Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of Recombinant Turkey Herpesvirus Expressing NDV F Protein
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Viruses, and Cell Culture
2.2. Construction of sgRNAs, Donor Plasmids, and Recombinant Viruses
2.3. Immunofluorescence and Western Blot
2.4. Stability and Growth Properties of the Recombinant Viruses
2.5. Animal Experiments
2.6. Serological Tests
2.7. Detection of Viral Shedding
2.8. Statistical Analysis
3. Results
3.1. Construction of rHVT-005/006-F and rHVT-US2-F
3.2. Characterization of the rHVT-005/006-F and rHVT-US2-F In Vitro
3.3. Humoral Immune Response to Vaccination in SPF Chickens
3.4. Protective Efficacy of rHVT-005/006-F and rHVT-US2-F in Chickens
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cattoli, G.; Susta, L.; Terregino, C.; Brown, C. Newcastle disease: A review of field recognition and current methods of laboratory detection. J. Vet. Diagn. Investig. 2011, 23, 637–656. [Google Scholar] [CrossRef]
- International Committee on Taxonomy of Viruses (ICTV). Current ICTV Taxonomy Release. Available online: https://ictv.global/taxonomy (accessed on 5 May 2024).
- Linde, A.M.; Munir, M.; Zohari, S.; Ståhl, K.; Baule, C.; Renström, L.; Berg, M. Complete genome characterisation of a Newcastle disease virus isolated during an outbreak in Sweden in 1997. Virus Genes 2010, 41, 165–173. [Google Scholar] [CrossRef]
- Yusoff, K.; Tan, W.S. Newcastle disease virus: Macromolecules and opportunities. Avian Pathol. 2001, 30, 439–455. [Google Scholar] [CrossRef]
- El Najjar, F.; Schmitt, A.P.; Dutch, R.E. Paramyxovirus glycoprotein incorporation, assembly and budding: A three way dance for infectious particle production. Viruses 2014, 6, 3019–3054. [Google Scholar] [CrossRef]
- Morgan, R.W.; Gelb, J., Jr.; Schreurs, C.S.; Lütticken, D.; Rosenberger, J.K.; Sondermeijer, P.J. Protection of chickens from Newcastle and Marek’s diseases with a recombinant herpesvirus of turkeys vaccine expressing the Newcastle disease virus fusion protein. Avian Dis. 1992, 36, 858–870. [Google Scholar] [CrossRef]
- Diel, D.G.; da Silva, L.H.; Liu, H.; Wang, Z.; Miller, P.J.; Afonso, C.L. Genetic diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and classification system of Newcastle disease virus genotypes. Infect. Genet. Evol. 2012, 12, 1770–1779. [Google Scholar] [CrossRef]
- Dimitrov, K.M.; Abolnik, C.; Afonso, C.L.; Albina, E.; Bahl, J.; Berg, M.; Briand, F.X.; Brown, I.H.; Choi, K.S.; Chvala, I.; et al. Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus. Infect. Genet. Evol. 2019, 74, 103917. [Google Scholar] [CrossRef]
- Xiang, B.; Chen, L.; Cai, J.; Liang, J.; Lin, Q.; Xu, C.; Ding, C.; Liao, M.; Ren, T. Insights into Genomic Epidemiology, Evolution, and Transmission Dynamics of Genotype VII of Class II Newcastle Disease Virus in China. Pathogens 2020, 9, 837. [Google Scholar] [CrossRef]
- Dimitrov, K.M.; Afonso, C.L.; Yu, Q.; Miller, P.J. Newcastle disease vaccines-A solved problem or a continuous challenge? Vet. Microbiol. 2017, 206, 126–136. [Google Scholar] [CrossRef]
- Tsukamoto, K.; Saito, S.; Saeki, S.; Sato, T.; Tanimura, N.; Isobe, T.; Mase, M.; Imada, T.; Yuasa, N.; Yamaguchi, S. Complete, long-lasting protection against lethal infectious bursal disease virus challenge by a single vaccination with an avian herpesvirus vector expressing VP2 antigens. J. Virol. 2002, 76, 5637–5645. [Google Scholar] [CrossRef]
