The African Swine Fever Virus with MGF360 and MGF505 Deleted Reduces the Apoptosis of Porcine Alveolar Macrophages by Inhibiting the NF-κB Signaling Pathway and Interleukin-1β
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Virus
2.2. Plasmids
2.3. Reagents and Antibodies
2.4. HAD Assay
2.5. Polymerase Chain Reaction
2.6. Western Blot Analysis
2.7. Transfection and Luciferase Reporter Assays
2.8. Flow Cytometry
2.9. Statistical Analysis
3. Results
3.1. Replication of ΔCD2v/ΔMGF360-505R-ASFV in Primary Swine Macrophages
3.2. Cytopathic Effect of ΔCD2v/ΔMGF360-505R-ASFV in Primary Swine Macrophages
3.3. Apoptosis of ΔCD2v/ΔMGF360-505R-ASFV in Primary Swine Macrophages
3.4. Phospho-NF-κB p65 and p-IκB of ΔCD2v/ΔMGF360-505R-ASFV in Primary Swine Macrophages
3.5. MGF360-12L, MGF360-13L, and MGF505-2R Inhibit NF-κB Promoter
3.6. ΔCD2v/ΔMGF360-505R-ASFV Inhibits the Expression of IL-1β mRNA
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- O’Donnell, V.; Holinka, L.G.; Gladue, D.; Sanford, B.; Krug, P.W.; Lu, X.; Arzt, J.; Reese, B.; Carrillo, C.; Risatti, G.R.; et al. African Swine Fever Virus Georgia Isolate Harboring Deletions of MGF360 and MGF505 Genes Is Attenuated in Swine and Confers Protection against Challenge with Virulent Parental Virus. J. Virol. 2015, 89, 6048–6056. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dixon, L.K.; Sun, H.; Roberts, H. African swine fever. Antivir. Res. 2019, 165, 34–41. [Google Scholar] [CrossRef] [PubMed]
- Pikalo, J.; Zani, L.; Hühr, J.; Beer, M.; Blome, S. Pathogenesis of African swine fever in domestic pigs and European wild boar—Lessons learned from recent animal trials. Virus Res. 2019, 271, 197614. [Google Scholar] [CrossRef] [PubMed]
- Golding, J.P.; Goatley, L.; Goodbourn, S.; Dixon, L.K.; Taylor, G.; Netherton, C.L. Sensitivity of African swine fever virus to type I interferon is linked to genes within multigene families 360 and 505. Virology 2016, 493, 154–161. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Thomson, G.R.; Onderstepoort, J. The epidemiology of African swine fever: The role of free-living hosts in Africa. Vet. Res. 1985, 52, 201–209. [Google Scholar]
- Cisek, A.A.; Dąbrowska, I.; Gregorczyk, K.P.; Wyżewski, Z. African Swine Fever Virus: A new old enemy of Europe. Ann. Parasitol. 2016, 62, 161–167. [Google Scholar]
- Zhuo, Y.; Guo, Z.; Ba, T.; Zhang, C.; He, L.; Zeng, C.; Dai, H. African Swine Fever Virus MGF360-12L Inhibits Type I Interferon Production by Blocking the Interaction of Importin α and NF-κB Signaling Pathway. Virol. Sinic. 2021, 36, 176–186. [Google Scholar] [CrossRef]
- Zhao, D.; Liu, R.; Zhang, X.; Li, F.; Wang, J.; Zhang, J.; Liu, X.; Wang, L.; Zhang, J.; Wu, X.; et al. Replication and virulence in pigs of the first African swine fever virus isolated in China. Emerg. Microbes Infect. 2019, 8, 438–447. [Google Scholar] [CrossRef][Green Version]
- Afonso, C.L.; Piccone, M.E.; Zaffuto, K.M.; Neilan, J.; Kutish, G.F.; Lu, Z.; Balinsky, C.A.; Gibb, T.R.; Bean, T.J.; Zsak, L.; et al. African swine fever virus multigene family 360 and 530 genes affect host interferon response. J. Virol. 2004, 78, 1858–1864. [Google Scholar] [CrossRef][Green Version]
- Correia, S.; Ventura, S.; Parkhouse, R.M. Identification and utility of innate immune system evasion mechanisms of ASFV. Virus Res. 2013, 173, 87–100. [Google Scholar] [CrossRef]
