ABCB1 Is Frequently Methylated in Higher-Grade Gliomas and May Serve as a Diagnostic Biomarker of More Aggressive Tumors
Abstract
1. Introduction
2. Materials and Methods
2.1. Glioma Samples Characteristics
2.2. DNA Isolation from Tumor Samples
2.3. Bisulfite Conversion and Methylation-Sensitive High-Resolution Melting (MS-HRM) of ABCB1 Promoter
2.4. IDH1 Genotyping Using High-Resolution Melting Analysis (HRM)
2.5. Bisulfite Sequencing
2.6. Statistical Analysis
3. Results
3.1. Patient Sample Characteristics
3.2. HRM Genotyping and Bisulfite Sequencing Reveal IDH1 Mutated Samples
3.3. ABCB1 Methylation Is a Hallmark of Higher Grade Gliomas
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Louis, D.N.; Perry, A.; Reifenberger, G.; von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: A Summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef]
- Torp, S.H.; Solheim, O.; Skjulsvik, A.J. The WHO 2021 Classification of Central Nervous System Tumours: A Practical Update on What Neurosurgeons Need to Know-a Minireview. Acta Neurochir. 2022, 164, 2453–2464. [Google Scholar] [CrossRef]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; Ng, H.K.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A Summary. Neuro-Oncol. 2021, 23, 1231–1251. [Google Scholar] [CrossRef]
- Sun, Y.; Xiong, Z.-Y.; Yan, P.-F.; Jiang, L.-L.; Nie, C.-S.; Wang, X. Characteristics and Prognostic Factors of Age-Stratified High-Grade Intracranial Glioma Patients: A Population-Based Analysis. Bosn. J. Basic Med. Sci. 2019, 19, 375–383. [Google Scholar] [CrossRef]
- Spiegl-Kreinecker, S.; Lötsch, D.; Ghanim, B.; Pirker, C.; Mohr, T.; Laaber, M.; Weis, S.; Olschowski, A.; Webersinke, G.; Pichler, J.; et al. Prognostic Quality of Activating TERT Promoter Mutations in Glioblastoma: Interaction with the Rs2853669 Polymorphism and Patient Age at Diagnosis. Neuro-Oncol. 2015, 17, 1231–1240. [Google Scholar] [CrossRef]
- Zappe, K.; Cichna-Markl, M. Aberrant DNA Methylation of ABC Transporters in Cancer. Cells 2020, 9, 2281. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, M.; Verreault, M.; Declèves, X.; Idbaih, A. Role of Multidrug Resistance in Glioblastoma Chemoresistance: Focus on ABC Transporters. In Glioblastoma Resistance to Chemotherapy: Molecular Mechanisms and Innovative Reversal Strategies; Elsevier: Amsterdam, The Netherlands, 2021; pp. 243–261. ISBN 978-0-12-821567-8. [Google Scholar]
- Bodor, M.; Kelly, E.J.; Ho, R.J. Characterization of the Human MDR1 Gene. AAPS J. 2005, 7, E1–E5. [Google Scholar] [CrossRef] [PubMed]
- Hodges, L.M.; Markova, S.M.; Chinn, L.W.; Gow, J.M.; Kroetz, D.L.; Klein, T.E.; Altman, R.B. Very Important Pharmacogene Summary: ABCB1 (MDR1, P-Glycoprotein). Pharmacogenet. Genom. 2011, 21, 152–161. [Google Scholar] [CrossRef] [PubMed]
