A Novel Splicing Mutation in the ACVRL1/ALK1 Gene as a Cause of HHT2
Abstract
:1. Introduction
2. Materials and Methods
2.1. Human Samples
2.2. Peripheral Blood Mononuclear Cells (PBMCs) Extraction
2.3. DNA Total Extraction and Sequencing
2.4. RNA Expression Analysis in Peripheral Blood Mononuclear Cells: RNA Extraction, Retrotranscription and qPCR
3. Results
3.1. Genetic Analysis of an HHT Family from Peru
3.2. Clinical Symptoms
3.3. RNA Expression Levels of ACVRL1 and ENG in Macrophages
3.4. Isolation of RNA Containing Intron IV of ACVRL1/ALK1 in the Proband
4. Discussion
5. Conclusions
- -
- A new mutation in the ACVRL1/ALK1 gene (HHT2), involving the consensus splice junction immediately after exon 4, c.525 + 1G > T, was found in a member of a large Peruvian family with a history of HHT-compatible symptoms.
- -
- Among 25 members of this family, 10 of them showed the presence of the mutation in a heterozygous condition, while 15 showed the wild-type alleles. The presence of this mutation was correlated with the clinical symptoms of HHT following Curaçao criteria.
- -
- It has been demonstrated that the mutation leads to an abnormal splicing of ACVRL1/ALK1 intron IV, since an RNA species containing exon4-intron IV-exon 5 was isolated, in addition to normal splicing in around half of the transcripts in an affected member.
- -
- We strongly recommend the screening and follow up of the affected members according to the clinical guidelines of HHT.
- -
- This manuscript may contribute to the awareness of HHT in Peru and to the creation of a reference center together with the patient association, for this rare disease in Peru.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Shovlin, C.L. Hereditary haemorrhagic telangiectasia: Pathophysiology, diagnosis and treatment. Blood Rev. 2010, 24, 203–219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faughnan, M.E.; Palda, V.A.; Garcia-Tsao, G.; Geisthoff, U.W.; McDonald, J.; Proctor, D.D.; Spears, J.; Brown, D.H.; Buscarini, E.; Chesnutt, M.S.; et al. International guidelines for the diagnosis and management of hereditary haemorrhagic telangiectasia. J. Med. Genet. 2011, 48, 73–87. [Google Scholar] [CrossRef] [PubMed]
- McDonald, J.; Bayrak-Toydemir, P.; Pyeritz, R.E. Hereditary hemorrhagic telangiectasia: An overview of diagnosis, management, and pathogenesis. Genet. Med. 2011, 13, 607–616. [Google Scholar] [CrossRef] [Green Version]
- McDonald, J.; Wooderchak-Donahue, W.; VanSant Webb, C.; Whitehead, K.; Stevenson, D.A.; Bayrak-Toydemir, P. Hereditary hemorrhagic telangiectasia: Genetics and molecular diagnostics in a new era. Front. Genet. 2015, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Faughnan, M.E.; Mager, J.J.; Hetts, S.W.; Palda, V.A.; Lang-Robertson, K.; Buscarini, E.; Deslandres, E.; Kasthuri, R.S.; Lausman, A.; Poetker, D.; et al. Second international guidelines for the diagnosis and management of hereditary hemorrhagic telangiectasia. Ann. Intern. Med. 2021, 174, 1035–1036. [Google Scholar] [CrossRef] [PubMed]
- Richards-Yutz, J.; Grant, K.; Chao, E.C.; Walther, S.E.; Ganguly, A. Update on molecular diagnosis of hereditary hemorrhagic telangiectasia. Hum. Genet. 2010, 128, 61–77. [Google Scholar] [CrossRef] [PubMed]
- Cole, S.G.; Begbie, M.E.; Wallace, G.M.F.; Shovlin, C.L.L. A new locus for hereditary haemorrhagic telangiectasia (HHT3) maps to chromosome 5. J. Med. Genet. 2005, 42, 577–582. [Google Scholar] [CrossRef]