- Le Gros, F.X.; Dancer, A.; Giacomini, C.; Pizzoni, L.; Bublot, M.; Graziani, M.; Prandini, F. Field efficacy trial of a novel HVT-IBD vector vaccine for 1-day-old broilers. Vaccine 2009, 27, 592–596. [Google Scholar] [CrossRef]
- van Hulten, M.C.W.; Cruz-Coy, J.; Gergen, L.; Pouwels, H.; Ten Dam, G.B.; Verstegen, I.; de Groof, A.; Morsey, M.; Tarpey, I. Efficacy of a turkey herpesvirus double construct vaccine (HVT-ND-IBD) against challenge with different strains of Newcastle disease, infectious bursal disease and Marek’s disease viruses. Avian Pathol. 2021, 50, 18–30. [Google Scholar] [CrossRef]
- Maekawa, D.; Beltrán, G.; Riblet, S.M.; García, M. Protection Efficacy of a Recombinant Herpesvirus of Turkey Vaccine Against Infectious Laryngotracheitis Virus Administered In Ovo to Broilers at Three Standardized Doses. Avian Dis. 2019, 63, 351–358. [Google Scholar] [CrossRef]
- Gao, H.; Cui, H.; Cui, X.; Shi, X.; Zhao, Y.; Zhao, X.; Quan, Y.; Yan, S.; Zeng, W.; Wang, Y. Expression of HA of HPAI H5N1 virus at US2 gene insertion site of turkey herpesvirus induced better protection than that at US10 gene insertion site. PLoS ONE 2011, 6, e22549. [Google Scholar] [CrossRef]
- Reemers, S.; Verstegen, I.; Basten, S.; Hubers, W.; van de Zande, S. A broad spectrum HVT-H5 avian influenza vector vaccine which induces a rapid onset of immunity. Vaccine 2021, 39, 1072–1079. [Google Scholar] [CrossRef]
- Rauw, F.; Gardin, Y.; Palya, V.; Anbari, S.; Lemaire, S.; Boschmans, M.; van den Berg, T.; Lambrecht, B. Improved vaccination against Newcastle disease by an in ovo recombinant HVT-ND combined with an adjuvanted live vaccine at day-old. Vaccine 2010, 28, 823–833. [Google Scholar] [CrossRef]
- Palya, V.; Kiss, I.; Tatár-Kis, T.; Mató, T.; Felföldi, B.; Gardin, Y. Advancement in vaccination against Newcastle disease: Recombinant HVT NDV provides high clinical protection and reduces challenge virus shedding with the absence of vaccine reactions. Avian Dis. 2012, 56, 282–287. [Google Scholar] [CrossRef]
- Rauw, F.; Gardin, Y.; Palya, V.; van den Berg, T.; Lambrecht, B. The combination of attenuated Newcastle disease (ND) vaccine with rHVT-ND vaccine at 1 day old is more protective against ND virus challenge than when combined with inactivated ND vaccine. Avian Pathol. 2014, 43, 26–36. [Google Scholar] [CrossRef]
- Sedeik, M.E.; El-Shall, N.A.; Awad, A.M.; Abd El-Hack, M.E.; Alowaimer, A.N.; Swelum, A.A. Comparative Evaluation of HVT-IBD Vector, Immune Complex, and Live IBD Vaccines against vvIBDV in Commercial Broiler Chickens with High Maternally Derived Antibodies. Animals 2019, 9, 72. [Google Scholar] [CrossRef]
- Perozo, F.; Villegas, A.P.; Fernandez, R.; Cruz, J.; Pritchard, N. Efficacy of single dose recombinant herpesvirus of turkey infectious bursal disease virus (IBDV) vaccination against a variant IBDV strain. Avian Dis. 2009, 53, 624–628. [Google Scholar] [CrossRef]
- Sedeik, M.E.; Awad, A.M.; El-Shall, N.A. Heterologous prime-boost vaccination programs against Newcastle disease virus genotype VII in chickens. Comp. Immunol. Microbiol. Infect. Dis. 2022, 87, 101836. [Google Scholar] [CrossRef]
- Li, Y.; Rehman, Z.U.; Li, M.; Manzoor, Z.; Liu, W.; Qiu, X.; Sun, Y.; Liao, Y.; Tan, L.; Song, C.; et al. Comparison of the protective antigen variabilities of prevalent Newcastle disease viruses in response to homologous/heterologous genotype vaccines. Poult. Sci. 2021, 100, 101267. [Google Scholar] [CrossRef]