- Reed, K.; Hembruff, S.L.; Laberge, M.L.; Villeneuve, D.J.; Côté, G.B.; Parissenti, A.M. Hypermethylation of the ABCB1 Downstream Gene Promoter Accompanies ABCB1 Gene Amplification and Increased Expression in Docetaxel-Resistant MCF-7 Breast Tumor Cells. Epigenetics 2008, 3, 270–280. [Google Scholar] [CrossRef]
- Haenisch, S.; Zimmermann, U.; Dazert, E.; Wruck, C.J.; Dazert, P.; Siegmund, W.; Siegmund, S.; Kroemer, H.K.; Warzok, R.W.; Cascorbi, I. Influence of Polymorphisms of ABCB1 and ABCC2 on MRNA and Protein Expression in Normal and Cancerous Kidney Cortex. Pharm. J. 2007, 7, 56–65. [Google Scholar] [CrossRef]
- Ieiri, I. Functional Significance of Genetic Polymorphisms in P-Glycoprotein (MDR1, ABCB1) and Breast Cancer Resistance Protein (BCRP, ABCG2). Drug Metab. Pharmacokinet. 2012, 27, 85–105. [Google Scholar] [CrossRef]
- Schaich, M.; Kestel, L.; Pfirrmann, M.; Robel, K.; Illmer, T.; Kramer, M.; Dill, C.; Ehninger, G.; Schackert, G.; Krex, D. A MDR1 (ABCB1) Gene Single Nucleotide Polymorphism Predicts Outcome of Temozolomide Treatment in Glioblastoma Patients. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 2009, 20, 175–181. [Google Scholar] [CrossRef]
- Malmström, A.; Łysiak, M.; Åkesson, L.; Jakobsen, I.; Mudaisi, M.; Milos, P.; Hallbeck, M.; Fomichov, V.; Broholm, H.; Grunnet, K.; et al. ABCB1 Single-Nucleotide Variants and Survival in Patients with Glioblastoma Treated with Radiotherapy Concomitant with Temozolomide. Pharm. J. 2020, 20, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Henrique, R.; Oliveira, A.I.; Costa, V.L.; Baptista, T.; Martins, A.T.; Morais, A.; Oliveira, J.; Jerónimo, C. Epigenetic Regulation of MDR1 Gene through Post-Translational Histone Modifications in Prostate Cancer. BMC Genom. 2013, 14, 898. [Google Scholar] [CrossRef]
- Vaclavikova, R.; Klajic, J.; Brynychova, V.; Elsnerova, K.; Alnaes, G.I.G.; Tost, J.; Kristensen, V.N.; Rob, L.; Kodet, R.; Skapa, P.; et al. Development of High-resolution Melting Analysis for ABCB1 Promoter Methylation: Clinical Consequences in Breast and Ovarian Carcinoma. Oncol. Rep. 2019, 42, 763–774. [Google Scholar] [CrossRef]
- Li, A.; Song, J.; Lai, Q.; Liu, B.; Wang, H.; Xu, Y.; Feng, X.; Sun, X.; Du, Z. Hypermethylation of ATP-Binding Cassette B1 (ABCB1) Multidrug Resistance 1 (MDR1) Is Associated with Cisplatin Resistance in the A549 Lung Adenocarcinoma Cell Line. Int. J. Exp. Pathol. 2016, 97, 412–421. [Google Scholar] [CrossRef]
- Nakai, E.; Park, K.; Yawata, T.; Chihara, T.; Kumazawa, A.; Nakabayashi, H.; Shimizu, K. Enhanced MDR1 Expression and Chemoresistance of Cancer Stem Cells Derived from Glioblastoma. Cancer Invest. 2009, 27, 901–908. [Google Scholar] [CrossRef]
- De Gooijer, M.C.; de Vries, N.A.; Buckle, T.; Buil, L.C.M.; Beijnen, J.H.; Boogerd, W.; van Tellingen, O. Improved Brain Penetration and Antitumor Efficacy of Temozolomide by Inhibition of ABCB1 and ABCG2. Neoplasia 2018, 20, 710–720. [Google Scholar] [CrossRef]