- Bayrak-Toydemir, P.; McDonald, J.; Akarsu, N.; Toydemir, R.M.; Calderon, F.; Tuncali, T.; Tang, W.; Miller, F.; Mao, R. A fourth locus for hereditary hemorrhagic telangiectasia maps to chromosome 7. Am. J. Med. Genet. A 2006, 140, 2155–2162. [Google Scholar] [CrossRef]
- Wooderchak-Donahue, W.L.; McDonald, J.; O’Fallon, B.; Upton, P.D.; Li, W.; Roman, B.L.; Young, S.; Plant, P.; Fülöp, G.T.; Langa, C.; et al. BMP9 mutations cause a vascular-anomaly syndrome with phenotypic overlap with hereditary hemorrhagic telangiectasia. Am. J. Hum. Genet. 2013, 93, 530–537. [Google Scholar] [CrossRef] [Green Version]
- Gallione, C.; Aylsworth, A.S.; Beis, J.; Berk, T.; Bernhardt, B.; Clark, R.D.; Clericuzio, C.; Danesino, C.; Drautz, J.; Fahl, J.; et al. Overlapping spectra of SMAD4 mutations in juvenile polyposis (JP) and JP-HHT syndrome. Am. J. Med. Genet. A 2010, 152A, 333–339. [Google Scholar] [CrossRef]
- Fernandez-L, A.; Sanz-Rodriguez, F.; Zarrabeitia, R.; Perez-Molino, A.; Morales, C.; Restrepo, C.M.; Ramirez, J.R.; Coto, E.; Lenato, G.M.; Bernabeu, C.; et al. Mutation study of spanish patients with hereditary hemorrhagic telangiectasia and expression analysis of endoglin and ALK1. Hum. Mutat. 2006, 27, 295. [Google Scholar] [CrossRef] [PubMed]
- Sanger, F.; Air, G.M.; Barrell, B.G.; Brown, N.L.; Coulson, A.R.; Fiddes, J.C.; Hutchison, C.A.; Slocombe, P.M.; Smith, M. Nucleotide sequence of bacteriophage φx174 DNA. Nature 1977, 265, 687–695. [Google Scholar] [CrossRef] [PubMed]
- Marcos, S.; Botella, L.M.; Albiñana, V.; Arbia, A.; de Rosales, A.M. Sclerotherapy on demand with polidocanol to treat hht nosebleeds. J. Clin. Med. 2021, 10, 3845. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Llorente, L.; Gallardo-Vara, E.; Rossi, E.; Smadja, D.M.; Botella, L.M.; Bernabeu, C. Endoglin and alk1 as therapeutic targets for hereditary hemorrhagic telangiectasia. Expert Opin. Ther. Targets 2017, 21, 933–947. [Google Scholar] [CrossRef] [Green Version]
- Lastres, P.; Bellon, T.; Cabañas, C.; Sanchez-Madrid, F.; Acevedo, A.; Gougos, A.; Letarte, M.; Bernabeu, C. Regulated expression on human macrophages of endoglin, an Arg-Gly-Asp-containing surface antigen. Eur. J. Immunol. 1992, 22, 393–397. [Google Scholar] [CrossRef]
- Sanz-Rodriguez, F.; Fernandez-L, A.; Zarrabeitia, R.; Perez-Molino, A.; Ramírez, J.R.; Coto, E.; Bernabeu, C.; Botella, L.M. Mutation analysis in Spanish patients with hereditary hemorrhagic telangiectasia: Deficient endoglin up-regulation in activated monocytes. Clin. Chem. 2004, 50, 2003–2011. [Google Scholar] [CrossRef]
- Zevallos-Morales, A.; Murillo, A.; Dueñas-Roque, M.M.; Prötzel, A.; Venegas-Tresierra, L.; Ángeles-Villalba, V.; Guevara-Cruz, M.; Chávez-Gil, A.; Fujita, R.; Guevara-Fujita, M.L. Novel mutation in ENG gene causing hereditary hemorrhagic telangiectasia in a peruvian family. Genet. Mol. Biol. 2020, 43, e20190126. [Google Scholar] [CrossRef] [Green Version]
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gastier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. [Google Scholar] [CrossRef] [Green Version]
- Fernandez-L, A.; Sanz-Rodriguez, F.; Zarrabeitia, R.; Pérez-Molino, A.; Hebbel, R.P.; Nguyen, J.; Bernabéu, C.; Botella, L.M. Blood outgrowth endothelial cells from Hereditary Haemorrhagic Telangiectasia patients reveal abnormalities compatible with vascular lesions. Cardiovasc. Res. 2005, 68, 235–248. [Google Scholar] [CrossRef] [Green Version]
- Fernández-L, A.; Sanz-Rodriguez, F.; Blanco, F.J.; Bernabéu, C.; Botella, L.M. Hereditary hemorrhagic telangiectasia, a vascular dysplasia affecting the TGF-β signaling pathway. Clin. Med. Res. 2006, 4, 66–78. [Google Scholar] [CrossRef] [Green Version]