- Yang, H.M.; Zhao, J.; Xue, J.; Yang, Y.L.; Zhang, G.Z. Antigenic variation of LaSota and genotype VII Newcastle disease virus (NDV) and their efficacy against challenge with velogenic NDV. Vaccine 2017, 35, 27–32. [Google Scholar] [CrossRef]
- Jia, W.; Zhang, X.; Wang, H.; Teng, Q.; Xue, J.; Zhang, G. Construction and immune efficacy of a recombinant turkey herpesvirus vaccine strain expressing fusion protein of genotype VII Newcastle disease virus. Vet. Microbiol. 2022, 268, 109429. [Google Scholar] [CrossRef]
- Calderón, K.; Rojas-Neyra, A.; Carbajal-Lévano, B.; Luján-Valenzuela, L.; Ticona, J.; Isasi-Rivas, G.; Montalvan, A.; Criollo-Orozco, M.; Huaccachi-Gonzáles, E.; Tataje-Lavanda, L.; et al. A Recombinant Turkey Herpesvirus Expressing the F Protein of Newcastle Disease Virus Genotype XII Generated by NHEJ-CRISPR/Cas9 and Cre-LoxP Systems Confers Protection against Genotype XII Challenge in Chickens. Viruses 2022, 14, 793. [Google Scholar] [CrossRef]
- Andoh, K.; Yamazaki, K.; Honda, Y.; Honda, T. Turkey herpesvirus with an insertion in the UL3-4 region displays an appropriate balance between growth activity and antibody-eliciting capacity and is suitable for the establishment of a recombinant vaccine. Arch. Virol. 2017, 162, 931–941. [Google Scholar] [CrossRef]
- Zai, X.; Shi, B.; Shao, H.; Qian, K.; Ye, J.; Yao, Y.; Nair, V.; Qin, A. Identification of a Novel Insertion Site HVT-005/006 for the Generation of Recombinant Turkey Herpesvirus Vector. Front. Microbiol. 2022, 13, 886873. [Google Scholar] [CrossRef]
- Sun, J.; Han, Z.; Zhao, R.; Ai, H.; Chen, L.; Li, L.; Liu, S. Protection of chicks from Newcastle disease by combined vaccination with a plasmid DNA and the pre-fusion protein of the virulent genotype VII of Newcastle disease virus. Vaccine 2020, 38, 7337–7349. [Google Scholar] [CrossRef]
- Abdelaziz, A.M.; Mohamed, M.H.A.; Fayez, M.M.; Al-Marri, T.; Qasim, I.; Al-Amer, A.A. Molecular survey and interaction of common respiratory pathogens in chicken flocks (field perspective). Vet. World 2019, 12, 1975–1986. [Google Scholar] [CrossRef]
- Becerra, R.; Maekawa, D.; García, M. Protection Efficacy of Recombinant HVT-ND-LT and the Live Attenuated Tissue Culture Origin Vaccines Against Infectious Laryngotracheitis Virus When Administered Individually or in Combination. Avian Dis. 2023, 67, 145–152. [Google Scholar] [CrossRef]
- Ding, L.; Chen, P.; Bao, X.; Li, A.; Jiang, Y.; Hu, Y.; Ge, J.; Zhao, Y.; Wang, B.; Liu, J.; et al. Recombinant duck enteritis viruses expressing the Newcastle disease virus (NDV) F gene protects chickens from lethal NDV challenge. Vet. Microbiol. 2019, 232, 146–150. [Google Scholar] [CrossRef]
- Hein, R.; Koopman, R.; García, M.; Armour, N.; Dunn, J.R.; Barbosa, T.; Martinez, A. Review of Poultry Recombinant Vector Vaccines. Avian Dis. 2021, 65, 438–452. [Google Scholar] [CrossRef]
- Rauw, F.; Ngabirano, E.; Gardin, Y.; Palya, V.; Lambrecht, B. Effectiveness of a Simultaneous rHVT-F(ND) and rHVT-H5(AI) Vaccination of Day-Old Chickens and the Influence of NDV- and AIV-Specific MDA on Immune Response and Conferred Protection. Vaccines 2020, 8, 536. [Google Scholar] [CrossRef]
- Palya, V.; Tatár-Kis, T.; Mató, T.; Felföldi, B.; Kovács, E.; Gardin, Y. Onset and long-term duration of immunity provided by a single vaccination with a turkey herpesvirus vector ND vaccine in commercial layers. Vet. Immunol. Immunopathol. 2014, 158, 105–115. [Google Scholar] [CrossRef]