- Rodriguez, J.M.; Yanez, R.J.; Almazan, F.; Vinuela, E.; Rodriguez, J.F. African swine fever virus encodes a Cd2 homolog responsible for the adhesion of erythrocytes to infected-cells. J. Virol. 1993, 67, 5312–5320. [Google Scholar] [CrossRef][Green Version]
- Goatley, L.C.; Dixon, L.K. Processing and localization of the african swine fever virus CD2v transmembrane protein. J. Virol. 2011, 85, 3294–3305. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kay-Jackson, P.C.; Goatley, L.C.; Cox, L.; Miskin, J.E.; Parkhouse, R.M.E.; Wienands, J.; Dixon, L.K. The CD2v protein of African swine fever virus interacts with the actin-binding adaptor protein SH3P7. J. Gen. Virol. 2004, 85, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Borca, M.V.; Carrillo, C.; Zsak, L.; Laegreid, W.W.; Kutish, G.F.; Neilan, J.G.; Burrage, T.G.; Rock, D.L. Deletion of a CD2-like gene, 8-DR, from African swine fever virus affects viral infection in domestic swine. J. Virol. 1998, 72, 2881–2889. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Alejo, A.; Matamoros, T.; Guerra, M.; Andres, G. A proteomic atlas of the african swine fever virus particle. J. Virol. 2018, 92, e01293-18. [Google Scholar] [CrossRef][Green Version]
- Monteagudo, P.L.; Lacasta, A.; Lopez, E.; Bosch, L.; Collado, J.; Pina-Pedrero, S.; Correa-Fiz, F.; Accensi, F.; Navas, M.J.; Vidal, E.; et al. BA71 Delta cd2: A new recombinant live attenuated african swine fever virus with cross-protective capabilities. J. Virol. 2017, 91, e01058-17. [Google Scholar] [CrossRef][Green Version]
- Almendral, J.M.; Almazán, F.; Blasco, R.; Viñuela, E. Multigene families in African swine fever virus: Family 110. J. Virol. 1990, 64, 2064–2072. [Google Scholar] [CrossRef][Green Version]
- González, A.; Calvo, V.; Almazán, F.; Almendral, J.M.; Ramírez, J.C.; de la Vega, I.; Blasco, R.; Viñuela, E. Multigene families in African swine fever virus: Family 360. J. Virol. 1990, 64, 2073–2081. [Google Scholar] [CrossRef][Green Version]
- Yozawa, T.; Kutish, G.; Afonso, C.; Lu, Z.; Rock, D. Two Novel Multigene Families, 530 and 300, in the Terminal Variable Regions of African Swine Fever Virus Genome. Virology 1994, 202, 997–1002. [Google Scholar] [CrossRef]
- Zsak, L.; Lu, Z.; Burrage, T.G.; Neilan, J.G.; Kutish, G.F.; Moore, D.M.; Rock, D.L. African Swine Fever Virus Multigene Family 360 and 530 Genes Are Novel Macrophage Host Range Determinants. J. Virol. 2001, 75, 3066–3076. [Google Scholar] [CrossRef][Green Version]
- Zsak, L.; Neilan, J.G. Regulation of Apoptosis in African Swine Fever Virus–Infected Macrophages. Sci. World J. 2002, 2, 1186–1195. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Burrage, T.G.; Lu, Z.; Neilan, J.G.; Rock, D.L.; Zsak, L. African Swine Fever Virus Multigene Family 360 Genes Affect Virus Replication and Generalization of Infection in Ornithodoros porcinus Ticks. J. Virol. 2004, 78, 2445–2453. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, 1651. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Beg, A.A.; Baltimore, D. An essential role for NF-kappaB in preventing TNF-alpha-induced cell death. Science 1996, 274, 782–784. [Google Scholar] [CrossRef]