- Goldwirt, L.; Beccaria, K.; Carpentier, A.; Farinotti, R.; Fernandez, C. Irinotecan and Temozolomide Brain Distribution: A Focus on ABCB1. Cancer Chemother. Pharmacol. 2014, 74, 185–193. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, S.-X.; Ma, J.-W.; Li, H.-Y.; Ye, J.-C.; Xie, S.-M.; Du, B.; Zhong, X.-Y. EGCG Inhibits Properties of Glioma Stem-like Cells and Synergizes with Temozolomide through Downregulation of P-Glycoprotein Inhibition. J. Neurooncol. 2015, 121, 41–52. [Google Scholar] [CrossRef] [PubMed]
- Riganti, C.; Salaroglio, I.C.; Caldera, V.; Campia, I.; Kopecka, J.; Mellai, M.; Annovazzi, L.; Bosia, A.; Ghigo, D.; Schiffer, D. Temozolomide Downregulates P-Glycoprotein Expression in Glioblastoma Stem Cells by Interfering with the Wnt3a/Glycogen Synthase-3 Kinase/β-Catenin Pathway. Neuro-Oncol. 2013, 15, 1502–1517. [Google Scholar] [CrossRef] [PubMed]
- Majidinia, M.; Mirza-Aghazadeh-Attari, M.; Rahimi, M.; Mihanfar, A.; Karimian, A.; Safa, A.; Yousefi, B. Overcoming Multidrug Resistance in Cancer: Recent Progress in Nanotechnology and New Horizons. IUBMB Life 2020, 72, 855–871. [Google Scholar] [CrossRef] [PubMed]
- Duncan, C.G.; Barwick, B.G.; Jin, G.; Rago, C.; Kapoor-Vazirani, P.; Powell, D.R.; Chi, J.-T.; Bigner, D.D.; Vertino, P.M.; Yan, H.A. Heterozygous IDH1R132H/WT Mutation Induces Genome-Wide Alterations in DNA Methylation. Genome Res. 2012, 22, 2339–2355. [Google Scholar] [CrossRef] [PubMed]
- Oberstadt, M.C.; Bien-Möller, S.; Weitmann, K.; Herzog, S.; Hentschel, K.; Rimmbach, C.; Vogelgesang, S.; Balz, E.; Fink, M.; Michael, H.; et al. Epigenetic Modulation of the Drug Resistance Genes MGMT, ABCB1 and ABCG2 in Glioblastoma Multiforme. BMC Cancer 2013, 13, 617. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, M.; Wada, M.; Harada, T.; Nagayama, J.; Kusaba, H.; Ohshima, K.; Kozuru, M.; Komatsu, H.; Ueda, R.; Kuwano, M. Hypomethylation Status of CpG Sites at the Promoter Region and Overexpression of the Human MDR1 Gene in Acute Myeloid Leukemias. Blood 1998, 92, 4296–4307. [Google Scholar] [CrossRef] [PubMed]
- Nakano, H.; Nakamura, Y.; Soda, H.; Kamikatahira, M.; Uchida, K.; Takasu, M.; Kitazaki, T.; Yamaguchi, H.; Nakatomi, K.; Yanagihara, K.; et al. Methylation Status of Breast Cancer Resistance Protein Detected by Methylation-Specific Polymerase Chain Reaction Analysis Is Correlated Inversely with Its Expression in Drug-Resistant Lung Cancer Cells. Cancer 2008, 112, 1122–1130. [Google Scholar] [CrossRef] [PubMed]
- Yokogami, K.; Yamasaki, K.; Matsumoto, F.; Yamashita, S.; Saito, K.; Tacheva, A.; Mizuguchi, A.; Watanabe, T.; Ohta, H.; Takeshima, H. Impact of PCR-Based Molecular Analysis in Daily Diagnosis for the Patient with Gliomas. Brain Tumor Pathol. 2018, 35, 141–147. [Google Scholar] [CrossRef]
- Xiao, H.; Zheng, Y.; Ma, L.; Tian, L.; Sun, Q. Clinically-Relevant ABC Transporter for Anti-Cancer Drug Resistance. Front. Pharmacol. 2021, 12, 648407. [Google Scholar] [CrossRef] [PubMed]