- Zai, X.; Shi, B.; Shao, H.; Qian, K.; Ye, J.; Yao, Y.; Nair, V.; Qin, A. Recombinant Turkey Herpesvirus Expressing H9N2 HA Gene at the HVT005/006 Site Induces Better Protection Than That at the HVT029/031 Site. Viruses 2022, 14, 2495. [Google Scholar] [CrossRef]
- Miller, P.J.; King, D.J.; Afonso, C.L.; Suarez, D.L. Antigenic differences among Newcastle disease virus strains of different genotypes used in vaccine formulation affect viral shedding after a virulent challenge. Vaccine 2007, 25, 7238–7246. [Google Scholar] [CrossRef]
- Miller, P.J.; Estevez, C.; Yu, Q.; Suarez, D.L.; King, D.J. Comparison of viral shedding following vaccination with inactivated and live Newcastle disease vaccines formulated with wild-type and recombinant viruses. Avian Dis. 2009, 53, 39–49. [Google Scholar] [CrossRef]
- Palya, V.; Tatár-Kis, T.; Arafa, A.S.A.; Felföldi, B.; Mató, T.; Setta, A. Efficacy of a Turkey Herpesvirus Vectored Newcastle Disease Vaccine against Genotype VII.1.1 Virus: Challenge Route Affects Shedding Pattern. Vaccines 2021, 9, 37. [Google Scholar] [CrossRef]
- Karaca, K.; Sharma, J.M.; Winslow, B.J.; Junker, D.E.; Reddy, S.; Cochran, M.; McMillen, J. Recombinant fowlpox viruses coexpressing chicken type I IFN and Newcastle disease virus HN and F genes: Influence of IFN on protective efficacy and humoral responses of chickens following in ovo or post-hatch administration of recombinant viruses. Vaccine 1998, 16, 1496–1503. [Google Scholar] [CrossRef]
- Ge, J.; Liu, Y.; Jin, L.; Gao, D.; Bai, C.; Ping, W. Construction of recombinant baculovirus vaccines for Newcastle disease virus and an assessment of their immunogenicity. J. Biotechnol. 2016, 231, 201–211. [Google Scholar] [CrossRef]
- Reddy, S.K.; Sharma, J.M.; Ahmad, J.; Reddy, D.N.; McMillen, J.K.; Cook, S.M.; Wild, M.A.; Schwartz, R.D. Protective efficacy of a recombinant herpesvirus of turkeys as an in ovo vaccine against Newcastle and Marek’s diseases in specific-pathogen-free chickens. Vaccine 1996, 14, 469–477. [Google Scholar] [CrossRef]
- Śmietanka, K.; Tyborowska, J.; Olszewska-Tomczyk, M.; Domańska-Blicharz, K.; Minta, Z.; Rabalski, L.; Czarnota, A.; Kucharczyk, K.; Szewczyk, B. A Recombinant Turkey Herpesvirus Expressing F and HN Genes of Avian Avulavirus-1 (AAvV-1) Genotype VI Confers Cross-Protection against Challenge with Virulent AAvV-1 Genotypes IV and VII in Chickens. Viruses 2019, 11, 784. [Google Scholar] [CrossRef]
- Panda, A.; Huang, Z.; Elankumaran, S.; Rockemann, D.D.; Samal, S.K. Role of fusion protein cleavage site in the virulence of Newcastle disease virus. Microb. Pathog. 2004, 36, 1–10. [Google Scholar] [CrossRef]
- Manoharan, V.K.; Varghese, B.P.; Paldurai, A.; Samal, S.K. Effect of fusion protein cleavage site sequence on generation of a genotype VII Newcastle disease virus vaccine. PLoS ONE 2018, 13, e0197253. [Google Scholar] [CrossRef]
- Ghanem, I.A.E.; Abdullatif, T.M.; Hassanin, O. The protection conferred against virulent Newcastle disease virus (vNDV) genotype VII by commercial double recombinant HVT vaccines and NDV live-attenuated vaccine as prime/boost vaccination regimens in commercial broiler chickens carrying maternally-derived antibodies (MDAs) against NDV. Avian Pathol. 2023, 52, 251–263. [Google Scholar] [CrossRef]
