGCTTCACACTCCTCCTCCT | GCACCGCCGAGGACTGCGTGGACGC-CY3 |
| r-CCTCGGGGTCGTTTACATGG | ||
| HPV62 | f-CTGGACGACCTGCACCTAAC | GACCTGTCCGCCGGTGAACTGCTGTCCT-CY5 |
| r-ACGTGTAGCTCCCGTATTGC | ||
| HPV72 | f-TCTGCAACGGACCTGTATCG | TGCAAACAGGCGGGTACCTGCCCTCCTG- FAM |
| r-AACTGGCCCACTTCAGGAAC | ||
| HPV84 | f-CAGCCCGACTCTACACAAGG | ACACCGGCCGGTTGACAGTTGCAGCAC-JOE |
| r-AGTTACTGTGTTCCCGTGGC | ||
| No | Yes | Missing Data | |||
|---|---|---|---|---|---|
| Male | 748 | 60% | 498 | 40% | 39 |
| Smoking | 801 | 64% | 446 | 36% | 39 |
| Alcohol | 781 | 63% | 466 | 37% | 39 |
| Partner | 473 | 38% | 773 | 62% | 39 |
| Individual | Tongue Base | Tonsil | Sex | Age | Smoke | Alcohol | Partner |
|---|---|---|---|---|---|---|---|
| FC95 | HPV45: 3385 copies; 0.76 HPV/cell | no sample | male | 49 | yes | yes | no |
| FC228 | HPV16: 3268 copies; 0.75 HPV/cell | no sample | male | 55 | yes | yes | no |
| FC151 | HPV18: 263 copies; 0.03 HPV/cell | no sample | male | 60 | yes | no | no |
| FC206 | HPV44: 1821 copies; 0.78 HPV/cell | negative | male | 62 | yes | yes | yes |
| Date of Birth | Age | Female | Male |
|---|---|---|---|
| 1995 | 24 | 21% | 0% |
| 1996 | 23 | 48% | 0% |
| 1997 | 22 | 65% | 1% |
| 1998 | 21 | 67% | 1% |
| 1999 | 20 | 69% | 1% |
| 2000 | 19 | 70% | 2% |
| 2001 | 18 | 70% | 3% |
| 2002 | 17 | 65% | 4% |
| 2003 | 16 | 71% | 3% |
| 2004 | 15 | 67% | 3% |
| 2005 | 14 | 60% | 6% |
| 2006 | 13 | 56% | 30% |
| 2007 | 12 | 29% | 15% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Palmieri, A.; Lauritano, D.; Pellati, A.; Scapoli, L.; Arcuri, C.; Baggi, L.; Gatto, R.; Carinci, F. Prevalence of Human Papillomavirus in the Oropharynx of Healthy Individuals in an Italian Population. J. Clin. Med. 2022, 11, 1935. https://doi.org/10.3390/jcm11071935
Palmieri A, Lauritano D, Pellati A, Scapoli L, Arcuri C, Baggi L, Gatto R, Carinci F. Prevalence of Human Papillomavirus in the Oropharynx of Healthy Individuals in an Italian Population. Journal of Clinical Medicine. 2022; 11(7):1935. https://doi.org/10.3390/jcm11071935
Chicago/Turabian StylePalmieri, Annalisa, Dorina Lauritano, Agnese Pellati, Luca Scapoli, Claudio Arcuri, Luigi Baggi, Roberto Gatto, and Francesco Carinci. 2022. "Prevalence of Human Papillomavirus in the Oropharynx of Healthy Individuals in an Italian Population" Journal of Clinical Medicine 11, no. 7: 1935. https://doi.org/10.3390/jcm11071935
APA StylePalmieri, A., Lauritano, D., Pellati, A., Scapoli, L., Arcuri, C., Baggi, L., Gatto, R., & Carinci, F. (2022). Prevalence of Human Papillomavirus in the Oropharynx of Healthy Individuals in an Italian Population. Journal of Clinical Medicine, 11(7), 1935. https://doi.org/10.3390/jcm11071935