- Dejardin, E.; Droin, N.M.; Delhase, M.; Haas, E.; Cao, Y.; Makris, C.; Li, Z.W.; Karin, M.; Ware, C.F.; Green, D.R.; et al. The lymphotoxin-beta receptor induces different patterns of gene expression via two NF-kappaB pathways. Immunity 2002, 17, 525–535. [Google Scholar] [CrossRef][Green Version]
- Bergmann, S.; Elbahesh, H. Targeting the proviral host kinase, FAK, limits influenza a virus pathogenesis and NFkB-regulated pro-inflammatory responses. Virology 2019, 534, 54–63. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, A.; Izykowska, I.; Podhorska-OkoŁów, M.; Zabel, M.; Dziegiel, P. The structure of NF-kappaB family proteins and their role in apoptosis. Postępy Hig. I Med. Doświadczalnej 2008, 62, 64–74. [Google Scholar]
- Zou, L.; Lei, H.; Shen, J.; Liu, X.; Zhang, X.; Wu, L.; Hao, J.; Jiang, W.; Hu, Z. HO-1 induced autophagy protects against IL-1 β-mediated apoptosis in human nucleus pulposus cells by inhibiting NF-κB. Aging 2020, 12, 2440–2450. [Google Scholar] [CrossRef]
- Saade, G.; Deblanc, C.; Bougon, J.; Marois-Créhan, C.; Fablet, C.; Auray, G.; Belloc, C.; Leblanc-Maridor, M.; Gagnon, CA.; Zhu, J; et al. Coinfections and their molecular consequences in the porcine respiratory tract. Vet. Res. 2020, 51, 80. [Google Scholar]
- Lau, S.K.; Chu, P.G.; Weiss, L.M. CD163: A Specific Marker of Macrophages in Paraffin-Embedded Tissue Samples. Am. J. Clin. Pathol. 2004, 122, 794–801. [Google Scholar] [CrossRef]
- Munday, J.; Floyd, H.; Crocker, P.R. Sialic acid binding receptors (siglecs) expressed by macrophages. J. Leukoc. Biol. 1999, 66, 705–711. [Google Scholar] [CrossRef]
- Breese, S.S.J.; DeBoer, C.J. Electron microscope observations of African swine fever virus in tissue culture cells. Virology 1966, 28, 420–428. [Google Scholar] [CrossRef]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African Swine Fever Virus Isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Donald, P.K.; Scott, M.R.; Geoffrey, H.H.; Sylvia, S.G.; Sylvia, J.W.; Linda, K.D.; Armanda, D.B.; Trevor, W.D. Development of a TaqMan® PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 2003, 107, 53–61. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Sabal, C.; Gustavo, A.D.; Sushil, K.; Daniel, L.R. African Swine Fever Virus CD2v Protein Induces β-Interferon Expression and Apoptosis in Swine Peripheral Blood Mononuclear Cells. Viruses 2021, 13, 1480. [Google Scholar]
- Zhuo, Y.; Guo, Z.; Ba, T.; Zhang, C.; He, L.; Zeng, C.; Dai, H. African swine fever virus MGF505-11R inhibits type I interferon production by negatively regulating the cGAS-STING-mediated signaling pathway. Vet. Microbiol. 2021, 263, 109265. [Google Scholar]
- Krug, P.W.; Holinka, L.G.; O’Donnell, V.; Reese, B.; Sanford, B.; Fernandez-Sainz, I.; Gladue, D.; Arzt, J.; Rodriguez, L.; Risatti, G.R.; et al. The Progressive Adaptation of a Georgian Isolate of African Swine Fever Virus to Vero Cells Leads to a Gradual Attenuation of Virulence in Swine Corresponding to Major Modifications of the Viral Genome. J. Virol. 2014, 89, 2324–2332. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Dixon, L.K.; Islam, M.; Nash, R.; Reis, A.L. African swine fever virus evasion of host defences. Virus Res. 2019, 266, 25–33. [Google Scholar] [CrossRef]
- Haig, D.M. Subversion and piracy: DNA viruses and immune evasion. Res. Vet. Sci. 2001, 70, 205–219. [Google Scholar] [CrossRef]