- Bublot, M.; Pritchard, N.; Le Gros, F.X.; Goutebroze, S. Use of a vectored vaccine against infectious bursal disease of chickens in the face of high-titred maternally derived antibody. J. Comp. Pathol. 2007, 137 (Suppl. S1), S81–S84. [Google Scholar] [CrossRef]
- Ferreira, H.L.; Reilley, A.M.; Goldenberg, D.; Ortiz, I.R.A.; Gallardo, R.A.; Suarez, D.L. Protection conferred by commercial NDV live attenuated and double recombinant HVT vaccines against virulent California 2018 Newcastle disease virus (NDV) in chickens. Vaccine 2020, 38, 5507–5515. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′-3′) | Product Size |
---|---|---|
NotI-NDV F-F | ATTTGCGGCCGCATGGGCTCCAAACTTTCTACCA | 1686 bp |
NotI-NDV F-R | ATTTGCGGCCGCTCATGCTCTTGTAGTGGCTCTCA | |
HVT-US2-F | ATGGGTGTGTGCATGATAACT | 142 bp (HVT) or 3521 bp (rHVT-US2-F) |
HVT-US2-R | GCACACCCACATCATTCTTCA | |
HVT-005/006-F | TCGTTTGCGCGTAGTAACATT | 347 bp (HVT) or 3726 bp (rHVT-005/006-F) |
HVT-005/006-R | TAACTGTGAGCAATGCAGGGG | |
sgA-F | CACCGAGATCGAGTGCCGCATCAC | Not applicable |
sgA-R | AAACGTGATGCGGCACTCGATCTC | |
HVTUS2-sg1-F | CACCGTGACGCTGCCTCCACCCTA | |
HVTUS2-sg1-R | AAACTAGGGTGGAGGCAGCGTCAC | |
HVT005/006-sg2-F | CACCGCATATACTGAATCGTAGGG | |
HVT005/006-sg2-R | AAACCCCTACGATTCAGTATATGC |
Challenge Period | Group | Virus Shedding | Incidence Rate | Mortality Rate | |||
---|---|---|---|---|---|---|---|
3 dpc | 5 dpc | 7 dpc | 10 dpc | ||||
4 wpv | Control | 0/10 | 0/10 | 0/10 | 0/10 | 0% | 0% |
NDV F48E8 | 8/8 | - | - | - | 100% | 100% | |
rHVT-005/006-F | 0/10 | 0/10 | 0/10 | 0/10 | 0% | 0% | |
rHVT-US2-F | 0/10 | 0/10 | 0/10 | 0/10 | 0% | 0% | |
12 wpv | Control | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% |
NDV F48E8 | 5/5 | - | - | - | 100% | 100% | |
rHVT-005/006-F | 0/5 | 1/5 | 0/5 | 0/5 | 0% | 0% | |
rHVT-US2-F | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% | |
20 wpv | Control | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% |
NDV F48E8 | 5/5 | - | - | - | 100% | 100% | |
rHVT-005/006-F | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% | |
rHVT-US2-F | 0/5 | 0/5 | 0/5 | 0/10 | 0% | 0% | |
52 wpv | Control | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% |
NDV F48E8 | 5/5 | - | - | - | 100% | 100% | |
rHVT-005/006-F | 0/5 | 0/5 | 0/5 | 0/5 | 0% | 0% | |
rHVT-US2-F | 0/5 | 2/5 | 2/5 | 0/5 | 0% | 0% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, B.; Yang, G.; Xiao, Y.; Qian, K.; Shao, H.; Xu, M.; Qin, A. Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of Recombinant Turkey Herpesvirus Expressing NDV F Protein. Vaccines 2024, 12, 604. https://doi.org/10.3390/vaccines12060604
Shi B, Yang G, Xiao Y, Qian K, Shao H, Xu M, Qin A. Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of Recombinant Turkey Herpesvirus Expressing NDV F Protein. Vaccines. 2024; 12(6):604. https://doi.org/10.3390/vaccines12060604
Chicago/Turabian StyleShi, Bin, Guifu Yang, Yue Xiao, Kun Qian, Hongxia Shao, Moru Xu, and Aijian Qin. 2024. "Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of Recombinant Turkey Herpesvirus Expressing NDV F Protein" Vaccines 12, no. 6: 604. https://doi.org/10.3390/vaccines12060604
APA StyleShi, B., Yang, G., Xiao, Y., Qian, K., Shao, H., Xu, M., & Qin, A. (2024). Long-Term Protection against Virulent Newcastle Disease Virus (NDV) in Chickens Immunized with a Single Dose of Recombinant Turkey Herpesvirus Expressing NDV F Protein. Vaccines, 12(6), 604. https://doi.org/10.3390/vaccines12060604