- Majchrzak-Celińska, A.; Dybska, E.; Barciszewska, A.-M. DNA Methylation Analysis with Methylation-Sensitive High-Resolution Melting (MS-HRM) Reveals Gene Panel for Glioma Characteristics. CNS Neurosci. Ther. 2020, 26, 1303–1314. [Google Scholar] [CrossRef] [PubMed]
- Amornpisutt, R.; Sriraksa, R.; Limpaiboon, T. Validation of Methylation-Sensitive High Resolution Melting for the Detection of DNA Methylation in Cholangiocarcinoma. Clin. Biochem. 2012, 45, 1092–1094. [Google Scholar] [CrossRef]
- Alzial, G.; Renoult, O.; Paris, F.; Gratas, C.; Clavreul, A.; Pecqueur, C. Wild-Type Isocitrate Dehydrogenase under the Spotlight in Glioblastoma. Oncogene 2022, 41, 613–621. [Google Scholar] [CrossRef] [PubMed]
- Cosnarovici, M.M.; Cosnarovici, R.V.; Piciu, D. Updates on the 2016 World Health Organization Classification of Pediatric Tumors of the Central Nervous System—A Systematic Review. Med. Pharm. Rep. 2021, 94, 282–288. [Google Scholar] [CrossRef] [PubMed]
- Majchrzak-Celińska, A.; Paluszczak, J.; Szalata, M.; Barciszewska, A.-M.; Nowak, S.; Kleszcz, R.; Sherba, A.; Baer-Dubowska, W. The Methylation of a Panel of Genes Differentiates Low-Grade from High-Grade Gliomas. Tumour Biol. J. Int. Soc. Oncodev. Biol. Med. 2015, 36, 3831–3841. [Google Scholar] [CrossRef] [PubMed]
- Majchrzak-Celińska, A.; Słocińska, M.; Barciszewska, A.-M.; Nowak, S.; Baer-Dubowska, W. Wnt Pathway Antagonists, SFRP1, SFRP2, SOX17, and PPP2R2B, Are Methylated in Gliomas and SFRP1 Methylation Predicts Shorter Survival. J. Appl. Genet. 2016, 57, 189–197. [Google Scholar] [CrossRef]
Gene | Primer | Primer Sequence (5′–3′) | Annealing Temp. (°C) | Product Size (bp) |
---|---|---|---|---|
ABCB1 | pF | AGATTTAGGAGTTTTTGGAGTAG | 56 | 101 |
pR | CTCAAAAAACAAATCCCC | |||
IDH1 | pF | GGCTTGTGAGTGGATGGGTA | 54 | 90 |
pR | GCAAAATCACATTATTGCCAAC |
No. | Histopathological Classification | WHO Grade | Sex | Age [years] | IDH1 | ABCB1 Meth. |
---|---|---|---|---|---|---|
1 | GBM | IV | M | 47 | Wild type | >10, <25 |
2 | GBM | IV | M | 67 | Wild type | >25, <75 |
3 | GBM | IV | M | 46 | Wild type | >10, <75 |
4 | GBM | IV | F | 53 | Wild type | >10, <50 |
5 | GBM | IV | M | 46 | Wild type | >10, <25 |
6 | GBM | IV | F | 63 | Heterozygous | 0 |
7 | GBM | IV | F | 63 | Heterozygous | 0 |
8 | GBM | IV | M | 60 | Wild type | >25, <100 |
9 | GBM | IV | F | 56 | Wild type | 10 |
10 | GBM | IV | F | 60 | Wild type | >10, <25 |
11 | GBM | IV | F | 56 | Wild type | >10, <25 |
12 | GBM | IV | F | 56 | Wild type | >10, <25 |
13 | GBM | IV | F | 57 | Wild type | >10, <50 |
14 | GBM | IV | M | 60 | Wild type | >25, <75 |
15 | GBM | IV | F | 54 | Wild type | >25, <75 |
16 | GBM | IV | F | 48 | Wild type | >10, <50 |
17 | GBM | IV | F | 47 | Wild type | >10, <75 |
18 | GBM | IV | M | 52 | BD | 10 |
19 | GBM | IV | F | 51 | Wild type | >25, <75 |
20 | GBM | IV | F | 47 | Wild type | 0 |
21 | GBM | IV | M | 48 | Wild type | >10, <50 |
22 | GBM | IV | M | 71 | Wild type | 0 |