- Janeway, C.A.; Medzhitov, R. Innate immune recognition. Ann. Rev. Immunol. 2002, 20, 197–216. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Benedict, C.A.; Norris, P.S.; Ware, C.F. To kill or be killed: Viral evasion of apoptosis. Nat. Immunol. 2002, 3, 1013–1018. [Google Scholar] [CrossRef] [PubMed]
- Ramiro-Ibáñez, F.; Ortega, A.; Escribano, J.M.; Alonso, C. Apoptosis: A Mechanism of Cell Killing and Lymphoid Organ Impairment during Acute African Swine Fever Virus Infection. J. Gen. Virol. 1996, 77, 2209–2219. [Google Scholar] [CrossRef] [PubMed]
- Hernaez, B.; Escribano, J.M.; Alonso, C. Visualization of the African swine fever virus infection in living cells by incorporation into the virus particle of green fluorescent protein-p54 membrane protein chimera. Virology 2006, 350, 1–14. [Google Scholar] [CrossRef][Green Version]
- Galindo, I.; Alonso, C. African Swine Fever Virus: A Review. Viruses 2017, 9, 103. [Google Scholar] [CrossRef][Green Version]
- Hilbi, H.; Zychlinsky, A.; Sansonetti, P.J. Macrophage apoptosis in microbial infections. Parasitology 1997, 115, 79–87. [Google Scholar] [CrossRef]
- Reis, A.L.; Abrams, C.C.; Goatley, L.C.; Netherton, C.; Chapman, D.G.; Cordón, P.S.; Dixon, L.K. Deletion of African swine fever virus interferon inhibitors from the genome of a virulent isolate reduces virulence in domestic pigs and induces a protective response. Vaccine 2016, 34, 4698–4705. [Google Scholar] [CrossRef][Green Version]
- Zhang, B.; Lu, Y.; Campbell-Thompson, M.; Spencer, T.; Song, S. Alpha1-antitrypsin protects beta-cells from apoptosis. Diabetes 2007, 56, 1316–1323. [Google Scholar] [CrossRef][Green Version]
- Roy, D.; Sarkar, S.; Felty, Q. Levels of IL-1 beta control stimulatory/inhibitory growth of cancer cells. Front. Biosci. 2006, 11, 889–898. [Google Scholar] [CrossRef][Green Version]
Gene | Primer Sequence (5′–3′) |
---|---|
CADC-B646L-rPCRF | ATAGAGATACAGCTCTTCCAG |
CADC-B646L-rPCRR | GTATGTAAGAGCTGCAGAAC |
CADC-B646L-Probe | FAM-TATCGATAAGATTGAT-MGB |
B646L-F | TGAAATAAAATGGAAGCCCACAGATC |
B646L-R | ACACTGTACAACATTGCGTAAAAGC |
GAPDH-F | GCAAAGACTGAACCCACTAATT |
GAPDH-R | TTGCCTCTGTTGTTACTTGGAG |
IL-1β-F | ACCTGGACCTTGGTTCTCTG |
IL-1β-R | CATCTGCCTGATGCTCTTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, Q.; Yang, Y.; Quan, W.; Zheng, J.; Luo, Y.; Wang, H.; Chen, X.; Huang, Z.; Chen, X.; Xu, R.; et al. The African Swine Fever Virus with MGF360 and MGF505 Deleted Reduces the Apoptosis of Porcine Alveolar Macrophages by Inhibiting the NF-κB Signaling Pathway and Interleukin-1β. Vaccines 2021, 9, 1371. https://doi.org/10.3390/vaccines9111371
Gao Q, Yang Y, Quan W, Zheng J, Luo Y, Wang H, Chen X, Huang Z, Chen X, Xu R, et al. The African Swine Fever Virus with MGF360 and MGF505 Deleted Reduces the Apoptosis of Porcine Alveolar Macrophages by Inhibiting the NF-κB Signaling Pathway and Interleukin-1β. Vaccines. 2021; 9(11):1371. https://doi.org/10.3390/vaccines9111371
Chicago/Turabian StyleGao, Qi, Yunlong Yang, Weipeng Quan, Jiachen Zheng, Yizhuo Luo, Heng Wang, Xiongnan Chen, Zhao Huang, Xiaojun Chen, Runda Xu, and et al. 2021. "The African Swine Fever Virus with MGF360 and MGF505 Deleted Reduces the Apoptosis of Porcine Alveolar Macrophages by Inhibiting the NF-κB Signaling Pathway and Interleukin-1β" Vaccines 9, no. 11: 1371. https://doi.org/10.3390/vaccines9111371