- Letteboer, T.G.; Mager, J.J.; Snijder, R.J.; Koeleman, B.P.; Lindhout, D.; Ploos van Amstel, J.K.; Westermann, C.J. Genotype-phenotype relationship in hereditary haemorrhagic telangiectasia. J. Med. Genet. 2006, 43, 371–377. [Google Scholar]
- Bayrak-Toydemir, P.; McDonald, J.; Markewitz, B.; Lewin, S.; Miller, F.; Chou, L.S.; Gedge, F.; Tang, W.; Coon, H.; Mao, R. Genotype-phenotype correlation in hereditary hemorrhagic telangiectasia: Mutations and manifestations. Am. J. Med. Genet. A 2006, 140, 463–470. [Google Scholar] [CrossRef] [PubMed]
- Lesca, G.; Olivieri, C.; Burnichon, N.; Pagella, F.; Carette, M.F.; Gilbert-Dussardier, B.; Goizet, C.; Roume, J.; Rabilloud, M.; Saurin, J.C.; et al. Genotype-phenotype correlations in hereditary hemorrhagic telangiectasia: Data from the French-Italian HHT network. Genet. Med. 2007, 9, 14–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]




| Gene | Fwd 5′-3′ | Rev 5′-3′ |
|---|---|---|
| 18S | CTAACACGGGAAACCTCAC | CGCTCCACCAACTAAGAACG |
| ACVRL1/ALK1 | ATCTGAGCAGGGCGACAGC | GAGGGACACCACGTCAGT |
| ENG | AGCCTCAGCCCCACAAGT | GTCACCTCGTCCCTCTCG |
| β-actin | AGCCTCGCCTTTGCCGA | CTGGTGCCTGGGGCG |
| Patient | Sex | Age | Epistaxis | Telangiectases | Avms | Screening | Other Diseases |
|---|---|---|---|---|---|---|---|
| III-1 | F | 64 | yes | Face, fingers | ---- | none | not referred |
| III-13 | M | 69 | yes | Back, face, fingers, legs, tongue, | gastric, colon | gastrointestinal endoscopy, colonoscopy | Gastric metaplasia, Anemia |
| III-14 * | M | 65 | yes | Face, fingers, Tongue | gastric, colon, liver | gastrointestinal (endoscopy, colonoscopy), brain, lung, liver, | not referred |
| III-15 | M | 64 | yes | Face, fingers, gums, tongue | gastric | Gastric endoscopy | Parkinson/PVI |
| IV-1 | M | 38 | yes | Not detected | none | not screened | not referred |
| IV-2 | F | 32 | yes | Tongue | none | not screened | not referred |
| IV-10 | F | 49 | yes | Face, fingers, lips, tongue | liver, colon | Colonoscopy, liver | not referred |
| IV-14 | F | 35 | yes | Face, fingers, tongue | none | not screened | not referred |
| IV-15 | F | 28 | yes | Not detected | none | not screened | not referred |
| IV-16 | M | 26 | yes | Chest, face, fingers, tongue | none | not screened | not referred |
| IV-17 | M | 40 | yes | Fingers | none | not screened | not referred |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Errasti Díaz, S.; Peñalva, M.; Recio-Poveda, L.; Vilches, S.; Casado-Vela, J.; Pérez Pérez, J.; Botella, L.M.; Albiñana, V.; Cuesta, A.M. A Novel Splicing Mutation in the ACVRL1/ALK1 Gene as a Cause of HHT2. J. Clin. Med. 2022, 11, 3053. https://doi.org/10.3390/jcm11113053
Errasti Díaz S, Peñalva M, Recio-Poveda L, Vilches S, Casado-Vela J, Pérez Pérez J, Botella LM, Albiñana V, Cuesta AM. A Novel Splicing Mutation in the ACVRL1/ALK1 Gene as a Cause of HHT2. Journal of Clinical Medicine. 2022; 11(11):3053. https://doi.org/10.3390/jcm11113053
Chicago/Turabian StyleErrasti Díaz, Suriel, Mercedes Peñalva, Lucía Recio-Poveda, Susana Vilches, Juan Casado-Vela, Julián Pérez Pérez, Luisa María Botella, Virginia Albiñana, and Angel M. Cuesta. 2022. "A Novel Splicing Mutation in the ACVRL1/ALK1 Gene as a Cause of HHT2" Journal of Clinical Medicine 11, no. 11: 3053. https://doi.org/10.3390/jcm11113053
APA StyleErrasti Díaz, S., Peñalva, M., Recio-Poveda, L., Vilches, S., Casado-Vela, J., Pérez Pérez, J., Botella, L. M., Albiñana, V., & Cuesta, A. M. (2022). A Novel Splicing Mutation in the ACVRL1/ALK1 Gene as a Cause of HHT2. Journal of Clinical Medicine, 11(11), 3053. https://doi.org/10.3390/jcm11113053