23 | GBM | IV | F | 22 | Wild type | 0 |
24 | GBM | IV | F | 28 | Heterozygous | 0 |
25 | GBM | IV | F | 62 | Wild type | >10, <50 |
26 | GBM | IV | F | 62 | Wild type | 0 |
27 | GBM | IV | M | 71 | Wild type | >10, <50 |
28 | GBM | IV | F | 69 | Wild type | 0 |
29 | Gliosarcoma | IV | M | 75 | Wild type | 0 |
30 | Anaplastic astrocytoma | III | M | 53 | Heterozygous | >10, <25 |
31 | Anaplastic astrocytoma | III | F | 49 | Wild type | 10 |
32 | Anaplastic astrocytoma | III | M | 48 | Wild type | >10, <25 |
33 | Anaplastic astrocytoma | III | M | 48 | Wild type | >10, <25 |
34 | Anaplastic astrocytoma | III | M | 75 | Wild type | >10, <50 |
35 | Anaplastic glioma, recurrent | III | M | 45 | Wild type | 10 |
36 | Oligoastrocytoma | III | M | 47 | Wild type | >10, <25 |
37 | Oligoastrocytoma | III | M | 38 | Heterozygous | 0 |
38 | Oligoastrocytoma | IV | M | 55 | Wild type | >10, <50 |
39 | Oligoastrocytoma | III | F | 55 | Wild type | 10 |
40 | Oligoastrocytoma | III | M | 23 | Wild type | 0 |
41 | Oligoastrocytoma | II | F | 36 | Wild type | 0 |
42 | Anaplastic oligoastrocytoma | III | F | 45 | Heterozygous | 0 |
43 | Anaplastic oligoastrocytoma | III | F | 47 | Wild type | 10 |
44 | Anaplastic oligodendroglioma, recurrent | III | M | 57 | Wild type | >10, <50 |
45 | Anaplastic oligodendroglioma, recurrent | III | M | 31 | Heterozygous | 0 |
46 | Oligodendroglioma | III | F | 46 | Heterozygous | >10, <50 |
47 | Fibrillary astrocytoma | II | M | 50 | Heterozygous | 10 |
48 | Fibrillary astrocytoma | II | M | 50 | Heterozygous | 0 |
49 | Fibrillary astrocytoma | II | F | 29 | Heterozygous | 0 |
50 | Ganglioglioma | II | F | 21 | Wild type | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Majchrzak-Celińska, A.; Sidhu, A.; Miechowicz, I.; Nowak, W.; Barciszewska, A.-M. ABCB1 Is Frequently Methylated in Higher-Grade Gliomas and May Serve as a Diagnostic Biomarker of More Aggressive Tumors. J. Clin. Med. 2022, 11, 5655. https://doi.org/10.3390/jcm11195655
Majchrzak-Celińska A, Sidhu A, Miechowicz I, Nowak W, Barciszewska A-M. ABCB1 Is Frequently Methylated in Higher-Grade Gliomas and May Serve as a Diagnostic Biomarker of More Aggressive Tumors. Journal of Clinical Medicine. 2022; 11(19):5655. https://doi.org/10.3390/jcm11195655
Chicago/Turabian StyleMajchrzak-Celińska, Aleksandra, Arvinder Sidhu, Izabela Miechowicz, Witold Nowak, and Anna-Maria Barciszewska. 2022. "ABCB1 Is Frequently Methylated in Higher-Grade Gliomas and May Serve as a Diagnostic Biomarker of More Aggressive Tumors" Journal of Clinical Medicine 11, no. 19: 5655. https://doi.org/10.3390/jcm11195655
APA StyleMajchrzak-Celińska, A., Sidhu, A., Miechowicz, I., Nowak, W., & Barciszewska, A.-M. (2022). ABCB1 Is Frequently Methylated in Higher-Grade Gliomas and May Serve as a Diagnostic Biomarker of More Aggressive Tumors. Journal of Clinical Medicine, 11(19), 5655. https://doi.org/10.3390/jcm11195655